close

Вход

Забыли?

вход по аккаунту

?

jcb.26466

код для вставкиСкачать
 Article
MicroRNA-381-induced down-regulation of CXCR4 promotes the proliferation
of renal tubular epithelial cells in rat models of renal ischemia reperfusion
injury†
Running title: Role of miR-381 in renal I/R injury
Gui-Hong Zheng 1, #, Xin Wen 1, #, Yong-Jian Wang 1, #, Xin-Rui Han 1, #, Qun Shan 1, Wang Li
2,
Tian Zhao 2, Dong-Mei Wu 1, *, Jun Lu 1, *, Yuan-Lin Zheng 1, *
1
Key Laboratory for Biotechnology on Medicinal Plants of Jiangsu Province, School of Life
Science, Jiangsu Normal University, Xuzhou 221116, P.R. China
2
Department of Nephrology, First Teaching Hospital of Tianjin University of Traditional Chinese
Medicine, Tianjin 300193, P.R. China
# These
*
authors are regarded as co-first authors.
Correspondence to: Dr. Dong-Mei Wu & Jun Lu & Yuan-Lin Zheng, Key Laboratory for
Biotechnology on Medicinal Plants of Jiangsu Province, School of Life Science, Jiangsu Normal
University, No. 101, Shanghai Road, Tongshan District, Xuzhou 221116, Jiangsu Province, P.R.
China
E-mail:
[email protected]
(Dong-Mei
Wu);
[email protected]
(Jun
Lu);
[email protected] (Yuan-Lin Zheng)
Tel./Fax.: +86-0516-83403170
†
This article has been accepted for publication and undergone full peer review but has not been through the
copyediting, typesetting, pagination and proofreading process, which may lead to differences between this
version and the Version of Record. Please cite this article as doi: [10.1002/jcb.26466]
Received 13 June 2017; Revised 18 October 2017; Accepted 24 October 2017
Journal of Cellular Biochemistry
This article is protected by copyright. All rights reserved
DOI 10.1002/jcb.26466
This article is protected by copyright. All rights reserved
Abstract
This study aims to explore whether microRNA-381 (miR-381) mediating CXCR4 affects the renal
tubular epithelial cells (RTEC) of renal ischemia reperfusion (I/R) injury. Forty-eight rats were
assigned into the I/R (n = 24, successfully established as I/R model) and sham (n = 24) groups.
After collecting kidney tissues, immunohistochemistry and microvascular density (MVD) counting
were conducted for CXCR4 positive expression and MVD numbers. RTECs were assigned into the
sham, blank, negative control (NC), miR-381 mimics, miR-381 inhibitor, si-CXCR4, and miR-381
inhibitor + si-CXCR4 groups. RT-qPCR and western blotting were performed for relative
expressions in tissues and cells. Cell proliferation and apoptosis were measured by MTT assay and
flow cytometry. Results showed that compared with the sham group, positive expression of CXCR4
and MVD number were higher in the I/R group, which exhibited decreased miR-381 and increased
expression of CXCR4, stromal cell-derived factor-1 (SDF1), vascular endothelial growth factor
(VEGF), hypoxia-inducible factor 1 (HIF-1α) and Tie-2. Dual luciferase reporter gene assay
verified that CXCR4 is a target gene of miR-381. MiR-381 expression was lower in the miR-381
inhibitor + si-CXCR4 and miR-381 inhibitor groups and higher in the miR-381 mimics group than
the blank and NC groups. Compared with the blank and NC groups, the miR-381 mimics and
si-CXCR4 groups exhibited higher cell proliferation but lower cell apoptosis and expression of
CXCR4, SDF1, VEGF, HIF-1α and Tie-2, whereas the miR-381 inhibitor group exhibited the
opposite trend. In conclusion, miR-381 may promote RTEC proliferation in rats with renal I/R
injury by down-regulating CXCR4. This article is protected by copyright. All rights reserved
Key words: MicroRNA-381; CXCR4; Renal ischemia-reperfusion injury; Renal tubular epithelial
cells
This article is protected by copyright. All rights reserved
Introduction
Ischemic/reperfusion (I/R) injury, including arterial occlusion, shock, and organ transplantation,
is a common finding in clinical settings. Renal ischemia-reperfusion (I/R) injury is the major cause
of acute renal failure (ARF) and may also be involved in the development and progression of some
forms of chronic kidney disease [Mejia-Vilet et al., 2007]. ARF often leads to renal cell death,
delayed graft function, renal graft rejection, and permanent impairment of renal function. Renal
ischemia-reperfusion (I/R) injury has also been identified as the most common cause of patient
morbidity and mortality in the perioperative period [Erkilic et al., 2017]. Serious clinical conditions
of vascular surgery, organ procurement, or transplantation may result in renal I/R injury, including
acute renal injury (AKI) observed in patients suffering from sepsis, renal transplantation, and other
ischemic insults [Mehta et al., 2007]. Mortality rates are kept at high levels for those patients in ICU,
of which in-hospital mortality rates may be higher than 50% [Hatcher et al., 2015]. Patients who
survive from acute episodes are still are still not clear of the disease may which may progress to the
chronic kidney disease stage that could possibly result in end-stage renal diseases [Coca et al.,
2009]. Renal I/R injury can also induce the acute renal failure, which may lead to some other
syndromes, such as acute inflammation and secondary tissue injury [Medeiros et al., 2017]. Despite
the ongoing research on renal I/R injury, there are still no current effective therapeutic approaches
for the treatment of renal I/R injury, which makes the search for new therapeutic tools essential
[Sun et al., 2016].
CD184 or more commonly known as CXCR4 is a chemokine receptor that belongs to the G
protein-coupled receptors (GPCR) gene family, and is expressed by cells in the immune and central
nervous system [Zou et al., 1998]. It is also broadly expressed by both mononuclear cells and
progenitor cells in the bone marrow. It has been has been well established that CXCR4 plays a
crucial role in a number of biological processes, including the trafficking and homeostasis of
immune cells such as T lymphocytes. CXCR4 has also been found to be a prognostic marker in
various types of cancer, including leukemia and breast cancer, and recent evidence has highlighted
This article is protected by copyright. All rights reserved
its role in prostate cancer [Furusato et al., 2010]. Specifically, CXCR4, a 37-kDa G protein–coupled
receptor, has been founded to locate principally at the plasmalemma of cardiac myocytes [Chen et
al., 2010]. It has been proved that CXCR4 could promote the development of vascular endothelial
cells, and a defective formation of large vessels has been observed in the gastrointestinal tract of
those rats lacking CXCR4 [Tachibana et al., 1998]. Overexpressed CXCR4 seems to exacerbate I/R
injury in the kidney possibly due to the increased production of tumor necrosis factor-alpha
(TNF-α), enhancement of inflammatory cells and the activation of pathways of cell death or cell
apoptotic [Chen et al., 2010].
The research and development of MicroRNAs (miRNAs) have been extensively studied as
prospective therapeutic approach in treating cancer as well as renal I/R injury therapy [Godwin et
al., 2010]. MiRNAs are small non-coding RNA molecules that play important roles in RNA
silencing and post transcriptional regulation of gene expression [Ambros, 2004; Bartel, 2004]. As
one of the miRs, miR-381 acts a suppressing or promoting role in different malignant tumors [Cao
et al., 2017]. Previous studies have suggested that miR-381 serves as an oncogenic or
tumor-suppressive miRNA in many types of cancers, such as hepatocellular carcinoma and
esophageal cancer cells [Hou et al., 2015; Montuori and Coscia-Porrazzi, 1967; Zhang et al., 2016].
However, there is currently no substantial data that describes the protective effects of miR-381 on
angiogenesis after renal I/R injury in rats. In addition, the role of miR-381-induced CXCR4 in the
proliferation of renal tubular epithelial cells in renal I/R injury has also not yet been reported.
Therefore, our present study aims to investigate the effects of miR-381 on renal I/R injury via
regulating CXCR4.
Materials and methods
Ethics statement
Animal use and experimental procedures were carried out in accordance with the Helsinki
Declaration [Williams, 2008], and this study was approved by the Experimental Animal Ethics
This article is protected by copyright. All rights reserved
Committee of the Affiliated Municipal Hospital of Xuzhou.
Animal and model establishment
Sixty Wistar rats in specific pathogen free (SPF) class, weighing between 180 to 250 g, were
purchased from the Laboratory Animal Centre at Chongqing Medical University. All rats were
housed under SPF-class conditions with room temperature of 23℃, relative humidity of 65%, 12 h
light/dark cycle). Thirty rats were selected randomly and induced by I/R injury and the other half
was served as normal control. All rats were anaesthetized by intravenous injection of 3%
pentobarbital sodium. The rats were then fixed on the operation table, and an incision was made in
the middle of the abdomen. The kidneys were exposed and bluntly separated. Afterwards, the left
renal artery was clamped and occluded by clamp until the color of the kidney surface turned to
black red, which indicated a successful renal blood flow occlusion. After 45 minutes, the clamp was
removed and the color of the kidney surface returned to a light red from black red colour which
indicated the success of blood flow recovery. After 60 minutes of reperfusion, the rat model of I/R
injury was successfully established. The rats in the sham group underwent the same operation
procedure without occluding the left kidney; the femoral artery of one side was separated and
cannulated. The sham rats were allowed to rest at room temperature for 120 minutes without
ischemic treatment after the wound was covered by gauze soaked with normal saline. After a 24
hour reperfusion period, the rats were euthanized by cervical dislocation and the venous blood was
extracted for further experimentation. The criteria for the successful establishment of rat models
were as follows: 1. the blood flow of I/R group was obviously lower than that of the sham group,
while the serum levels of urea nitrogen (BUN), creatinine (Scr) and malondialdehyde (MDA) were
higher than the sham group; 2. Clear changes in renal structure were clearly observed by
hematoxylin-eosin (HE) staining. If the model establishment failed, the rats were removed and
excluded from the experiment. Twenty six rats succeeded in being model established. Finally, 24
rats from the model group were randomly selected as I/R group, and 24 in the normal control group
served as sham group. All rats in the experiment were kept warm after the operation, and were
This article is protected by copyright. All rights reserved
given standard feed and water [Czarkowski, 2014].
Enzyme-linked immunosorbent assay (ELISA)
Reagent kits (B-TAE-233, Tianjin Annuo Ruikang Biotechnology Co., Ltd., Tianjin, China;
MHM019, Shanghai Meixuan Biological Science and Technology, Shanghai, China) were used to
evaluate the concentration of Scr and malondialdehyde in serum, according to the instructions
provided. The specific procedures were as follows: 20 μL per well of samples and the standards (2
mg/dL) were pipetted into 96-well plates. Reagent A and B were mixed at a 1 : 1 ratio and then
transferred into the standard samples (200 μL/well). Optical density (OD) at 0 min (OD0) and OD at
5 min (OD5) were measured at 490 nm and the value of Src and malondialdehyde were calculated
according to the following equation: Scr = (sample OD5 - sample OD0) / (standard OD5 - standard
OD0) × standard concentration (2 mg/dL). A BUN kit (JKSJ-2205, Shanghai Crystal Bioengineering
Co., Ltd., Shanghai, China) was used to detect urea nitrogen content with following specific
operations: samples, standards (50 mg/d L) and pure water were added into a 96-well plate (5
μL/well). Reagent A and B were mixed and transferred to the standards (200 μL/well). After a 20
minutes incubation period, the OD value was read and measured at 490 nm. The value of urea
nitrogen in serum was calculated as follows: BUN = (sample OD- water OD) / (standard OD - water
OD) × sample concentration (50 mg/dL).
Immunohistochemistry staining
Immunohistochemistry staining was according to the instructions belonging to the SP-9001 kits
(Beijing Noble Ryder Technology Co., Ltd., Beijing, China). Renal tissues of the I/R group were
frozen and cut into 4 to 8 μm sections. After leaving the sections at room temperature for 30
minutes the sections were fixed with acetone at 4℃ for 10 min, dewaxed to water, and rinsed 3
times using phosphate-buffered saline (PBS; 5 min each). Next, 3% H2O2 was used to suppress
endogenous peroxidase activity for 5 to 10 min. The sections were washed with distilled water and
soaked twice in PBS, 5 min each, and blocked with 5 to 10% of normal sheep serum working fluid
(C1771, Beijing Pulilai Gene Technology Co., Ltd., Beijing, China). After incubating at 37℃ for
This article is protected by copyright. All rights reserved
10 to 15 minutes, the sections were taken out. Next, primary rabbit-anti CXCR4 antibody (ab124824,
1 : 500, Cambridge Inc, MA, USA) was added to the mixture and left to incubating at 4℃
overnight. The sections were allowed to rest at room temperature for 30 minutes and washed 3
times (5 min per time) with PBS. Secondary biotin-labeled goat anti-rabbit IgG antibody (ab150077,
Abcam, Inc, MA, USA) was add to the sections, and left to incubating at 37℃ for 1 h. PBS
washing was conducted 3 times, each time for 3 minutes, followed by horseradish peroxidase
treatment (0343-10000U, Yimo Biotechnology Co., Ltd., Beijing, China) and incubation at 37℃
for 1 hour. PBS washing was conducted 3 times, 5 min each time, followed by coloration with
diaminobenzidine (DAB) (ST033, Guangzhou Weijia Technology Co., Ltd., Guangzhou, China) for
3 ~ 10 min. Double distilled water was used to wash thorough these sections. Next, the tissues
counterstained by hematoxylin for 1 min, dehydrated conventionally, cleared and mounted. PBS
was used to replace the primary antibody as a blank control. Positive staining was indicated by a
yellow brown color. Five randomly selected visual fields were observed at high magnification (200
fold and 200 cells per field), to measure the positive number of cells and staining area in order to
obtain the average expression rate. The average positive expression rate was equal to the ratio of the
positive cell number to total cell number (%).
HE staining
After reperfusion period of 2 hours, the kidneys of rats were removed, fixed in 4%
paraformaldehyde, embedded in paraffin and cut into sections of 3 μm, followed by HE staining and
periodic acid Schiff (PAS) staining. Next, the sections were mounted ventilated with neutral gum
and the pathological changes of the tissues were imaged and observed under a Zeiss fluorescence
microscope (PrimoStar iLED, Beijing Boruisi Technology Co., Ltd., Beijing, China).
Semi-quantitative detection was performed to assess the extent of renal cell injury and evaluate the
histological changes. This includes the degree of necrosis of renal tubular epithelial cells (RTEC),
renal tubular dilatation and congestion. The scores were given according to the five grades: Grade 1
= 0 point, Grade 2 = 1 point, Grade 3 = 2 point, Grade 4 = 3 point, Grade 5 = 4 point which the
This article is protected by copyright. All rights reserved
higher the scores were, the worse the renal tissue injury was. The evaluator evaluated the numbered
sections using the double blind method.
Microvascular density (MVD) counting
Same as the immunohistochemistry staining, an immunohistochemistry S-P method was used to
determine MVD of the rat renal tissues. The primary antibody rabbit anti-rat CD31 (1 : 50; ab28364;
Abcam, Cambridge, Inc, MA, USA) was used to mark the vascular endothelial cells and
angiogenesis was presented by MVD, which was calculated by microvessel number per unit area in
the renal interstitiumz. The MVD counting method was performed according to the Weidner
counting method with some modifications: (1), single endothelial cells or endothelial cell clusters
stained in brown-yellow was considered as one count; (2), the cells with a lumen larger than 8
erythrocytes, or vessels with comparatively thick muscle layer or obscure staining were excluded
from the counting. After staining, the MVD region 5 random fields of vision (× 400) were selected
from each section under a 100-fold field of vision and chosen for micro-vessel counting. The
average value was used to determine the MVD value in the tissue.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted by TRIZOL method with QiantiTect Sybr green PCR kit (Qiagen
Company, Hilden, Germany) from lower part of the left renal tissues, the concentration of which
was measured. Primer sequences were synthezied by Takara Biotechnology Ltd., Dalian, China
(Table 1). Next, 2 μL cDNA products and 500 nM primer mixture were mixed and reverse
transcription was performed with a ABI 7500 fluorescence qPCR device, according to the
instructions provided the cDNA reverse transcriptase kit. The reaction conditions for reverse
transcription were as follows: pre-denaturation at 95℃ for 10 s, 40 cycles of denaturation at 95℃
for 5 s, annealing and extension at 60℃ for 30 s. Total RNA (2 μg) was used as the template, and
U6 and β-actin were as internal reference primers. The relative quantitative method 2-△△Ct method
was adopted to calculate the mRNA expression of the target genes (miR-381, CXCR4, SDF1, VEGF,
HIF-1α and Tie-2) on relative transcription. The formulas used were as follows: △△Ct=△Ct I/R group
This article is protected by copyright. All rights reserved
- △Ct
sham group,
△Ct = Ct
target gene –
Ct
internal reference,
mRNA expression of target gene on the relative
transcription = 2-△△Ct [Ayuk et al., 2016]. Transfected total RNA of each group was collected, and
the RT-qPCR method was employed to test the mRNA expressions in each group. The operation
methods are same as above. (This experiment was conducted with the repetition of 3 times)
Western blotting
Renal tissues (50 mg) was extracted after and ground into uniform fine powder and added with
1
mL tissue
lysate
(containing
50
mmol/L Tris,
150
mmol/L NaCl,
5
mmol/L
ethylenediaminetetraacetic acid (EDTA), 0.1% sodium dodecyl sulfate (SDS), 1% NP-4, 5 μg/mL
Aprotinin and 2 mmol/L PMSF). The homogenate was prepared on an ice bath, followed by protein
lysis for 30 min at 4℃. The tissues were shaken once every 10 min. Tissues were then centrifuged
(12000 r/min) for 20 min at 4℃, then the lipid layer was discarded and the supernatant was
extracted. A bicinchoninic acid (BCA) kit (20201ES76, Yeasen Biotechnology Co., Ltd., Shanghai,
China) was used to determine the protein concentration of each sample. After sample loading, the
membrane was transferred onto a nitrocellulose membrane and sealed at 4℃ overnight with 5%
skim milk powder. Primary anti-rabbit antibody CXCR4 (ab53316, 1 : 500), HIF-1α (ab10842, 1 :
1000), VEGF (ab131441, 1 : 500) and Tie-2 (ab40854, 1 : 1000) (Abcam, Cambridge, Inc, MA,
USA,) were added and incubated in a shaking incubator at 4℃ overnight. After washing with
Tris-buffered saline containing Tween-20 (TBST), secondary goat anti-rabbit antibody IgG (FITC,
1 : 1000, Abcam, Cambridge, Inc, MA, USA) was added, and the mixture was incubated for 1 h at
room temperature, then rinsed with TBST 3 times (5 min each). The ratio of the gray value between
the target band and GAPDH band was used as the relative protein expression, protein quantitative
analysis was conducted using ImageJ 1.48u (National Institutes of Health) after developed. After 48
h of transfection, the cells in all groups were collected separately and then treated with the same
procedures above. The experiment was repeated 3 times.
Cell culture and grouping
The renal tissues was collected, cut into about 3 mm3 sections and washed with D-Hanks
This article is protected by copyright. All rights reserved
solution (HMK0011, Beijing Huamaike Biotechnology Co., Ltd., Beijing, China). After discarding
the supernatant, 0.15% collagenase Dulbecco’s modified Eagle’s medium (DMEM) low sugar
medium (SH30021, Beijing North TZ-Biotech Develop., Co., Ltd., Beijing, China), were added to
the tissues and transferred into a sterile centrifuge tube and digested at 37℃. Thereafter, the
supernatant was discarded after the tissues were centrifuged for 5 min at 700 rpm, followed by
addition of an appropriate amount of DMEM low sugar medium containing 20% volume fraction of
fetal bovine serum (FBS). The tissues underwent another centrifugation at 700 rpm, then
precipitation was taken out and culture medium was added. Afterwards, the cells were resuspended
and transferred to a disposable culture dish. D-Hank’s solution was used to wash the cells, followed
by addition of 0.25% moderate trypsin containing 0.02% EDTA. After culturing with 5% CO2 at 37℃
for 7 to 9 min, digestion was terminated by adding culture medium with 20% fetal bovine serum.
The tissues were centrifuged at 1200 rpm for 5 min, and the supernatant was removed. After
resuspension by DMEM culture solution with 20% fetal bovine serum, the cells were inoculated
into a new culture dish for further culture with 5% CO2 at 37℃, with replacement of culture
medium every 2 - 3 days.
Cells were assigned into seven different groups: sham group (cells from normal healthy rats in
the sham group without transfection of any sequence), blank group (cells from rats in the I/R group
without transfection of any sequence), NC group (cells from rats in the I/R group transfected with
miR-381 negative control sequence ), the miR-381 mimic group (cells from rats in the I/R group
transfected with miR-381 analogue miR-381 mimics sequence), miR-381 inhibitor group (cells
from rats in the I/R group transfected with miR-381 inhibitor sequence), si-CXCR4 group (CXCR4
expression inhibitor group, cells from rats in the I/R group transfected with si-CXCR4 sequence),
and miR-381 inhibitor + si-CXCR4 group (miR-381 and CXCR4 were both inhibited; cells from rats
in the I/R group co-transfected with miR-381 inhibitor and si-CXCR4 sequences). All transfection
sequences were purchased from Shanghai Gene Pharma Biological Company (Shanghai, China).
The cells were inoculated in 6-well plates for 24 hours before transfection. When the cell
This article is protected by copyright. All rights reserved
confluence reached approximately 50%, renal cells were immediately transfected with the
mediation of lipofectamine 2000 (XFSJ16444, Shanghai Xinfan Biotechnology Co., Ltd., Shanghai,
China). Next, 250 µL serum-free Opti-MEM (31985-070, Shanghai Hengfei Biotechnology Co.,
Ltd., Shanghai, China) was used to dilute 100 pmol miR-381 mimics, miR-381 inhibitor, si-CXCR4,
miR-381 inhibitor + si-CXCR4 and the negative control (The final concentration added into the
cells was 50 nM), followed by mixing and incubating for 5 minutes at room temperature. Afterwards,
250 µL serum-free Opti-MEM was used to dilute 5 µl lipofectamin 2000, mixed, and incubated for
5 min at room temperature. The two mixtures were mixed and incubated for 20 minutes at room
temperature, and then transferred into cell culture well. After an incubation period of 6 to 8 hours
with 5% CO2 at 37℃, the medium was replaced by complete medium. The further experimentation
was conducted after 24 ~ 48 h of culture.
Dual luciferase reporter gene assay
The biological prediction website microRNA.org was used to analyze the target gene of
miR-381. Dual luciferase reporter gene assay was employed to identify whether CXCR4 was the
direct target gene of miR-381. The 3’-UTR fragment of CXCR4 gene was artificially synthesized.
Restriction sites Hind III and Spe I restriction sites were introduced into the pMIR-reporter gene
(Beijing Huayueyang Biotechnology Co., Ltd., Beijing, China). Complementary sequence mutation
site of seed sequence was designed based on wild-type CXCR4. T4 DNA ligase was used to insert
the target fragment into the pMIR-reporter reporter plasmid after restriction endonuclease digestion.
The correct sequence of Luciferase reporter plasmids WT and MUT were respectively
co-transfected with miR-381 into HEK-293T cell (CRL-1415, Shanghai Beinuo Biotechnology Co.,
Ltd., Shanghai, China). After 48 hours transfection, the cells were collected and lysed. Luciferase
assay kit (K801-200, Biovision, CA, USA) was used to measure the luciferase activity. The
experiment was repeated 3 times.
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) assay
The transfected cells were washed with PBS twice when cell density reached 80%, digested
This article is protected by copyright. All rights reserved
with 0.25% trypsin to create a single cell suspension. After calculation, the cells were seeded at 3 ×
103 ~ 6 × 103 cell per well in a 96-well plate (0.2 mL per well), with 6 replicate set in each group.
The plates were incubated at 24 h, 48 h and 72 hours. After incubation, the culture plates were
transferred in medium with 10% MTT solution (5 g/L, GD-Y1317, Guduo Biotechnology Company,
Shanghai, China) for further culture for 4 h. After removing the supernatant, dimethyl sulfoxide
(100 μL) (D5879-100ML, Sigma-Aldrich, St. Louis, MO, USA) was added to each well, gently
oscillated and mixed for 10 minutes to completely dissolve formazan crystals produced by living
cells. The optical density (OD) value was measured at 490 nm using a microplate reader (BS-1101,
Nanjing Detie Laboratory Equipment Co., Ltd., Nanjing, China). Every experiment was repeated 3
times. The cell viability curve was drawn with time points as abscissa and OD values as ordinate.
Flow cytometry
Propidium iodide (PI) single staining was employed to examine cell cycles. After 48 hours
transfection, cells were centrifuged after rinsing with PBS 3 times, supernatant discarded. The cells
were resuspended in PBS, and the cell concentration was adjusted to 1 × 105 cells/ml. After that, the
cells were fixed with the addition of -20℃ pre-cooled 70% ice ethanol at 4℃ overnight. On the
following day, the cells were centrifuged at 800g/min at 4℃, washed twice with PBS containing 1%
fetal bovine serum and resuspended with 400 L binding buffer. Next, 50 μL RNA enzyme A (R4875,
Shanghai Wei Jin Biotechnology Co., Ltd., Shanghai, China) was added, followed by incubation at
37 ℃ for 30 minutes. Afterwards, 50 μL 50 mg/L of PI (GK3601-50T, Beijing Dingguo
Changsheng Biotechnology Co., Ltd., Beijing, China) was added to the cells in a dropwise manner
and then incubated for 30 min at room temperature in the dark. Cell cycles were measured using
flow cytometer (the experiment was repeated 3 times).
Annexin V-FITC/propidium iodide (PI) double staining was utilized to measure cell apoptosis.
After 48 hours transfection, the cells were digested with 0.25% EDTA-free trypsin (YB15050057,
Yubo, Shanghai, China), transferred to Eppendorf tubes and then centrifuged, followed by
supernatant removal. The cells were washed again in PBS, and the supernatant was discarded.
This article is protected by copyright. All rights reserved
According to the instructions provided by the Annexin-V-FITC cell apoptosis assay kit (K201-100,
Biovision, CA, USA), the Annexin-V-FITC, PI and HEPES buffer solution were made into
Annexin-V-FITC/PI dye liquor at the ratio of 1: 2: 50. Dye liquor (100 μL) was used to resuspended
1 × 106 cells, oscillated and mixed. The cells were incubate for 15 minutes at room temperature,
after which 1 mL HEPES buffer solution (PB180325, Procell, Wuhan,China) was added, oscillated
and mixed. Fluorescence FITC and PI was measured using 525 nm and 620 nm band pass filters at
488 nm red fluorescence. This experiment was repeated 3 times.
Statistical analysis
All statistical analysis was performed using SPSS 21.0 software (IBM Corp., Armonk, NY,
USA). Measurement data was expressed as mean ± standard deviation. Comparisons between two
groups were conducted by a t-test. Comparisons between multiple groups were performed using
one-way factor analysis of variance. P < 0.05 was considered to be statistically significant.
Results
Variation of blood flow, BUN, Scr and MDA of rats in the sham and I/R groups
Statistical results revealed that the success rate of establishing an I/R model group was 86.67%
(26/30). The blood flow, BUN, Scr and MDA of each group are presented in Table 2. The blood
flow in the I/R group was significantly lower than the sham group while BUN, Scr and MDA were
significantly heightened, indicating a successful model establishment.
The positive expression of CXCR4 of tissues in the sham and I/R groups
The results of immunohistochemistry staining demonstrated that positive staining of CXCR4
was mainly located in the cytoplasm. In the sham group, we saw a weak expression level of CXCR4
in the rat renal tissues which were also lightly stained and mainly expressed in the renal cortex. In
the I/R group, CXCR4 presented with a strong positive expression with obvious yellow-brownish
granules. CXCR4 expression extended all the way to the cutaneous medullary junction, where the
exogenous renal medulla was the most obvious. CXCR4 was mainly expressed in the distal tubule
This article is protected by copyright. All rights reserved
but presented weak positive expression in the proximal tubule (FIG 1A). After renal I/R injury, the
positive number of cells of CRCX4 and increased CXCR4 expression (78.32% VS 13.21%, P < 0.05)
were significantly enhanced in the I/R group compared to the sham group (FIG 1B).
Histological observation of RTEC in renal tissues in the sham and I/R groups
HE staining results (FIG 2A) showed that the morphology and structure of RTEC in the sham
group were clear. The basement membrane structure was complete and there were only a small
amount of inflammatory infiltration. In contrast, the renal cortex and medulla in the I/R group, were
swollen. RTECs presented with vacuolar changes, brush border detachment and necrosis. The
basement membranes of the renal tubules were markedly thickened with inflammatory cell
infiltration; renal tubular lumens were also mildly dilated. The PAS staining (FIG 2B) showed that
in the sham group the RTECs was in clear morphology and structure; the basement membranes of
the renal tubule were complete without obvious injury. In the I/R group, the basement membranes
of the renal tubule were markedly thickened, contorted, a small number of which shrunk and broken
(FIG 2C). The histopathological score of the I/R group increased significantly compared with the
sham group (P < 0.05), indicating that after successful model establishment, the severity of I/R rat
was notably elevated.
MVD is higher in the I/R group
After I/R injury, the tissues were rich in micro-vessels, with a large number of dense clusters
formed with the gathering of small vessels. In the sham group, the MCD in the renal tissues were
sparse, with a large number of big vessels. The MVD counting results are shown in FIG 3. Under a
400-fold field of vision, the MVD in the renal tissues was 24.04 ± 2.40 and 13.25 ± 1.29 in the I/R
group and sham group, respectively (P < 0.0001,t = 19.405).
MiR-381 could specifically target CXCR4 gene
A Specific binding region was observed between miR-381 and CXCR4 gene sequences by
online analysis software, where CXCR4 was identified as the target gene of miR-381 (FIG 4).
Luciferase reporter gene assay helped confirmed that that CXCR4 was the target gene of miR-381.
This article is protected by copyright. All rights reserved
The results showed that, luciferase activity of wild-type 3’UTR of CXCR4 gene was obviously
inhibited by miR-381 in the miR-381 mimics group (P = 0.0031, t = 6.359), while no notable
differences was observed in the luciferase activity of mutant 3’UTR when compared with the NC
group (P > 0.05). This suggests that miR-381 could specifically bind with the 3’-UTR region of the
CXCR4 gene.
The miR-381 expression and mRNA and protein expressions of CXCR4, SDF1, VEGF, HIF-1α
and Tie-2 of rats in the sham and I/R groups before transfection
RT-qPCR revealed that, the expression levels of miR-381 in the I/R group significantly
decreased while the mRNA expressions of the factors related to I/R injury repair such as CXCR4,
SDF1, VEGF, HIF-1α and Tie-2 all increased significantly than the sham group (P < 0.05) (FIG
5A).
Western blotting showed that compared with the sham group, the protein expressions of
CXCR4, SDF1, VEGF, HIF-1α and Tie-2 increased significantly in the I/R group (P < 0.05) (FIG
5B).
Comparison of miR-381 expression and mRNA and protein expressions of, CXCR4, SDF1,
VEGF, HIF-1α and Tie-2 after transfection
After transfection, in the I/R groups the expression of miR-381 significantly decreased while
the mRNA expressions of CXCR4, SDF1, VEGF, HIF-1α and Tie-2 markedly increased in the I/R
group compared with the sham group (all P < 0.05). Compared with the blank and NC groups, the
si-CXCR4 group showed no significant differences in the expression of miR-381; the miR-381
inhibitor + si-CXCR4 group exhibited no obvious difference in the mRNA expressions of CXCR4,
SDF1, VEGF, HIF-1α and Tie-21 (all P > 0.05). Compared with the blank and NC groups, in the
miR-381 inhibitor group the expression of miR-381 markedly decreased, while the mRNA
expressions of CXCR4, SDF1, VEGF, HIF-1α and Tie-2 markedly increased (all P < 0.05); in the
miR-381 mimics and si-CXCR4 groups the mRNA expressions of CXCR4, SDF1, VEGF, HIF-1α
and Tie-2 markedly increased (all P < 0.05). Compared with the blank and NC groups, the miR-381
This article is protected by copyright. All rights reserved
mimics group exhibited higher miR-381 expression; the miR-381 inhibitor + si-CXCR4 group
displayed no significant differences in the mRNA expressions of CXCR4, SDF1, VEGF, HIF-1α and
Tie-21 (all P > 0.05) but markedly decreased miR-381 expression (P < 0.05) (FIG 6A).
After transfection, the I/R groups had a significant decrease in the protein expressions of
CXCR4, SDF1, VEGF, HIF-1α and Tie-2 compared with the sham group (all P < 0.05). Compared
with the blank and NC groups, the miR-381 inhibitor + si-CXCR4 group showed no significant
differences in the protein expressions of CXCR4, SDF1, VEGF, HIF-1α and Tie-21 (all P > 0.05). In
the miR-381 inhibitor group, the protein expressions of CXCR4, SDF1, VEGF, HIF-1α and Tie-2
were significantly ascended than the blank and NC groups (all P < 0.05). Meanwhile, compared
with the blank and NC groups, the miR-381 mimics and si-CXCR4 groups had significantly
diminished protein expressions of CXCR4, SDF1, VEGF, HIF-1α and Tie-2 (all P < 0.05). No
significant differences were observed in the protein expressions of CXCR4, SDF1, VEGF, HIF-1α
and Tie-2 among the miR-381 inhibitor + si-CXCR4, blank and NC groups (P > 0.05) (FIG 6B-C).
MiR-381 promotes cell proliferation of RTECs
MTT results showed the effects of different groups, different time points and the interaction
among groups and time on cell proliferation. As shown in FIG 7, compared with the sham group,
cell proliferation in the blank, NC, miR-381 mimics, miR-381 inhibitor, si-CXCR4 and miR-381
inhibitor + si-CXCR4 groups were descended at all time points of 24 h, 48 h and 72 h (all P < 0.05).
Cell proliferation was no differences between the blank and NC groups at the four different time
points. In comparison with the blank and NC groups, cell proliferation amongst the miR-381
mimics and si-CXCR4 groups showed a significant increase at 24 h, 48 h and 72 h time points while
the cell proliferation in the miR-381 inhibitor group decreased significantly (all P < 0.05). There
were no significant differences in cell proliferation in the miR-381 inhibitor+ si-CXCR4 group
compared to blank and NC groups (P > 0.05).
MiR-381 arrested RTECs in G2 and S phases and inhibited apoptosis of RTECs
PI single staining results (FIG 8A-B) revealed that, compared with the sham group, the cells of
This article is protected by copyright. All rights reserved
RTEC in G1 phase significantly increased in the I/R groups (all P < 0.05), however, the cell
percentage of cells existing in the G2 and S phases was dramatically declined (all P < 0.05). These
above data were no significant differences among the blank, NC and miR-381 inhibitor + si-CXCR4
groups (all P > 0.05). The number of cells in the miR-381 inhibitor group was enhanced in the G1
phase and lower in the G2 and S phases compared than the blank group and NC group, indicating
that RTEC was significantly trapped (P < 0.05). On the other hand, the miR-381 mimics and
si-CXCR4 groups had declined reduction in cell number of RTEC in G1 phase but an increased
number in G2 and S phases compared with the blank and NC groups (P < 0.05).
Annexin V-FITC/ PI double staining in FIG 8C-D demonstrated that the cell apoptosis rate was
elevated in the blank, NC, miR-381 mimics, miR-381 inhibitor, si-CXCR4 and miR-381 inhibitor +
si-CXCR4 groups in comparison with the sham group (all P < 0.05). There were no obvious
differences observed in apoptosis rate between the NC and blank groups (P > 0.05). There were also
no significant differences in apoptosis rate in the miR-381 inhibitor + si-CXCR4 group compared
with the blank and NC groups, (P > 0.05), while apoptosis in the miR-381 inhibitor group was
incredibly elevated (P < 0.05). The miR-381 mimics and si-CXCR4 groups exhibited significantly
reduced cell apoptotic rates of RTEC (P < 0.05). No significant differences were observed between
these two groups.
Discussion
Renal I/R injury, is the leading cause of acute renal failure and multiple organ injury with a
substantial mortality rate that accounts for 50% of mortality rates worldwide [Chen et al., 2013; de
Vries et al., 2004]. Today, hemodialysis is the one and only effective treatment option available for
patients who suffer from renal I/R injury [De Vries et al., 2003]. Due to the complicated
pathophysiological pathway of renal I/R injury, several studies have recently reported that the
complement system may intervene and plays a core role in renal injury [de Vries et al., 2004].
MiRNAs are a class of small noncoding RNAs that can suppress post-transcriptional gene
This article is protected by copyright. All rights reserved
expression via binding to the 3’-untranslated region (UTR) of messenger RNAs (mRNAs),
effectively repressing translation or inducing sequence-specific mRNA degradation. Recent
evidence has revealed that miRNAs are abnormally expressed in various cancers and may act as
either oncogenes or tumor suppressor genes [Huntzinger and Izaurralde, 2011]. MiR-381 has
experienced functional analysis in tumors, and miR-381 has been observed that is associated with a
variety of malignant biological behaviors of a mount of tumor cells [He et al., 2016; Zhou et al.,
2015]. MiR-381 was shown to serve as a tumor suppressor in breast cancer, chondrosarcoma,
osteosarcoma and ovarian cancer. In these cancers, the expression levels of miR-381 were
commonly downregulated; over-expression of miR-381 in vitro could play anti-cancer roles by
growth arrest and metastasis inhibition. Despite the findings of miR-381 and its role in cancer, there
is little data about the effects of miR-381 expression on renal I/R injury. Our present study found
that miR-381 promoted the proliferation of RTEC in rat models of I/R injury by down-regulating
CXCR4.
Previous research has demonstrated other biological functions of miR-381 not only functions in
cancerous but also noncancerous conditions [He et al., 2016; Shi et al., 2015]. We also found that
over-expression of miR-381 significantly promoted the growth of RTECs. Moreover,
over-expression of miR-381 resulted in increased self-proliferation capacity of RTEC, which is a
positive indicator of tumor cell failure. Conversely, down-regulation of miR-381 led to decreased
self-proliferation capacity. What’s more, miR-381 has been found to exert inhibitory roles in the cell
migration and invasion of lung adenocarcinoma [Rothschild et al., 2012], which highlights the
tumor suppressive function of miR-381. In contrast, the oncogenic role of miR-381 stimulating
tumor growth in glioma has also been identified [Tang et al., 2011]. Our data revealed that miR-381
could inhibit apoptosis of RTECs. MiR-381 can also enhance the chemotherapy sensitivity of
several cancer cells, such as leukemia cancer and renal cancer [Chen et al., 2013; Xu et al., 2013]. A
previous study has reported that a series of miRNA members including miR-21, miR-20a,
miR-146a, miR-199a-3p, miR-187 and miR-214 were down-regulated during I/R injury [Godwin et
This article is protected by copyright. All rights reserved
al., 2010]. However, A Güçlü et al also reported that miR-320 was up-regulated in renal I/R and
could be a promising treatment target in renal I/R injury which potentially due to its typical
characteristics of cell and tissue-specific expressions [Guclu et al., 2016]. Compared with theirs, we
thus hypothesized that the effects of miR-381 on renal I/R injury might be correlated with its
function on RTECs. MiR-381 has been reported to participate in the regulation of epithelial cells in
multiple diseases, for instance, miR-381 was able to inhibit epithelial ovarian cancer malignancies
[Xia et al., 2016]. Moreover, miRNA-381 could target and down-regulate TMEM16A, which could
exacerbate renal injury [Cao et al., 2017; Lian et al., 2017].
A present study identified the targeting relationship between miR-381 and CXCR4 [Zhou et al.,
2015]. In addition, miR-381 has been shown to inhibit breast cancer cell proliferation,
epithelial-to-mesenchymal transition and metastasis by targeting CXCR4 [Xue et al., 2017]. In our
study, we demonstrated that over-expression of miR-381 lead to reduced expressions of CXCR4 and
VEGF, HIF-1α and Tie-2 in rats’ renal tissues. It is noteworthy that miR-381 can accelerate the
proliferation of RTEC by down-regulating CXCR4. The cell-surface receptor CXCR4 is a
seven-transmembrane-spanning, G-protein-coupled receptor for the CXC chemokine PBSF/SDF-1
(for pre-B-cell growth-stimulating factor/stromal-cell-derived factor), which is liable for
bone-marrow myelopoiesis, B-cell lymphopoiesis and cardiac ventricular septum formation [Zuo et
al., 2016]. CXCR4 also functions as a co-receptor for T-cell-line tropic human immunodeficiency
virus HIV-1 [Bieniasz et al., 1997]. Research has demonstrated that CXCR4 overexpression
exacerbates hemodynamic dysfunction and structural deterioration in a rat model of renal I/R injury
[Chen et al., 2010]. In relation to our findings, I/R results in increased CXCR4 and as well as
mRNA and protein expressions of CXCR4, indicating that the over-expression of CXCR4 plays a
critical role in dictating the outcome of renal I/R injury. However, contrary to our results, CXCR4 is
found to be expressed in developing vascular endothelial cells, and that mice which are CXCR4
deficient develop deformations of the large vessels supplying the gastrointestinal tract. These mice
and will die in utero and are defective in hematopoiesis, vascular development and cardiogenesis
This article is protected by copyright. All rights reserved
[Tachibana et al., 1998]. A previous study reported that renal acute injury may be improved with
bone marrow-derived mesenchymal stem cells (BMSCs) over expressing CXCR4 due to the
increased homing ability of BMSCs [Liu et al., 2013]. A majority of the differentially expressed
miRNAs is considered to be involved in stemness maintenance and differentiation [Baglio et al.,
2013]. In our study we discovered that CXCR4 mainly affect angiogenesis after renal I/R injury by
taking a part in the modulation of proliferation of RTECs. We speculated that in the process of
repair of renal I/R injury, miR-381 might regulate BMSCs via an mRNA-dependent way to
weakened the participation of CXCR4 in this. Taken together, our study demonstrated that the
elevated expression of CXCR4 and relative serum levels in RTECs were correlated with the severity
of renal I/R injury. We also discovered that miR-381 plays a vital role in inhibiting RTEC apoptosis
and promotes the growth of RTECs via down-regulation of CXCR4. This provides us with a novel
drug target for the treatment of renal I/R injury in patients. Despite our findings, some limitations
existed in this study. Firstly, the indices (miR-381 and CXCR4 gene) selected in the study were not
sufficient to support the findings. Secondly, current therapeutic approaches to renal I/R injury are
still in their early developmental stages as there is still a lack of research that helps understand the
genes or pathways that can target or suppress RTECs. Future studies are still needed to help us
further understand the complex relationship between miR-381, CXCR4 gene, RTECs and I/R injury
to extent our knowledge beyond this work.
This article is protected by copyright. All rights reserved
Acknowledgments
This work was supported by the Priority Academic Program Development of Jiangsu Higher
Education Institutions (PAPD); the 2016 "333 Project" Award of Jiangsu Province, the 2013
"Qinglan Project" of the Young and Middle-aged Academic Leader of Jiangsu College and
University, the National Natural Science Foundation of China (81571055, 81400902, 81271225,
31201039, 81171012, and 30950031), the Major Fundamental Research Program of the Natural
Science Foundation of the Jiangsu Higher Education Institutions of China (13KJA180001), and
grants from the Cultivate National Science Fund for Distinguished Young Scholars of Jiangsu
Normal University and the Graduate Student Innovation Program of Jiangsu Province
(KYZZ16_0467). We would like to acknowledge the reviewers for their helpful comments on this
paper.
Disclosure Statement
None
This article is protected by copyright. All rights reserved
References
Ambros V. The functions of animal microRNAs. Nature. 2004; 431(7006):350-355.[PubMed: 15372042]
Ayuk SM, Abrahamse H, Houreld NN. The role of photobiomodulation on gene expression of cell adhesion molecules
in diabetic wounded fibroblasts in vitro. Journal of photochemistry and photobiology. B, Biology. 2016;
161(368-374.[PubMed: 27295416]
Baglio SR, Devescovi V, Granchi D, Baldini N. MicroRNA expression profiling of human bone marrow mesenchymal
stem cells during osteogenic differentiation reveals Osterix regulation by miR-31. Gene. 2013;
527(1):321-331.[PubMed: 23827457]
Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004; 116(2):281-297.[PubMed:
14744438]
Bieniasz PD, Fridell RA, Anthony K, Cullen BR. Murine CXCR-4 is a functional coreceptor for T-cell-tropic and
dual-tropic strains of human immunodeficiency virus type 1. Journal of virology. 1997; 71(9):7097-7100.[PubMed:
9261443]
Cao Q, Liu F, Ji K, Liu N, He Y, Zhang W, Wang L. MicroRNA-381 inhibits the metastasis of gastric cancer by
targeting TMEM16A expression. Journal of experimental & clinical cancer research : CR. 2017; 36(1):29.[PubMed:
28193228]
Chen B, Duan L, Yin G, Tan J, Jiang X. miR-381, a novel intrinsic WEE1 inhibitor, sensitizes renal cancer cells to 5-FU
by up-regulation of Cdc2 activities in 786-O. Journal of chemotherapy. 2013; 25(4):229-238.[PubMed: 23816136]
Chen J, Chemaly E, Liang L, Kho C, Lee A, Park J, Altman P, Schecter AD, Hajjar RJ, Tarzami ST. Effects of CXCR4
gene transfer on cardiac function after ischemia-reperfusion injury. The American journal of pathology. 2010;
176(4):1705-1715.[PubMed: 20133817]
Chen TH, Yang YC, Wang JC, Wang JJ. Curcumin treatment protects against renal ischemia and reperfusion
injury-induced cardiac dysfunction and myocardial injury. Transplantation proceedings. 2013;
45(10):3546-3549.[PubMed: 24314955]
Coca SG, Yusuf B, Shlipak MG, Garg AX, Parikh CR. Long-term risk of mortality and other adverse outcomes after
acute kidney injury: a systematic review and meta-analysis. American journal of kidney diseases : the official
journal of the National Kidney Foundation. 2009; 53(6):961-973.[PubMed: 19346042]
Czarkowski M. [Helsinki Declaration--next version]. Polski merkuriusz lekarski : organ Polskiego Towarzystwa
Lekarskiego. 2014; 36(215):295-297.[PubMed: 24964503]
De Vries B, Matthijsen RA, Wolfs TG, Van Bijnen AA, Heeringa P, Buurman WA. Inhibition of complement factor C5
protects against renal ischemia-reperfusion injury: inhibition of late apoptosis and inflammation. Transplantation.
2003; 75(3):375-382.[PubMed: 12589162]
de Vries B, Walter SJ, Peutz-Kootstra CJ, Wolfs TG, van Heurn LW, Buurman WA. The mannose-binding
lectin-pathway is involved in complement activation in the course of renal ischemia-reperfusion injury. The
American journal of pathology. 2004; 165(5):1677-1688.[PubMed: 15509537]
Erkilic E, Kesimci E, Alaybeyoglu F, Kilinc I, Tural R, Yazgan A, Gumus T, Sepici Dincel A, Dumlu EG, Kanbak O.
Does remifentanil attenuate renal ischemia-reperfusion injury better than dexmedetomidine in rat kidney? Drug
design, development and therapy. 2017; 11(677-683.[PubMed: 28331287]
Furusato B, Mohamed A, Uhlen M, Rhim JS. CXCR4 and cancer. Pathology international. 2010;
60(7):497-505.[PubMed: 20594270]
Godwin JG, Ge X, Stephan K, Jurisch A, Tullius SG, Iacomini J. Identification of a microRNA signature of renal
ischemia reperfusion injury. Proceedings of the National Academy of Sciences of the United States of America.
2010; 107(32):14339-14344.[PubMed: 20651252]
Guclu A, Kocak C, Kocak FE, Akcilar R, Dodurga Y, Akcilar A, Secme M. Micro RNA-320 as a novel potential
biomarker in renal ischemia reperfusion. Renal failure. 2016; 38(9):1468-1475.[PubMed: 27760486]
Hatcher HC, Tesfay L, Torti SV, Torti FM. Cytoprotective Effect of Ferritin H in Renal Ischemia Reperfusion Injury.
PloS one. 2015; 10(9):e0138505.[PubMed: 26379029]
He X, Wei Y, Wang Y, Liu L, Wang W, Li N. MiR-381 functions as a tumor suppressor in colorectal cancer by targeting
Twist1. OncoTargets and therapy. 2016; 9(1231-1239.[PubMed: 27094913]
Hou C, Meng F, Zhang Z, Kang Y, Chen W, Huang G, Fu M, Sheng P, Zhang Z, Liao W. The Role of MicroRNA-381 in
Chondrogenesis and Interleukin-1-beta Induced Chondrocyte Responses. Cellular physiology and biochemistry :
international journal of experimental cellular physiology, biochemistry, and pharmacology. 2015;
36(5):1753-1766.[PubMed: 26184031]
Huntzinger E, Izaurralde E. Gene silencing by microRNAs: contributions of translational repression and mRNA decay.
Nature reviews. Genetics. 2011; 12(2):99-110.[PubMed: 21245828]
Lian H, Cheng Y, Wu X. TMEM16A exacerbates renal injury by activating P38/JNK signaling pathway to promote
podocyte apoptosis in diabetic nephropathy mice. Biochemical and biophysical research communications. 2017;
487(2):201-208.[PubMed: 28392397]
Liu N, Patzak A, Zhang J. CXCR4-overexpressing bone marrow-derived mesenchymal stem cells improve repair of
acute kidney injury. American journal of physiology. Renal physiology. 2013; 305(7):F1064-1073.[PubMed:
23884141]
Medeiros VF, Azevedo IM, Carvalho MD, Oliveira CN, Egito ES, Medeiros AC. The renoprotective effect of oral
This article is protected by copyright. All rights reserved
Tadalafil pretreatment on ischemia/reperfusion injury in rats. Acta cirurgica brasileira. 2017; 32(2):90-97.[PubMed:
28300873]
Mehta RL, Kellum JA, Shah SV, Molitoris BA, Ronco C, Warnock DG, Levin A, Acute Kidney Injury N. Acute Kidney
Injury Network: report of an initiative to improve outcomes in acute kidney injury. Critical care. 2007;
11(2):R31.[PubMed: 17331245]
Mejia-Vilet JM, Ramirez V, Cruz C, Uribe N, Gamba G, Bobadilla NA. Renal ischemia-reperfusion injury is prevented
by the mineralocorticoid receptor blocker spironolactone. American journal of physiology. Renal physiology. 2007;
293(1):F78-86.[PubMed: 17376767]
Montuori R, Coscia-Porrazzi L. [Semio-pathogenetic contribution to the knowledge of Ehlers-Danlos syndrome].
Omnia medica et therapeutica. 1967; 45(2):425-448.[PubMed: 5628936]
Rothschild SI, Tschan MP, Jaggi R, Fey MF, Gugger M, Gautschi O. MicroRNA-381 represses ID1 and is deregulated
in lung adenocarcinoma. Journal of thoracic oncology : official publication of the International Association for the
Study of Lung Cancer. 2012; 7(7):1069-1077.[PubMed: 22592211]
Shi X, Yan C, Liu B, Yang C, Nie X, Wang X, Zheng J, Wang Y, Zhu Y. miR-381 Regulates Neural Stem Cell
Proliferation and Differentiation via Regulating Hes1 Expression. PloS one. 2015; 10(10):e0138973.[PubMed:
26431046]
Sun P, Liu J, Li W, Xu X, Gu X, Li H, Han H, Du C, Wang H. Human endometrial regenerative cells attenuate renal
ischemia reperfusion injury in mice. Journal of translational medicine. 2016; 14(28.[PubMed: 26822150]
Tachibana K, Hirota S, Iizasa H, Yoshida H, Kawabata K, Kataoka Y, Kitamura Y, Matsushima K, Yoshida N,
Nishikawa S, Kishimoto T, Nagasawa T. The chemokine receptor CXCR4 is essential for vascularization of the
gastrointestinal tract. Nature. 1998; 393(6685):591-594.[PubMed: 9634237]
Tang H, Liu X, Wang Z, She X, Zeng X, Deng M, Liao Q, Guo X, Wang R, Li X, Zeng F, Wu M, Li G. Interaction of
hsa-miR-381 and glioma suppressor LRRC4 is involved in glioma growth. Brain research. 2011;
1390(21-32.[PubMed: 21435336]
Williams JR. The Declaration of Helsinki and public health. Bulletin of the World Health Organization. 2008;
86(8):650-652.[PubMed: 18797627]
Xia B, Li H, Yang S, Liu T, Lou G. MiR-381 inhibits epithelial ovarian cancer malignancy via YY1 suppression.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine. 2016;
37(7):9157-9167.[PubMed: 26768613]
Xu Y, Ohms SJ, Li Z, Wang Q, Gong G, Hu Y, Mao Z, Shannon MF, Fan JY. Changes in the expression of miR-381 and
miR-495 are inversely associated with the expression of the MDR1 gene and development of multi-drug resistance.
PloS one. 2013; 8(11):e82062.[PubMed: 24303078]
Xue Y, Xu W, Zhao W, Wang W, Zhang D, Wu P. miR-381 inhibited breast cancer cells proliferation,
epithelial-to-mesenchymal transition and metastasis by targeting CXCR4. Biomedicine & pharmacotherapy =
Biomedecine & pharmacotherapie. 2017; 86(426-433.[PubMed: 28012397]
Zhang Q, Zhao S, Pang X, Chi B. MicroRNA-381 suppresses cell growth and invasion by targeting the liver receptor
homolog-1 in hepatocellular carcinoma. Oncology reports. 2016; 35(3):1831-1840.[PubMed: 26677080]
Zhou S, Ye W, Ren J, Shao Q, Qi Y, Liang J, Zhang M. MicroRNA-381 increases radiosensitivity in esophageal
squamous cell carcinoma. American journal of cancer research. 2015; 5(1):267-277.[PubMed: 25628936]
Zou YR, Kottmann AH, Kuroda M, Taniuchi I, Littman DR. Function of the chemokine receptor CXCR4 in
haematopoiesis and in cerebellar development. Nature. 1998; 393(6685):595-599.[PubMed: 9634238]
Zuo K, Kuang D, Wang Y, Xia Y, Tong W, Wang X, Chen Y, Duan Y, Wang G. SCF/c-kit transactivates CXCR4-serine
339 phosphorylation through G protein-coupled receptor kinase 6 and regulates cardiac stem cell migration.
Scientific reports. 2016; 6(26812.[PubMed: 27245949]
This article is protected by copyright. All rights reserved
Legends
FIG 1 Positive expression of CXCR4 (B) in the sham and I/R groups using immunohistochemistry
staining (A) (200 ×)
Note: I/R, ischemia reperfusion injury; the black arrows represent the migration and expression
locations of CXCR4 in the renal tissues; *, P < 0.05, compared with the sham group.
FIG 2 Pathological changes and the score of renal tissues of rats in the sham and I/R groups using
HE staining (200 ×)
Note: A, HE staining of rat renal tissues the sham and I/R groups; B, PAS staining of rat renal
tissues in the sham and I/R groups; C, pathological score of renal tissues of rats in the sham and I/R
groups; I/R, ischemia reperfusion injury; HE staining, hematoxylin and eosin; PAS, periodic acid
Schiff ; * P < 0.05, compared with the sham group.
FIG 3 Variation of MVD of rats in the sham and I/R groups
Note: I/R, ischemia reperfusion injury; MVD, microvascular density; *, P < 0.05, compared with
the sham group.
FIG 4 Dual Luciferase reporter gene assay Identification of the targeting relationship between
miR-381 and CXCR4
Note: NC, negative control; Wt, wild-type; Mut, mutant; A, predicted binding site of miR-381 on
CXCR4 3'UTR; B, detection of luciferase activity; *, P < 0.05, compared with the NC group.
FIG 5 The miR-381 expression (A) and mRNA (A) and protein (B, C) expressions of, CXCR4,
SDF1, VEGF, HIF-1α and Tie-2 of rats in the sham and I/R groups
Note: I/R, ischemia reperfusion injury; SDF1, stromal cell-derived factor-1, VEGF, vascular
endothelial growth factor, HIF-1α, hypoxia-inducible factor 1; *, P < 0.05, compared with the sham
group.
FIG 6 miR-381 expression and mRNA and protein expressions of CXCR4, SDF1, VEGF, HIF-1α
and Tie-2 in different groups after transfection
Note: I/R, ischemia reperfusion injury; NC, negative control; RT-qPCR, reverse transcription
This article is protected by copyright. All rights reserved
quantitative polymerase chain reaction; A, relative mRNA expressions of CXCR4, SDF1, VEGF,
HIF-1α and Tie-2 in each group after transfection; B, protein band images of CXCR4, SDF1, VEGF,
HIF-1α and Tie-2 in each group after transfection; C, relative protein expressions of CXCR4, SDF1,
VEGF, HIF-1α and Tie-2 in each group after transfection using western blotting; SDF1, stromal
cell-derived factor-1, VEGF, vascular endothelial growth factor, HIF-1α, hypoxia-inducible factor 1;
*, P < 0.05, compared with the sham group; #, P < 0.05, compared with the blank and NC groups.
FIG 7 Cell proliferation of RTECs in rats in the sham and I/R groups using MTT assay
Note: OD, optical density; NC, negative control; RTEC, renal tubular epithelial cells; MTT,
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide; *, P < 0.05, compared with the
sham group; #, P < 0.05, compared with the blank and NC groups.
FIG 8 Cell cycles (A, B) and apoptosic rates (C, D) of rats in the sham and I/R groups using flow
cytometry
Note: NC, negative control; *, P < 0.05, compared with the sham group; #, P < 0.05, compared with
the blank and NC groups.
This article is protected by copyright. All rights reserved
Table 1 Primer sequences of related genes for RT-qPCR
Genes
miR-381
Primer sequences 5’- 3’
Forward: TGGTACTTAAAGCGAGGTTGC
Reverse: GGTCATGCACACACATACCAC
CXCR4
Forward: GCTAGCTAGCATGGAAATATACAC
Reverse: GGAATTCTTAGCTGGAGTGAAAAC
SDF1
Forward: TGAGGCCAGGGAAGAGTGAG
Reverse: GACACATGGCGATGAATGGA
VGEF
Forward: CGCAAGAAATCCCGGTTTAA
Reverse: GGATCTTGGACAAACAAATGCTT
HIF-1α
Forward: GTGTGTGTGAATTATGTTGTAAGTGGTATT
Reverse: TTAGTGAACAGCTGGGTCATTTTC
Tie-2
Forward: ATTGACGTGAAGATCAAGAATGCCACC
Reverse: ATCCGGATTGTTTTGGCCTTCCTGTT
U6
Forward: CTCGCTTCGGCAGCACA
Reverse: ACGCTTCACGAATTTGCGT
β-actin
Forward: GTCAGGTCATCACTATCGGCAAT
Reverse: AGAGGTCTTTACGGATGTCAACGT
Note: RT-qPCR, reverse transcription quantitative polymerase chain reaction; SDF1, stromal
cell-derived factor-1, VEGF, vascular endothelial growth factor, HIF-1α, hypoxia-inducible factor 1.
This article is protected by copyright. All rights reserved
Table 2 Variation of blood flow, BUN, Scr and MDA of rats in Sham and I/R groups
Sham group
I/R group
P value
Blood flow (mL/100g·min) 79.32 ± 7.18
47.85 ± 4.33
< 0.001
BUN (mmol/L)
5.56 ± 0.56
15.32 ± 1.53
< 0.001
Scr (μmol/L)
60.36 ± 6.35
95.86 ± 9.61
< 0.001
MDA (μmol/L)
6.50 ± 0.21
9.76 ± 0.64
< 0.001
Note: BUN, blood urea nitrogen; Scr, serum creatinine; MDA, malondialdehyde; I/R, ischemia
reperfusion injury; *, P < 0.05, compared with the sham group
This article is protected by copyright. All rights reserved
This article is protected by copyright. All rights reserved
This article is protected by copyright. All rights reserved
This article is protected by copyright. All rights reserved
This article is protected by copyright. All rights reserved
This article is protected by copyright. All rights reserved
This article is protected by copyright. All rights reserved
This article is protected by copyright. All rights reserved
This article is protected by copyright. All rights reserved
Документ
Категория
Без категории
Просмотров
5
Размер файла
1 222 Кб
Теги
26466, jcb
1/--страниц
Пожаловаться на содержимое документа