close

Вход

Забыли?

вход по аккаунту

?

467

код для вставкиСкачать

Yeast 15, 73–79 (1999)
Disruption of Six Novel Genes from the Left Arm of
Chromosome XV of Saccharomyces cerevisiae and Basic
Phenotypic Analysis of the Generated Mutants
KARIN SE
u RON1, MARIE-ODILE BLONDEL1 AND ROSINE HAGUENAUER-TSAPIS1*
1
Institut Jacques Monod, CNRS-UMRC7592, Université Paris 7–Denis Diderot, 2 place Jussieu, 75251 Paris cedex
05, France
Six open reading frames (ORFs) of unknown function from the left arm of Saccharomyces cerevisiae chromosome
XV were deleted in two genetic backgrounds by disruption cassettes with long flanking homology (LFH) (Wach,
1996), within the frame of the research project EUROFAN. The LFH disruption cassettes, obtained by PCR, were
made by introducing the kanMX4 marker module between two fragments homologous to the promoter and
terminator regions of a given ORF. Transformants resistant to geneticin (G418) were selected. The LFH disruption
cassettes were cloned in a bacterial vector. Each cognate gene was also cloned in a centromeric plasmid. Correct
deletion of each gene was verified by four different PCR reactions. Sporulation and tetrad analysis of heterozygous
deletants revealed that ORF YOL102c is essential. The non-growing haploid spores gave rise to microcolonies. Basic
phenotypic analyses were performed on haploid deletants of both mating types of the five non-essential ORFs,
YOL018c, YOL098c, YOL101c, YOL104c and YOL105c. Plate growth tests on different media at 15C, 30C or
37C did not reveal any significant differences between parental and mutant cells. Mating and sporulation efficiencies
were not affected in any of the viable disruptants as compared to wild-type cells. Copyright 1999 John Wiley &
Sons, Ltd.
  — EUROFAN 6-pack analysis; chromosome XV
INTRODUCTION
Systematic sequencing of the Saccharomyces cerevisiae genome (Goffeau et al., 1996) reveals the
presence of about 30% of ORFs of unknown
function (Dujon, 1996). The aim of a European
network, designated EUROFAN, is to elucidate
the function of 1000 of these novel genes (Oliver,
1996). A set of six genes were allocated to us on the
left arm of chromosome XV. The approach which
was chosen by EUROFAN to study the function
of these genes was to disrupt each one in two
different genetic backgrounds and to perform a
basic phenotypic analysis of the mutants. The
*Correspondence to: Dr R. Haguenauer-Tsapis, Institut
Jacques Monod, CNRS-UMRC7592, Université Paris 7-Denis
Diderot, 2 Place Jussieu, 75251 Paris Cedex 5, France. E-mail:
[email protected]
CCC 0749–503X/99/010073–07 $17.50
Copyright 1999 John Wiley & Sons, Ltd.
method used for the disruption is based on PCR
and the creation of disruption cassettes with long
flanking homologies (LFH; Wach, 1996). According to the EUROFAN guideline, a cognate clone
and the LFH disruption cassette have to be created
for each ORF. This paper describes the creation of
disruptants for our six-pack, basic phenotypic
analysis and the cloning of the cognate genes and
disruption cassettes.
MATERIALS AND METHODS
Strains, media and plasmids
The Escherichia coli strains DH5á and JM109
were used as plasmid hosts. For selective growth,
the bacteria were grown on LB containing
Received 20 May 1998
Accepted 24 July 1998
74
100 mg/l of ampicillin. DNA manipulation including plasmid preparation, subcloning and transformation followed standard protocols (Sambrook
et al., 1989).
As S. cerevisiae strains, we used the EUROFAN
reference strains FY1679 (a/á ura3-52/ura3-52
leu2Ä1/+trp1Ä63/+his3Ä200/+) and W303 (a/á
ura3-1/ura3-1 leu2-3,112/leu2-3,112 trp1-1/trp1-1
his3-11,15/his3-11,15 ade2-1/ade2-1 can1-100/can1100). For routine culture, yeast cells were grown
on 2% yeast extract, 1% peptone and 2% glucose
(YPD). Rich medium containing 2% glycerol
(YPG) instead of 2% glucose was used to test
growth on a non-fermentable carbon source. Synthetic complete medium (YNB; 0·67% w/v yeast
nitrogen base without amino acids, Difco) was
supplemented with 2% glucose and with appropriate amino acids and/or uracil. For the selection of
transformants resistant to geneticin, cells were
grown on YPD plates containing 200 mg/l of G418
(geneticin, Sigma). For each ORF, deleted heterozygous (FY1679 and W303), deleted homozygous
(FY1679) diploids, and deleted haploids of each
mating type (FY1679 and W303) were deposited
in the EUROFAN collection (EUROSCARF,
P. Koetter and K.-D. Entian, Frankfurt).
The pUG7 (U. Güldener, S. Heck, and J. H.
Hegemann, unpublished) and pFL38 (Bonneaud
et al., 1991) plasmids were used to clone the
disruption cassette (pYORC) and the cognate gene
(pYCG), respectively. The resulting plasmids were
deposited in EUROSCARF.
Construction of long flanking homology deletion
cassettes
All disruptions were obtained using the long
flanking homology (LFH) method (Wach et al.,
1994). The dominant resistance module kanMX4
was used to replace the yeast coding sequence and
to select S. cerevisiae transformants. Genomic
FY1679 DNA was prepared according to Rose
et al. (1990), and 500 ng were used as template in
PCR reactions. In a first step, two fragments
homologous to the promoter (>350 bp) and terminator (>250 bp) regions of a given ORF were
amplified by two independent PCR reactions using
Taq DNA polymerase (Appligene) and primers
L1–L2 and L3–L4 respectively (Table 1; Figure 1).
The inner primers used in this first step (L2 and
L3) carry 5-extensions (20–25 bases) derived from
the pFA6a-kanMX4 multiple cloning site (MCS)
in order to generate the 5- and 3-PCR fragments,
Copyright 1999 John Wiley & Sons, Ltd.
. ́  .
short overlapping homologies to the selection
marker. In a second PCR, 50 ng of NotI-digested
pFA6a-kanMX4 were used as kanMX4 (Wach
et al., 1994) module template; 50 ng of the two first
PCR products were added to the two external
primers L1 and L4, and a fusion PCR reaction
was performed using Taq DNA polymerase
(Appligene) to create the ORF disruption cassette.
Yeast cells were directly transformed using the
lithium acetate method (Gietz et al., 1992) with the
amount of DNA generated by one PCR (approximately 2 ìg). Transformant cells were grown at
30C in YPD for 2–3 h and spread onto YPD
plates. Plates were incubated overnight at 30C
and replicas were made on G418 YPD plates.
After 2–3 days, large colonies were streaked on
G418 YPD plates to purify transformant cells
from the background.
Verification of gene replacement by PCR
Correct replacement of the targeted gene at the
genomic locus was verified by analytical PCR
performed on whole yeast cells (Huxley et al.,
1990). Oligonucleotides were designed to bind
either outside the target locus, in the promoter
(A1) and in the terminator (A4), or within the
ORF (A2 and A3), and oligonucleotides K2 and
K3 were designed to bind within the KanMX
module (Table 1). Colony PCR was then carried
out on the heterozygous disruptants using primer
combinations A1+A2, A3+A4, A1+K2 and
A4+K3 to confirm correct disruption (Figure 1).
Cloning of the LFH disruption cassettes
The ORF disruption cassettes were obtained by
PCR fusion as described above. Each cassette was
purified from an agarose gel and cloned into the
pGEM-T vector (Promega) which allows direct
cloning of PCR products. The disruption cassettes
were released by digestion with SnaBI. SnaBI
restriction sites were introduced in the outer primers (L1 and L4) used to create the disruption
cassettes. Each cassette was cloned into the EcoRV
site of pUG7. The derivatives of pUG7 carrying
the LFH disruption cassette were named pYORC
(followed by name of the ORFs). These new
plasmids were linearized with NotI and were used
to transform W303. Correct replacement of targeted gene on the genomic locus of G418 resistant
transformants was verified by PCR as described
for FY1679.
Yeast 15, 73–79 (1999)
Table 1.
Oligonucleotides used in this study.
Primer
K2
K3
YOL018c
L1
L2
L3
L4
A1
A2
A3
A4
YOL098c
L1
L2
L3
L4
A1
A2
A3
A4
YOL 101c
L1
L2
L3
L4
A1
A2
A3
A4
YOL102c
L1
L2
L3
L4
A1
A2
A3
A4
YOL 104c
L1
L2
L3
L4
A1
A2
A3
A4
YOL105c
L1
L2
L3
L4
A1
A2
A3
A4
Sequence
5–GATCCGTCGACCTGCAGC–3
5–CGCCTCGACATCATCTGCCC–3
5–GTACGTACCTGGTAATGAGCAGGCCG–3
5–GGGGATCCGTCGACCTGCAGCGTACCATGTTTGTAAACGACTGCCTAG–3
5–AACGAGCTCGAATTCATCGATGATATGATGACAAAACTTTCACGG–3
5–CTACGTACACAATAACCACCAACTTG–3
5–CCCTAGGCTTTGAAGACTGG–3
5–GGGAAAGTCCTACGGTATG–3
5–GCAACTTGCCGAGTATCGTTG–3
5–GCCCCGAGCTACTACTTC–3
5–GTACGTAGGTTTTCGTGCTCAGATGAGC–3
5–GGGGATCCGTCGACCTGCAGCGTACCATTGTGAAGATTCGACGAACTG–3
5–AACGAGCTCGAATTCATCGATGATAGGAATCAGTTCAAGAATTCTTTG–3
5–CTACGTACAAGCTACTTAAATACTC–3
5–GCCAGACCCATTCTCACACC–3
5–CATAATCCGGTTGGAATG–3
5–CCAATAAAAGCGTTGCCTTTGTG–3
5–CACGCTGCTCCAGTACCG–3
5–GTACGTAGACATTGAAACATAGCAAGCC–3
5–GGGGATCCGTCGACCTGCAGCGTACCATACTGTCAATATATATGTACC–3
5–AACGAGCTCGAATTCATCGATGATATAGACTCAGCTGGTGCTCAC–3
5–GTACGTAGCTCAATTCTGTAATAATG–3
5–GTACGGGCAGTACCAGCTG–3
5–CTGCAATTTTGCCAAGTC–3
5–GGTTGGAATCATTCCGAG–3
5–CCGTTTGAGTCAATAGTC–3
5–GTACGTAACTCAGCTGGTGCTCACAT–3
5–GGGGATCCGTCGACCTGCAGCGTACCATTGRCAAGTCCACCTTTC–3
5–AACGAGCTCGAATTCATCGATGATAGTTAAAGGAAACTTGAAAGATG–3
5–GTACGTACTGCTACACCAACAAAAAAT–3
5–GGTTGGAATCATTCCGAG–3
5–CCGTTTGAGTCAATAGTC–3
5–GCAGCAGTATTCCCGTTG–3
5–GGTGGCCGAAGGTGCTGCCC–3
5–GTACGTAGAAGGAGTGGATGGAAAAGT–3
5–GGGGATCCGTCGACCTGCAGCGTACGTTCCTCTTGCAGAGTATGC–3
5–AACGAGCTCGAATTCATCGATGATATAAAACGGGCTATCCATATT–3
5–GTACGTAGRCTGCAGTATACCACTTAC–3
5–GTTGATAGACGATAGTGG–3
5–CTCTAAACATCGGCGGGC–3
5–GGCCAGCACATCTCTTGG–3
5–CCAGCAGACTGGATATCCGC–3
5–GTACGTACGTCATCCCGCTCTCCTTTG–3
5–GGGGATCCGTCGACCTGCAGCGTACCATTTTATATTGTCTTCTGC–3
5–AACGAGCTCGAATTCATCGATGATATGAAAAACTCGCATAAACTC–3
5–GTACGTAGTTTATATTTTTGTACCAC–3
5–GGCCAGCACATCTCTTGG–3
5–CCAGCAGACTGGATATCCGC–3
5–CTGATAATCCTGATAATC–3
5–GAAGAGCGCAGCTTTCAG–3
The sequence complementary to the MCS of pFA6a-kanMX4 is underlined.
The sequence corresponding to the SnaBI restriction site is in bold letters.
76
. ́  .
Figure 1. Verification of the gene disruption by PCR. Disruption of all six ORFs was verified by the same procedure. (A)
Schematic representation of heterozygous disruptants. The oligonucleotides used for the LFH disruption cassettes are indicated by
thick arrows (L1, L2, L3, L4); SnaBI sites and regions homologous to pFA6a-kanMX4 MCS (Kan) were indicated respectively.
Oligonucleotides used for verifications are indicated by thin arrows (A1, A2, A3, A4). (B) Electrophoresis of PCR products.
M, 1 kb DNA ladder (Life Technology); lanes 1–5, PCR products resulting from different reactions as indicated.
Construction of cognate gene clones
Wild-type genes were cloned by the gap-repair
method (Rothstein, 1991) in the pFL38 centromeric plasmid (CEN/ARS, URA3). ORF replacement cassettes were obtained by PCR as described
above, except that the Pwo DNA polymerase
(Boehringer Manheim) was used to avoid errors
during amplification steps. Each disruption cassette was cloned into the SmaI site of a modified
Copyright 1999 John Wiley & Sons, Ltd.
pFL38 in which a sequence in the MCS extending
from EcoRI to KpnI was removed. After excision
of the kanMX4 module by appropriate restriction
enzymes (SmaI/EcoRI for YOL101c cassette, and
SmaI/Ecl136II for the five other cassettes),
the remaining vector fragment was used to
transform wild-type FY1679 strain. All the
URA+transformants recovered for each ORF
were assembled and amplified by overnight
growth in 2 ml of minimal medium without uracil.
Yeast 15, 73–79 (1999)
     ,  
DNA was extracted and used to transform
highly competent E. coli. JM109 cells (4·7108
transformant/ìg of DNA). Rescued plasmids were
recovered and the presence of the gene was verified
by restriction analysis. Furthermore, promoter and
terminator regions of each gene were sequenced to
verify that no mutations had been introduced
during PCR amplifications. The corresponding
plasmids are named pYCG clones (followed by the
name of the ORFs).
Tetrad analysis of the FY1679 heterozygous
transformants
Heterozygous deletants were first grown for 24 h
on pre-sporulation medium (0·25% yeast extract,
0·1% glucose, 1% potassium acetate, 2% bacto
agar) at 30C, and then transferred for 3–4 days to
sporulation medium (1% potassium acetate, 2%
bacto agar) at 30C. Once the cells had sporulated,
the equivalent of a large colony of cells (2 mm
diameter) was resuspended in 300 ìl of helicase
(50 mg/ml) in sterile water, and incubated for
10 min at 30C. Tetrad dissection was performed
using a micromanipulator. At least 20 tetrads per
ORF were dissected and analysed. Spores
were germinated on YPD at 30C and their genotype determined. The non-growing spores were
observed under a light microscope.
Construction of homozygous deletants
MATa and MATá strains were grown in YPD
and spotted onto YPD plates in two overlapping
spots. Plates were incubated overnight at 30C and
replica were made on selective medium allowing
growth of the homozygous deletants. After 3–4
days of incubation at 30C, the homozygous
deletants were recovered at the junction of the two
spots. Homozygous strains were checked for their
sporulation efficiency. Sporulation was induced
as described above. Tetrads were counted and
compared to the wild-type strain.
Phenotypic tests
For each non-essential gene, haploid disruptants
of both mating types were plated onto YPD, YPG
and YNB supplemented with the appropriate
nutrients. Plates were incubated at either 15C,
30C or 37C and examined after 1–13 days,
depending on the temperature tested, for growth as
compared to wild-type cells.
Copyright 1999 John Wiley & Sons, Ltd.
77
RESULTS AND DISCUSSION
Disruption of the ORFs using the LFH strategy
The six ORFs allocated to us in the EUROFAN
program, YOL018c, YOL098c, YOL101c,
YOL102c, YOL104c and YOL105c, were all
located on the left arm of chromosome XV (Dujon
et al., 1997). Following transformation with the
kanMX4 LFH cassette specific for each ORF,
G418-resistant transformants wree analysed by
four independent colony PCRs (Figure 1). Each
heterozygous disruptant was sporulated and tetrads were dissected. With the exception of
YOL102c, two G418-resistant and two G418sensitive spores were found for each ORF. The
PCR-generated LFH cassettes were cloned into
pUG7 to generate pYORC vectors. The cassettes
were released by NotI digestion and used to
transform the W303 strain.
For ORF YOL102c, only two spores were viable
in each tetrad and these were G418-sensitive. This
was true in the two genetic backgrounds tested,
FY1679 and W303. YOL102c thus encodes an
essential gene. Observation of the non-growing
spores under the microscope shows that the spores
were able to give rise to microcolonies comprising
30–40 cells. Sequence comparisons reveal that
YOL102c have similarities with ORFs of unknown
function, such as YJII in E. coli (SwissProt no.
P39380). The function of YOL102c was determined in the meantime by Culver et al. (1997). The
gene encodes the 2-phosphotransferase implicated
in tRNA splicing; it has been called TPT1 (tRNA
phospho-transferase). Deletion of TPT1 was also
shown to be essential for cell viability in the genetic
background tested by these authors.
Phenotypic analysis of the viable deletants
The deletion of ORFs YOL018c, YOL098c,
YOL101c, YOL104c and YOL105c led to viable
cells. Plate growth tests were performed on deleted
cells of both mating types, showing that neither
growth (tested at 30C, 37C or 15C) nor media
(YPD, YPG or YNB) affected the mutant cells
(Table 2). The mating and sporulation efficiencies
were determined for each ORF. No differences
were observed when compared to wild-type
strains.
Disruption of YOL018c Sequence analysis
revealed that YOL018c is a member of the
t-SNARE family. This family of proteins conYeast 15, 73–79 (1999)
. ́  .
78
Table 2.
Quantitative growth characteristics of non-essential deletant strains.
YPG
Time (days)
WT MATa
WT MATá
YOL018c MATa
YOL018c MATá
YOL098c MATa
YOL098c MATá
YOL101c MATa
YOL101c MATá
YOL104c MATa
YOL104c MATá
YOL105c MATa
YOL105c MATá
YPD
YNB
15C
30C
37C
15C
30C
37C
15C
30C
37C
13
+
+
+
+
+
+
+
+
+
+
+
+
4
++
++
++
++
++
++
++
++
++
++
++
++
5
++
++
++
++
++
++
++
++
++
++
++
++
4
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
1
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
1
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
4
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
1
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
2
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
+++
Quantitative growth is recorded as follows: + poor, + + reduced, + + + normal.
served from yeast to humans participates in vesicular trafficking of proteins along the secretory
and endocytic pathways. Our laboratory is
involved in the node N11, ‘Secretion and protein
trafficking’ in the EUROFAN II project. In collaboration with two laboratories of this node, we
determined the function of the protein encoded by
YOL018c (K. Séron, V. Tieaho, C. PrescianottoBaschong, T. Aust, M.-O. Blondel, P. Guillaud, G.
Devilliers, O. W. Rossanese, B. S. Glick, H.
Riezman, S. Keränen, and R. Haguenauer-Tsapis,
Mol. Biol. Cell., in press). We observed that the
protein is not involved in the secretory pathway,
but plays a role in the endocytotic pathway. Our
data suggest that this protein is required for the
biogenesis of early endosomes. We originally
named the gene TSE1 (t-SNARE for endocytosis).
A recent report on the same ORF has just been
published (Holthuis et al., 1998): the ORF was
named TLG2 (t-SNARE of late Golgi).
Disruption of YOL098c and YOL101c Growth,
mating and sporulation efficiencies were not
affected in any of the deletants as compared to
wild-type strains. YOL098c shows similarity to a
hypothetical Schizosaccharomyces pombe protein.
YOL101c has similarity to two hypothetical proteins of S. cerevisiae encoded by YOL002c and
YDR492w.
Disruption of YOL104c The function of
YOL104c was determined independently by two
Copyright 1999 John Wiley & Sons, Ltd.
laboratories (Chua and Roeder, 1997; Conrad
et al., 1997); it was named TAM1 (telomereassociated meiotic protein) or NDJ1 (nondisjunction) respectively. Both reports show that the
protein is expressed during meiosis and localized
to the end of meiotic chromosomes. Deletion
of the gene caused non-disjunction and impaired
distributive
segregation
of
chromosomes.
Homozygous deletants show reduced sporulation
efficiency (73% as compared to 88% for the wildtype; Conrad et al., 1997: 86% as compared to
96%; Chua and Roeder, 1997). We did not observe
such a defect in the homozygous deletant. Indeed,
very low sporulation efficiencies were observed in
the original parental strain FY1679, possibly
masking a subtle sporulation deficiency in the
derived strain, in which the deletion is present in
the heterozygous or homozygous state.
Disruption of YOL105c No phenotype different
from that of the wild-type cells was observed
in the YOL105c deletant. This protein belongs
to a family of four yeast proteins which was
reported recently (Verna et al., 1997) to be
required for maintenance of cell wall integrity
and for stress response. YOL105c was named
WSC3 (cell wall integrity and stress response
component).
In our case, the first phase of EUROFAN
did not reveal any basic phenotypic defect in five
out of six mutants studied. However, different
research groups studying specific cellular functions
Yeast 15, 73–79 (1999)
     ,  
determined, independently of the present work, the
function of four out of six proteins. This striking
feature of our six-pack is not generalized in the
case of the 1000 orphan genes analysed by EUROFAN. The second phase of the project is launched
for a more specialized analysis of the mutants
with more specific tests and should hopefully
permit determination of the function of the genes
remaining as orphans.
ACKNOWLEDGEMENTS
The authors are very grateful to D. Urban-Grimal
and C. Volland for constructive discussions. We
thank A.-L. Haenni for critical reading of the
manuscript and A. Wach for fruitful advice. This
work was supported by the European Community
(BIOTECH programme) within the frame of
EUROFAN and by the Centre National de la
Recherche Scientifique (CNRS).
REFERENCES
Bonneaud, N., Ozier-Kalojeropoulos, O., Li, G. Y.,
Labouesse, M., Minvielle-Sebastia, L. and Lacroute,
F. (1991). A family of low and high copy replicative,
integrative and single-stranded S. cerevisiae/E. Coli
shuttle vectors. Yeast 7, 609–615.
Chua, P. R. and Roeder, G. S. (1997). Tam1, a telomereassociated meiotic protein, functions in chromosome
synapsis and crossover interference. Genes Dev. 11,
1786–1800.
Conrad, M. N., Dominguez, A. M. and Dresser, M. E.
(1997). Ndj1p, a meiotic telomere protein required for
normal chromosome synapsis and segregation in
yeast. Science 276, 1252–1255.
Culver, G. M., McCraith, S. M., Consaul, S. A.,
Stanford, D. R. and Phizicky, E. M. (1997). A 2phosphotransferase implicated in tRNA splicing is
essential in Saccharomyces cerevisiae. J. Biol. Chem.
272, 13,203–13,210.
Dujon, B. (1996). The yeast genome project: what did we
learn? Trends Genet. 12, 263–270.
Copyright 1999 John Wiley & Sons, Ltd.
79
Dujon, B. et al. (1997). The nucleotide sequence of
Saccharomyces cerevisiae chromosome XV. Nature
387 (Suppl. 6632). 98–102.
Gietz, D., St. Jean, A., Woods, R. A. and Schiestl, R. H.
(1992). Improved method for high efficiency transformation of intact yeast cells. Nucl. Acid Res. 20, 1425.
Goffeau, A., Barrell, B. G., Bussey, H., Davis, R. W.,
Dujon, B., Feldmann, H., Galibert, F., Hoheisel,
J. D., Jacq, C., Johnston, M., Louis, E. J., Mewes,
H. W., Murakami, Y., Philippsen, P., Tettelin, H. and
Oliver, S. G. (1996). Life with 6000 genes. Science 274,
546–567.
Holthuis, J. C. M., Nichols, B. J., Dhruvakumar, S. and
Pelham, H. R. B. (1998). Two syntaxin homologues in
the TGN/endosomal system of yeast. EMBO J. 17,
113–126.
Huxley, C., Green, E. D. and Dunham, I. (1990). Rapid
assessment of S. cerevisiae mating type by PCR.
Trends Genet. 6, 236.
Oliver, S. (1996). A network approach to the systematic
analysis of yeast gene function. Trends Genet. 12,
241–242.
Rose, M. D., Winston, F. and Hieter, P. (1990). Methods in Yeast Genetics: A Laboratory Course Manual.
Cold Spring Harbor Laboratory Press, New York.
Rothstein, R. (1991). Targeting, disruption, replacement, and allele rescue: integrative DNA transformation in yeast. Methods Enzymol. 194, 281–301.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989).
Molecular Cloning. A Laboratory Manual, 2nd edn.
Cold Spring Harbor Laboratory Press, New York.
Verna, J., Lodder, A., Lee, K., Vagts, A. and Ballester,
R. (1997). A family of genes required for maintenance
of cell wall integrity and for the stress response in
Saccharomyces cerevisiae. Proc. Natl Acad. Sci. USA
94, 13,804–13,809.
Wach, A. (1996). PCR-synthesis of marker cassettes
with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12, 259–265.
Wach, A., Brachat, A., Pöhlmann, R. and Phippsen, P.
(1994). New heterologous modules for classical
or PCR-based gene disruptions in Saccharomyces
cerevisiae. Yeast 10, 1793–1808.
Yeast 15, 73–79 (1999)
Документ
Категория
Без категории
Просмотров
2
Размер файла
242 Кб
Теги
467
1/--страниц
Пожаловаться на содержимое документа