close

Вход

Забыли?

вход по аккаунту

?

uploaded 0A305D1040

код для вставкиСкачать
На правах рукописи
АНДРЕЙЧЕНКО ИРИНА НИКОЛАЕВНА
ЭКСПРЕССИЯ ТРАНСКРИПЦИОННЫХ ФАКТОРОВ
СЕМЕЙСТВА VSX В МОРФОГЕНЕЗЕ СЕТЧАТКИ КУР
GALLUS DOMESTICUS
03.02.07 - генетика
АВТОРЕФЕРАТ
диссертации на соискание ученой степени
кандидата биологических наук
Москва 2017
Общая характеристика работы
Изучение экспрессии регуляторных генов в ходе онтогенеза и их участие в
дифференцировке клеток различного типа
-
центральное направление
современной генетики и биологии развития. В результате дифференциальной
активности генов формируются различные клетки, ткани и органы, а также
механизмы поддержания их формирования и регенерации. Одной из
классических экспериментальных моделей биологии развития являются
эмбрионы кур, закономерности эмбриогенеза которых хорошо изучены как в
норме, так и при воздействии широкого спектра эндогенных и экзогенных
факторов. Сетчатка позвоночных как объект исследования представляет
удобную модельную систему с детально описанными стадиями морфогенеза во
времени.
Нейральная
сетчатка
содержит
шесть
типов
высокоспециализированных нейронов и один тип глии: амакриновые,
биполярные,
горизонтальные,
ганглиозные
и
клетки
фоторецепторные
Мюллеровской
глии.
(палочки
Морфогенез
и
колбочки),
сетчатки
у
представителей различных систематических групп существенно различается,
однако дифференцировка клеток у всех изученных видов - от дрозофилы до
человека - происходит в строгой последовательности и регулируется
согласованной работой каскада транскрипционных факторов (Harada et al.,
2007). Установлено, что для специализации клеток сетчатки необходима
экспрессия регуляторных генов Pax6, Pax2, Rx, Lhx2, Vsx2, Optx2 (Zagozewski et
al., 2014). Определяющая роль в морфогенезе сетчатки принадлежит
транскрипционным факторам семейства Vsx (Visual system homeobox), которые
начинают экспрессироваться на ранних этапах формирования глаза. Изучение
Vsx1/Chx10-1 и Vsx2/Chx10 имеет не только фундаментальное, но и прикладное
значение, так как аномалии развития глаз и заболевания сетчатки у человека
связывают с мутациями этих генов (Reis et al., 2011). Понимание регуляторных
3
механизмов дифференцировки клеток сетчатки важно для развития технологий
регенеративной медицины.
Цель и задачи исследования
Целью работы являлось исследование экспрессии генов, кодирующих
транскрипционные факторы семейства Vsx/Chx (Visual system homeobox/Ceh-10
homeodomain-containing homolog), в сетчатке глаза кур Gallus domesticus на
последовательных стадиях развития.
В работе были поставлены следующие задачи:
1. Изучить характер экспрессии генов Vsx1/Chx10-1 и Vsx2/Chx10 с
помощью метода полимеразной цепной реакции (ПЦР) в формирующейся
сетчатке кур на стадиях Е4-Е14.
2. Провести
количественный
анализ
уровня
экспрессии
генов
Vsx1/Chx10-1 и Vsx2/Chx10 с помощью ПЦР в реальном времени на
стадиях Е4-Е14.
3. Исследовать локализацию белков транскрипционных факторов
Vsx1/Chx10-1 и Vsx2/Chx10 в ходе формирования сетчатки.
4. Выявить пространственные и временные особенности экспрессии
анализируемых регуляторных факторов в ходе морфогенеза сетчатки кур.
Научная новизна полученных результатов
Для
исследования
характера
экспрессии
генов,
кодирующих
транскрипционные факторы Vsx1/Chx10-1 и Vsx2/Chx10, в формирующейся
сетчатке
эмбрионов
кур
впервые
применен
комплексный
подход.
Использование широкого спектра молекулярно-генетических методов и
методов
классической
иммуногистохимии
4
позволило
охарактеризовать
пространственно-временные особенности экспрессии исследуемых генов.
Получены
данные
последовательных
об
активности
стадиях
развития.
этих
генов
Впервые
и
локализации
локализация
на
продуктов
проведена не на срезах, а на целой сетчатке с помощью конфокальной
микроскопии. Одним из основных результатов работы является установление
факта участия генов Vsx1/Chx10-1 и Vsx2/Chx10 в регуляции дифференцировки
биполярных клеток сетчатки, однако уровень экспрессии генов, динамика и
локализация соответствующих белков существенно отличаются. Vsx1/Chx10-1
и Vsx2/Chx10 могут принимать участие в дифференцировке биполярных клеток
разного типа.
Научная и практическая значимость работы
Анализ особенностей экспрессии генов Vsx1/Chx10-1 и Vsx2/Chx10 в
формирующейся сетчатке кур имеет общебиологическое значение, поскольку
вносит вклад в формирование целостной картины о молекулярно-генетических
механизмах развития глаза. Несмотря на то, что экспрессия Vsx1 в морфогенезе
сетчатки позвоночных достаточно хорошо охарактеризована, его роль в
заболеваниях глаза человека изучена мало. Имеются данные о связи мутаций
VSX1 с макулярной дегенерацией сетчатки (Valleix et al., 2006). Показано, что
мутации VSX2/CHX10 у человека являются причиной многих аномалий
развития глаз и заболеваний сетчатки (Reis et al., 2011). Впервые получены
результаты, которые расширяют и углубляют представления о молекулярногенетических механизмах дифференцировки биполярных клеток сетчатки в
ходе эмбриогенеза. Эти данные могут быть использованы в медикобиологических исследованиях, а также при чтении лекций по биологии и
генетике развития.
5
Основные положения, выносимые на защиту
1. Применение комплекса молекулярно-генетических методов и
методов классической имуногистохимии для изучения экспрессии
регуляторных генов семейства Vsx в ходе формирования сетчатки у кур
позволило охарактеризовать пространственно-временные особенности
экспрессии исследуемых генов.
2. С помощью методов ПЦР и ПЦР-РВ установлены различия в
уровне экспрессии генов семейства Vsx.
3. С помощью метода иммуногистохимии выявлены различия в
локализации белков исследованных генов в ходе формирования сетчатки
кур.
4. Полученные результаты свидетельствуют о том, что родственные
гены семейства Vsx играют важную, но отличающуюся роль в
дифференцировке клеток сетчатки.
Личное участие автора
Все этапы работы: планирование и выполнение экспериментов, а также
дальнейший анализ полученных данных выполнены автором лично в Институте
биологии развития им. Н.К. Кольцова РАН.
Степень достоверности и апробация работы
Основные результаты диссертационной работы были представлены на
обсуждение
научной
общественности
на
следующих
российских
и
международных форумах: Всероссийской научной конференции молодых
6
ученых «Проблемы биомедицинской науки третьего тысячелетия», СанктПетербург, 2010 г.; конференции молодых ученых ИБР РАН, Москва, 2012 г.;
IX
Международном
междисциплинарном
конгрессе
«Нейронаука
для
медицины и психологии», Судак, Крым 2013 г.; XVI школе-конференции
«Актуальные проблемы биологии развития» ИБР РАН, Москва, 2013 г.;
XI Международной конференции «Проблемы современной биологии», Москва,
2014 г.; на отчётной конференции «Живая природа: современное состояние и
проблемы развития. Динамика и сохранение генофондов». Москва: ИОГен,
2014 г., III Всероссийской научной конференции молодых ученых «Проблемы
биомедицинской науки третьего тысячелетия», Санкт-Петербург, 2016 г.
Публикации
По материалам диссертации опубликовано 4 печатных работы (из них 3
статьи в журналах, соответствующих перечню ВАК, 1 статья в научном
сборнике) и 7 тезисов конференций.
Структура и объем диссертации
Диссертационная работа изложена на 100 страницах, содержит 33 рисунка,
12 таблиц и состоит из следующих разделов: введение, обзор литературы,
материалы и методы, результаты, обсуждение, заключение, выводы и список
литературы. Библиография включает 117 источников.
7
Материалы и методы исследования
Объект исследования
Исследование выполнено на сетчатке кур Gallus domesticus породы белый
леггорн с 4 по 14 сут эмбрионального развития (Е4-Е14). Оплодотворенные
яйца инкубировали при 37.5°С и 60% влажности. Стадии развития эмбрионов
определяли в соответствие с таблицей Гамильтона и Гамбургера (Hamburger
and Hamilton, 1951). На каждой стадии развития фиксировали по 12 образцов: 4
- для молекулярных исследований, 8 - для иммуногистохимических.
Препарирование тканей для молекулярно-генетических исследований
Для молекулярных исследований на 4 - 14 сут эмбрионального развития
проводили препарирование сетчатки под бинокулярной лупой МБС-9 в
следующей последовательности: по лимбу отсекали передний сегмент глаза от
заднего, удаляли роговицу, хрусталик и цилиарное тело вместе с радужкой.
Сетчатку отделяли, подрезая глазной нерв. Для иммуногистохимических
исследований на заднем сегменте глаза делали четыре разреза. Образовавшиеся
«розетки» фиксировали 4%-ным формальдегидом, после чего отделяли
сетчатку.
Рисунок 1. Препарирование сетчатки кур на стадии Е12.
8
Выделение тотальной РНК
Выделение тотальной РНК из сетчатки проводили при помощи смеси TRI®
Reagent (Sigma, США) по протоколу, предоставленному производителем.
Концентрацию РНК в пробе измеряли на приборе EPPENDORF Bio Photometer
plus. Удаление геномной ДНК проводили обработкой ДНК-азой I, свободной от
РНКаз, с последующим переосаждением.
Получение и нормировка кДНК
Синтез первой цепи кДНК на матрице мРНК выполняли с помощью
обратной транскриптазы Super Script (GIBCOBRL, США) и гексануклеотидов
фирмы СилексМ (Россия). Для оценки уровня экспрессии исследуемых генов
кДНК были предварительно отнормированы методом ПЦР по глицеральдегид3-фосфатдегидрогеназе
(Gapgh),
количество
мРНК
которой
в
клетках
различного типа принято считать одинаковым. В качестве отрицательного
контроля проводили ПЦР без кДНК матрицы.
Полимеразная цепная реакция
Полимеразную цепную реакцию (ПЦР) проводили на матрице кДНК с
помощью Tag-полимеразы, смеси дНТФ и реакционного буфера, входящих в
состав набора для амплификации (Силекс, Россия). Условия амплификации:
- для Vsx1, Pax6 ─ 94°С – 20 сек, 60°С – 20 сек, 72°С – 30 сек, 40 циклов;
- для Vsx2 ─ 94°С – 20 сек, 58°С – 20 сек, 72°С – 30 сек, 40 циклов;
- для Prox1, Rho ─ 94°С – 20 сек, 62°С – 20 сек, 72°С – 30 сек, 40 циклов;
- для Gapdh ─ 94°С – 20 сек, 58°С – 20 сек, 72°С – 30 сек, 30 циклов.
9
Конструирование праймеров
Для
конструирования
специфических
праймеров,
идентичных
соответствующим участкам ДНК исследуемых генов, использовали программу
DNAStar. Структура праймеров (Литех, Россия) для ПЦР и ПЦР-РВ указаны в
таблице 1.
Таблица 1. Праймеры, использованные в экспериментах.
Ген
Структура праймеров
Vsx1
5' – tcgcagatcaagaggaagaagc – 3' 5'– gtccatcatcaactctgccaag – 3'
Vsx2
5' – accgcaaaatgtccaaatc – 3' 5' – gtgatggctgagtatgggct – 3'
Vsx1 РТ
5' – agggagatgctggcggtgaag – 3' 5' – cactccatccctctgcccga – 3'
Vsx2 РТ
5' – gaggcggcacaggacaatct – 3' 5' – catgaaaacagagctgccagaagac – 3'
Pax6
5' – cagaagatcgtggaactcgc – 3' 5' – ggaggactctgtttatcgacgac – 3'
Prox1
5' – agcctgaggaccaagatgtcgt – 3' 5' – cctcactgtccagcttacagat – 3'
Rho
5' – acacgctgaagccggagatcaa – 3' 5' – ttcttgccgcagcagaggttgt – 3'
Gapdh
5' – agggtagtgaaggctgctgctga – 3' 5' – atgcagaactgagcggtggt – 3'
Gapdh РТ
5'– ccgtgttgtggacttgatggt – 3' 5' – gtgggggagacagaagggaacaga – 3'
Электрофорез в агарозном геле
ДНК-фрагменты,
полученные
при
ПЦР,
анализировали
с
помощью
электрофореза в 1,2%-ном агарозном геле в трис-ацетатном буфере ТАЕ (40 мМ
Трис, 20 мМ уксусной кислоты, 1 мМ ЭДТА) при рН=8.4. Интеркалирующим
красителем служил бромистый этидий (0.5 мкг/мл). Использована миникамера
для горизонтального электрофореза Horizon®58 (Life Technologies Inc., США).
10
ПЦР фрагменты визуализировали и фотографировали на трансиллюминаторе
GelDoc® XR с помощью программного обеспечения Quantity One (Bio-Rad
Laboratories, США). Размер фрагментов ДНК определяли относительно
фрагментов известной длины DNA ladder (Fermentas, Литва). Выделение ДНК
из агарозного геля проводили с помощью набора GENECLEAN (Bio-Rad,
США).
Секвенирование
Определение первичной структуры ДНК ПЦР-фрагментов, полученных со
специфическими праймерами к Vsx1 и Vsx2, выполняли по методу Сэнгера с
помощью набора реактивов BigDye 3.1 на приборе Genetic Analyzes ABI 3500
(Applied
Biosystems,
последовательностей
США).
Анализ
проводили
в
полученных
системе
нуклеотидных
NCBI
BLAST
(www.ncbi.nlm.hin.gov).
Полимеразная цепная реакция в реальном времени
Для
одновременной
амплификации
и
измерения
количества
ДНК
исследуемого гена использовали полимеразную цепную реакцию в режиме
«реального времени» (ПЦР-РВ), которую проводили на матрице кДНК на
приборе
7500
Real-time
PCR
System
(Applied
Biosystems,
США)
с
использованием интеркалирующего красителя SYBR Green и наборов
реагентов qPCRmix-HSSubr+Rox (Evrogen, Россия). Условия амплификации для
Vsx1 РТ, Vsx2 РТ, Gapdh РТ ─ 94°С – 15 сек, 60°С – 15 сек, 72°С – 20 сек, 40
циклов.
Определение количества мРНК каждого исследованного гена в
образце повторяли трижды. Анализ результатов, полученных с помощью ПЦРРВ, оценивали с помощью программного обеспечения 7500 Software v. 2.0.1
(Applied Biosystems, США). В качестве эндогенного контроля использовали ген
Gapdh, уровень которого в разных клетках считается условно одинаковым.
11
Иммуногистохимическое исследование
Имуногистохимические исследования проводили по стандартной методике
для
конфокальной
процедуру
antigen
микроскопии.
retrieval
Для
усиления
сигнала
фиксированную
-
использовали
ткань
(4%-ный
параформальдегид) выдерживали 20 мин при +95ºС в буфере, содержащем 250
mM Tris-HCl pH 8.5, 10 mM EDTA, 0.5% SDS. Для анализа иммунохимической
реакции использовали конфокальный микроскоп Leika SP5. Ядра клеток
окрашивали Propidium Iodide (PrI) после РНК-азной обработки. В качестве
отрицательного контроля ставили реакцию без нанесения первичных антител.
Названия антител, фирмы производители и разведения указаны в таблице 2.
Таблица 2. Антитела, использованные в эксперименте.
Антитела
Фирма
Разведение
Rabbit polyclonal to Vsx1
(GWB-226BB6)
GenWay Biotech
1:100
Sheep polyclonal to Vsx2
(PA1-12566)
Thermo Fisher
1:200
Mouse monoclonal to Prox1
(NBP1-30045)
Novus Biologicals
1:50
Anti-rabbit Alexa 488
Life Technologies
1:1000
Anti-mouse Alexa 546
Life Technologies
1:1000
Anti-sheep Alexa 546
Life Technologies
1:1000
Propidium Iodide
Life Technologies
1:1000
В работе использовалось оборудование Центра коллективного пользования
Института биологии развития им. Н.К. Кольцова РАН.
12
Результаты и обсуждение
В настоящей работе впервые выполнен сравнительный анализ экспрессии
двух родственных генов семейства Vsx, кодирующих транскрипционные
факторы Vsx1 и Vsx2, как на уровне мРНК, так и на белковом уровне, в
сетчатке глаза эмбрионов кур на последовательных стадиях развития.
Морфогенез сетчатки у кур осуществляются в течение раннего эмбриогенеза, в
первые 14 сут инкубации (Wai et al., 2006). Уже на 4-е сут эмбрионального
развития в формирующемся глазу присутствуют зачатки всех основных
структур. Внутренние сегменты фоторецепторов начинают развиваться после
10-х сут, а к 14-м сут формируются наружные сегменты и происходит
терминальная дифференцировка всех клеточных типов сетчатки (Mey et al.,
2000).
Поэтому
для
изучения
экспрессии
генов,
кодирующих
транскрипционные факторы семейства Vsx в сетчатке у кур, использовали эти
стадии развития, что позволило оценить их участие в пролиферации и
дифференцировке
клеток.
Семейство
Vsx
позвоночных
включает
два
родственных гена, Vsx1 и Vsx2, для которых кроме гомеодомена характерно
наличие парного (Paired-like) и CVC доменов.
Анализ динамики экспрессии генов Vsx1/Chx10-1 и Vsx2/Chx10 в
формирующейся сетчатке кур Gallus domesticus
Качественный анализ экспрессии генов Vsx1/Chx10-1 и Vsx2/Chx10 в
формирующейся сетчатке кур проводили методом ПЦР. Для контроля
дифференцировки клеток сетчатки использовали гены-маркеры: Prox1 - для
амакриновых, Pax6 – для ганглиозных, Rho – для фоторецепторных клеток.
Результаты
ПЦР
анализа
показали,
что
экспрессия
гена
Vsx2/Chx10
наблюдается на всех исследованных стадиях, Е4-Е14, но имеет максимум на 10
и 14-е сут инкубации, в то время как экспрессия Vsx1/Chx10-1 выявляется с 6-х
13
сут, достигая максимального уровня на 10-е и 14-е сут, когда дифференцировка
всех клеточных типов практически завершена (Рис.2).
Рисунок 2. Пцр-анализ экспрессии генов Vsx1/Chx10-1, Vsx2/Chx10, Pax6,
Prox1, Rho и Gapdh в формирующейся сетчатке кур на стадиях Е4-Е14 (в
сутках). К – контроль, ПЦР без кДНК.
Сходная динамика экспрессии наблюдается для транскрипционных факторов
Pax6 и Prox1 – возрастание уровня экспрессии до Е10, понижение и второй пик
Е14. Известно, что Pax6 принимает участие в регуляции дифференцировки
ганглиозных и горизонтальных клеток (Hatakeyama and Kageyma, 2004), а Prox1
в
контроле
процессов
пролиферации
клеток-предшественников
и
дифференцировке амакриновых клеток развивающейся сетчатки (Dyer et al.,
2003). Надо отметить, что транскрипты родопсина, Rho, присутствуют на всех
исследованных стадиях, начиная с 4 сут инкубации зародыша.
Для исключения некорректной трактовки результатов анализа генов, гомология
которых в гомео- и CVC доменах составляет более 90%, ДНК ПЦР-фрагментов,
полученных с праймерами к генам Vsx1/Chx10-1 и Vsx2/Chx10, были
секвенированы (Рис.3).
14
А.
В.
Рисунок 3. Сравнительный анализ нуклеотидных последовательностей ДНК
ПЦР-фрагментов Vsx1/Chx10-1 (А) и Vsx2/Chx10 (В) с последовательностью
мРНК Vsx1 и Vsx2 в банке данных NCBI BLAST.
Анализ
полученных
нуклеотидных
последовательностей
ДНК
ПЦР-
фрагментов Vsx1/Chx10-1 (А) и Vsx2/Chx10 в базе данных NCBI BLAST показал
100% идентичность с таковых генов Vsx1 и Vsx2 Gallus gallus.
15
Количественная оценка уровня экспрессии генов Vsx1/Chx10-1 и
Vsx2/Chx10 в морфогенезе сетчатки глаза кур Gallus domesticus
Количественную оценку мРНК Vsx1/Chx10-1 и Vsx2/Chx10 в формирующейся
сетчатке кур на стадиях Е4-Е14 проводили с помощью метода ПЦР-РВ.
Рисунок 4. ПЦР-РВ-анализ экспрессии транскриптов Vsx1/Chx10-1 и
Vsx2/Chx10 на стадиях Е4-Е14 развития сетчатки кур, в сутках.
Основным результатом экспериментов, выполненных для сравнения уровня
экспрессии генов семейства Vsx, является результат на основе наблюдения, что
транскрипты Vsx1/Chx10-1 и Vsx2/Chx10 детектируются на всех анализируемых
стадиях. Количество транскриптов генов возрастает и достигает максимального
уровня на стадии Е11, когда идет дифференцировка клеток и формируются
ядерные и сетчатые слои, а также на стадии Е14, когда слои сетчатки в
16
основном уже сформированы. Полученные результаты в целом согласуются с
данными ПЦР (Рис.4). Следует отметить, что на стадии Е12 происходит
уменьшение количества транскриптов как Vsx1/Chx10-1, так и Vsx2/Chx10, что
совпадает с данными ПЦР анализа других генов-регуляторов дифференцировки
клеток сетчатки Prox1 и Pax6. На рисунке 5 приведены результаты
сравнительного анализа уровней экспрессии генов Vsx1/Chx10-1 и Vsx2/Chx10,
полученных с помощью ПЦР-РВ, в период с 4 по 14 сут развития сетчатки.
Рисунок 5. Сравнительный анализ уровня экспрессии генов Vsx1/Chx10-1
и Vsx2/Chx10 на стадиях Е4-Е14 развития сетчатки кур (в сут). Метод ПЦРРВ.
Существенным различием является высокий уровень экспрессии Vsx2/Chx10 по
сравнению с Vsx1/Chx10-1. Пониженный уровень экспрессии гена Vsx1/Chx101,
согласуется
с
данными
филогенетических
исследований,
которые
показывают, что ген образовался путем дупликации Vsx2/Chx10 (Chow et al.,
2001).
17
Локализации белка Vsx1/Chx10-1 в формирующейся сетчатке кур
Исследование
локализации
продуктов
экспрессии
гена
Vsx1/Chx10-1
проводилось с помощью имуногистохимических методов, с последующим
анализом на конфокальном микроскопе. В качестве маркера дифференцировки
амакриновых клеток использовали Prox1, имунохимический сигнал которого
выявляется во внутреннем ядерном слое (Рис. 6).
Рисунок 6. Имуногистохимическое окрашивание сетчатки кур Vsx1 и Prox1
на стадиях Е6-Е10. ВНС – внутренний слой нейробластов, ВЯС – внутренний
ядерный слой. Стрелками показаны одиночные клетки, в которых выявляется
Vsx1. (Увеличение 50 мкм)
18
Белковый продукт Vsx1/Chx10-1 детектируется в формирующейся сетчатке,
начиная с 6-х по 14-е сут инкубации зародышей. На ранних стадиях (Е6-Е8)
сетчатка представлена наружным и внутренним слоями нейробластов, в
которых идет активная пролиферация, миграция и дифференцировка клеток.
Сигнал Vsx1 на ранних стадиях развития наблюдается в наружной части
внутреннего слоя нейробластов (Рис. 6). На стадиях Е10-Е12 продолжается
активный морфогенез сетчатки, клетки на этих стадиях уже организованы в
наружный и внутренний ядерные слои, а также в слой ганглиозных клеток.
Белок Vsx1 обнаружен в наружной части внутреннего ядерного слое (Рис. 6, 7).
Рисунок 7. Имуногистохимическое окрашивание сетчатки кур Vsx1 и Prox1
на стадиях Е12 – Е14. ВЯС – внутренний ядерный слой. Стрелками показана
ядерная локализация белка Vsx1. (Увеличение 50 мкм).
19
На стадии Е14, в сетчатке хорошо выражены наружний и внутренний
ядерные слои, а также слой ганглиозных клеток, которые уже разделены
наружным и внутренним сетчатым слоями. На этой стадии белок Vsx1 четко
выявляется в наружной части внутреннего ядерного слоя, где расположены
ядра биполярных клеток (Рис. 7).
Это согласуется с данными, полученными с помощью in situ гибридизации, о
локализации транскриптов Vsx1/Chx10-1 во внутреннем ядерном слое
формирующейся сетчатки эмбрионов кур (Chen and Cepko, 2000). Таким
образом, результаты экспериментов, цель которых состояла в определении
локализации белка Vsx1 в формирующейся сетчатке, свидетельствуют об его
участии в регуляции дифференцировки биполярных клеток сетчатки. Можно
предположить, что появление в ходе эволюции гена Vsx1 привело к увеличению
разнообразия типов биполярных клеток и способствовало оптимизации зрения
у позвоночных.
Локализации белка Vsx2/Chx10 в клетках формирующейся сетчатки кур
Исследование локализации продукта экспрессии гена Vsx2/Chx10 в клетках
развивающейся сетчатки кур проводили с помощью имуногистохимических
методов, с последующим анализом на конфокальном микроскопе.
Для контроля локализации белкового продукта Vsx2/Chx10 использовали
ядерный краситель Propidium Iodide (PrI). Белок Vsx2/Chx10 выявляется в
клетках внутреннего ядерного слоя на поздних стадиях формирования сетчатки
(Е12 - Е14) (Рис. 8). Белок Vsx2 на стадии Е12 наблюдается в клетках
внутреннего ядерного слоя и прослеживается тенденция к увеличению на
последующих стадиях развития. На стадии Е14, когда архитектура сетчатки
уже сформирована, белок Vsx2 также отчетливо выявляется и в наружном
ядерном слое, в сегментах фоторецепторов.
20
Рисунок 8. Имуногистохимическое окрашивание сетчатки кур Vsx2 и PrI на
стадиях Е12 - Е14. PrI – ядерный краситель, ВЯС — внутренний ядерный слой,
НЯС – наружный ядерный слой, ГС – ганглиозный слой. Стрелками показана
ядерная локализация белка Vsx2. (Увеличение 50 мкм).
Сравнительный
анализ
уровней
экспрессии
транскрипционных
факторов
экспрессироваться
раньше и уровень мРНК существенно выше, чем у
Vsx1/Chx10-1.
А
на
белковом
показал,
уровне
что
исследуемых
Vsx2/Chx10
наоборот, белок
начинает
Vsx1/Chx10-1
детектируется раньше и относительный уровень иммунохимического сигнала
выше, чем у Vsx2/Chx10. На основании данных по относительному уровню
мРНК (ПЦР) и полуколичественной оценке уровня флуоресцентного сигнала
белков Vsx1 и Vsx2 были построены графики (Рис. 9). Из Рис. 9а видно, что
21
экспрессия Vsx2 выше, чем Vsx1, но оба гена имеют сходные пики уровня
экспресии на стадиях Е10 и Е14. Относительный уровень флуоресцентного
сигнала белков Vsx1 и Vsx2 на стадии Е14 имеет максимальное значение, в то
время как на стадии Е10 минимальное (Рис. 9б). Несоответствие пиков
экспрессии генов и белка позволяет предположить, что мРНК исследуемых
генов после процессинга и выхода в цитоплазму не сразу приступает к
трансляции, а образует комплексы с белками – информосомы, тем самым
регулируя интенсивность синтеза белка. Этот результат для генов, кодирующих
транскрипционные факторы Vsx1/Chx10-1 и Vsx2/Chx10, получен впервые.
Рисунок 9. (а) кривые относительного уровня мРНК генов Vsx1 и Vsx2; (б)
кривые относительного уровня флуоресцентного сигнала белков Vsx1 и Vsx2.
22
Как
и
многие факторы
транскрипции
Vsx1/Chx10-1
и
Vsx2/Chx10
многофункциональны и участвуют как в дифференцировке клеток сетчатки, так
и в дальнейшем их функционировании.
Известно, что следствием нарушения экспрессии VSX2 у человека, а также у
мутантных мышей (Chx10or-J/or-J, - ocular retardation), является множественные
дефекты развития глаз, включая микрофтальмию (Reis et al., 2011).
Предполагается, что Vsx2/Chx10 может обладать потенциалом для лечения
дегенеративного заболевания глаза - пигментного ретинита сетчатки. Было
показано, что Vsx2/Chx10 опосредованно регулирует дифференцировку
фоторецепторов через активацию экспрессии фактора жизнеспособности
колбочек, RdCVF, нарушение экспрессии которого связывают с пигментным
ретинитом, часто приводящим к слепоте (Reichman et al., 2010). Другое
заболеванием глаза – макулярная дегенерация сетчатки – связывают с VSX1,
мутации в котором приводят к утрате центрального зрения.
23
Заключение
Согласно полученным данным, гены Vsx1/Chx10-1 и Vsx2/Chx10 имеют
максимальный уровень экспрессии на стадиях Е10-Е11, когда активно идет
дифференцировка клеток сетчатки и формирование ядерных слоев, а также на
стадии Е14, когда слои сетчатки уже сформированы. Ген Vsx2/Chx10 начинает
экспрессироваться раньше и уровень мРНК существенно выше, чем у
Vsx1/Chx10-1. На стадиях Е12-Е13, в период, когда в сетчатке формируются
сетчатые слои, происходит существенное уменьшение количества транскриптов
Vsx1/Chx10-1 и Vsx2/Chx10, как и других генов-регуляторов дифференцировки
клеток сетчатки, Prox1 и Pax6. Белки генов Vsx1/Chx10-1 и Vsx2/Chx10
выявляются во внутреннем ядерном слое сетчатки с Е6 и Е12, соответственно.
Сигнал определяется в наружной части внутреннего ядерного слоя сетчатки,
где расположены ядра биполярных клеток. Кроме того, на стадии Е14, белок
Vsx2/Chx10 выявляется и в наружном ядерном слое, в наружных сегментах
формирующихся
фоторецепторов.
Различия
уровня
экспрессии
высоко
гомологичных генов, а также динамика и локализация продуцирующих ими
белков, возможно, указывают на различие функций транскрипционных
факторов семейства Vsx в сетчатке. На основании собственных и имеющихся в
литературе данных можно предположить, что белки Vsx1/Chx10-1 и
Vsx2/Chx10 могут быть использованы при разработке способов лечения ряда
заболеваний сетчатки. Для того чтобы пролить свет на молекулярные
механизмы возникновения аномалий формирования глаз и подойти к
разработке
Планируются
методов
лечения
исследования
необходимы
экспрессии
дальнейшие
генов
исследования.
семейства
Vsx,
на
культивированных эмбрионов, глаз или сетчатки кур. Предполагается in vivo
проверить гипотезу взаиморегуляции генов семейства Vsx. На основании
анализа полученных результатов сделаны следующие выводы.
24
Выводы
1. Впервые проведены сравнительные исследования экспрессии
высоко гомологичных генов семейства Vsx в ходе морфогенеза сетчатки
кур (Е4-Е14). Выявлены значимые различия динамики и уровня
экспрессии Vsx1/Chx10-1 и Vsx2/Chx10.
2. Экспрессия гена Vsx1/Chx10-1, оцениваемая по уровню мРНК,
выявляется на стадиях Е6-Е11 и Е14, а гена Vsx2/Chx10 - на всех
проанализированных
стадиях.
Уровень
экспрессии
Vsx2/Chx10
существенно выше, чем - Vsx1/Chx10-1.
3. Гены Vsx1/Chx10-1 и Vsx2/Chx10 имеют максимальный уровень
экспрессии на стадии Е10, когда идет дифференцировка клеток сетчатки
и формирование ядерных слоев, и на стадии Е14, когда сетчатка
завершает формирование архитектуры.
4. Белок Vsx1 определяется на ранних стадиях эмбриогенеза (Е6-Е8) в
наружной части слоя нейробластов, на стадиях Е12-Е14 - в биполярных
клетках сетчатки. Белок Vsx2 также наблюдается в биполярных клетках
сетчатки, но только на стадиях Е12-Е14, а на стадии Е14 и в наружных
сегментах фоторецепторов.
5. Выявленные
различия в динамике и уровне экспрессии
родственных генов Vsx1/Chx10-1 и Vsx2/Chx10 согласуются с данными
филогенетических исследований и свидетельствуют о том, что эти гены
выполняют важную, но отличающуюся роль в морфогенезе сетчатки.
6. Выдвигается
гипотеза, согласно
которой
в ходе эволюции
произошла не только структурная, но и функциональная дивергенция
генов семейства Vsx, обусловленная оптимизацией функций глаза.
25
Список работ, опубликованных по теме диссертации.
Статьи в изданиях, входящих в перечень ВАК:
1. Андрейченко
И.Н.,
Фирсова
Н.В.
Изучение
экспрессии
транскрипционного фактора PITX2 в сетчатке глаза позвоночных.
Вестник МГОУ 2010, №3, С. 57-63.
2. Андрейченко
И.Н.,
Зиновьева
Р.Д.
Экспрессия
факторов
транскрипции семейства Vsx в ходе ретиногенеза у кур. Медицинский
академический журнал 2016, Т.16, №3. С. 99-101.
3. Андрейченко И.Н., Зиновьева Р.Д. Экспрессия транскрипционных
факторов семейства Vsx в ходе морфогенеза сетчатки глаз у кур Gallus
domesticus. Известия РАН. Серия биологическая. 2017. №2, С. 81–87.
Статьи в научных сборниках:
1. Болмазова (Андрейченко) И.Н., Зиновьева Р.Д. Экспрессия
транскрипционного фактора Vsx1 в сетчатке глаза позвоночных в
онтогенезе.
Статья
в
сборнике
XI Международной
практической конференции «Проблемы современной
Москва. Изд. «Спутник+» С. 64-68.
26
научно-
биологии».
2014.
Документ
Категория
Без категории
Просмотров
7
Размер файла
2 109 Кб
Теги
uploaded, 0a305d1040
1/--страниц
Пожаловаться на содержимое документа