close

Вход

Забыли?

вход по аккаунту

?

757

код для вставкиСкачать
THE JOURNAL OF COMPARATIVE NEUROLOGY 408:437–448 (1999)
Presynaptic Cytomatrix Protein Bassoon
Is Localized at Both Excitatory and
Inhibitory Synapses of Rat Brain
KARIN RICHTER,1 KRISTINA LANGNAESE,1 MICHAEL R. KREUTZ,1 GISELA OLIAS,2
RONG ZHAI,2 HENNING SCHEICH,1 CRAIG C. GARNER,2
AND ECKART D. GUNDELFINGER1*
1Leibniz Institute for Neurobiology (IfN), D-39118 Magdeburg, Germany
2Department of Neurobiology, University of Alabama at Birmingham,
Birmingham, Alabama 35213-0021
ABSTRACT
Bassoon is a 420-kDa protein specifically localized at the active zone of presynaptic nerve
terminals. It is thought to be involved in the structural organization of the neurotransmitter
release site. We studied the distribution of Bassoon transcripts and protein in rat brain and
assessed which types of presynaptic terminals contain the protein. As shown by in situ
hybridization, Bassoon transcripts are widely distributed in the brain and occur primarily in
excitatory neurons. In addition, examples of ␥-aminobutyric acid (GABA)-ergic neurons
expressing Bassoon are detected. At the light microscopic level, Bassoon immunoreactivity is
found in synaptic neuropil regions throughout the brain, with the strongest expression in the
hippocampus, the cerebellar cortex, and the olfactory bulb. Immunoelectron microscopy
showed that Bassoon immunoreactivity is found in both asymmetric type 1 and symmetric
type 2 synapses. Immunopositive asymmetric synapses include mossy fiber boutons and
various spine and shaft synapses in the hippocampus and mossy fiber terminals and parallel
fiber terminals in the cerebellum. Bassoon-containing symmetric synapses are observed, e.g.,
between basket and granule cells in the hippocampus, between Golgi cells and granule cells,
and between basket cells and Purkinje cells in the cerebellum. Within synaptic terminals,
Bassoon appears highly concentrated at sites opposite to postsynaptic densities. In cultured
hippocampal neurons, Bassoon was found to colocalize with GABAA and glutamate (GluR1)
receptors. These data indicate that Bassoon is a component of the presynaptic apparatus of
both excitatory glutamatergic and inhibitory GABAergic synapses. J. Comp. Neurol. 408:437–
448, 1999. r 1999 Wiley-Liss, Inc.
Indexing terms: hippocampus; cerebellum; presynaptic terminal; neurotransmitters; GABA;
glutamate
Presynaptic nerve terminals constitute the principal
site of regulated neurotransmitter release from nerve
cells. At the active zone, synaptic vesicles dock, fuse with
the presynaptic plasma membrane, and release their
transmitter contents in a highly coordinated way; thereafter, vesicles are rapidly recycled in a clathrin-mediated
process (for review, see Südhof 1995; De Camilli and Takei
1996; Betz and Angleson, 1998; Geppert and Südhof,
1998). A highly specialized apparatus at the active zone
composed of the presynaptic membrane and the underlying cytoskeleton is thought to define the site of transmitter
release and to spatially organize individual steps of the
synaptic vesicle cycle. At the ultrastructural level, a filamentous cytomatrix attached to the presynaptic mem-
r 1999 WILEY-LISS, INC.
Grant sponsor: Deutsche Forschungsgemeinschaft; Grant numbers: SFB
425/A1 and KR 1879/1-1; Grant sponsor: Fonds der Chemischen Industrie;
Grant sponsor: National Institutes of Health; Grant numbers: P50 HD32901,
AG 12978-02, and AG 06569-09; Grant sponsor: Keck Foundation; Grant
number: 931360.
Karin Richter’s current address: Institute of Medical Neurobiology,
Faculty of Medicine, Otto von Guericke University, 39120 Magdeburg,
Germany.
Kristina Langnaese’s current address: Institute for Human Genetics,
Faculty of Medicine, Otto von Guericke University, 39120 Magdeburg,
Germany.
*Correspondence to: E.D. Gundelfinger, Leibniz Institute for Neurobiology, Postfach 1860, D-39008 Magdeburg, Germany.
E-mail: [email protected]
Received 28 September 1998; Revised 11 January 1999; Accepted 14
January 1999
438
K. RICHTER ET AL.
brane and interspersed between synaptic vesicles has been
observed (Landis et al., 1988; Hirokawa et al., 1989; Burns
and Augustine, 1995; Brodin et al., 1997). The molecular
nature of this presynaptic cytomatrix is not well understood. Part of the filamentous meshwork appears to be
based on the actin/fodrin (i.e., brain spectrin) cytoskeleton
and on synapsin I, which links synaptic vesicles to actin
filaments (Landis et al., 1988; Hirokawa et al., 1989;
Burns and Augustine, 1995; Pieribone et al., 1995). Other
filaments of unknown protein composition and larger in
size than actin/spectrin fibers arise from the presynaptic
plasmalemma and extend into the proximal axoplasm
(Landis et al., 1988; Brodin et al., 1997). It has been
postulated that this filamentous cytomatrix may represent
the machinery that guides synaptic vesicles from the
synapsin-associated pool to the plasma membrane (Brodin
et al., 1997).
In an effort to identify new synaptic proteins of the
mammalian brain (Langnaese et al., 1996), we have
characterized two proteins, i.e., Piccolo and Bassoon, that
are strong candidates for being components of the presynaptic cytomatrix proximal to the active zone (CasesLanghoff et al., 1996; tom Dieck et al., 1998). Both
polypeptides are very large in size (molecular weight ⬎
400,000), behave biochemically as cytoskeleton-associated
proteins, and their distribution within synaptic nerve
terminals is restricted to the cytomatrix opposite to postsynaptic densities (Cases-Langhoff et al., 1996; tom Dieck
et al., 1998). Piccolo immunoreactivity is detected in
neurons of virtually all regions of the rat brain and is
found primarily in asymmetric type 1 synapses (CasesLanghoff et al., 1996).
We examined the distribution of Bassoon RNA and
protein in the rat brain by in situ hybridization and
immunohistochemistry, respectively. Moreover, we addressed the question as to which types of synapses contain
the protein. Bassoon transcripts are expressed in neurons
throughout the brain. Both somata of identifiable excitatory and inhibitory (i.e., ␥-aminobutyric acid [GABA]ergic) neurons contain Bassoon transcripts. Consistent
with the in situ hybridization data, Bassoon immunoreactivity is found widely distributed in synaptic neuropil
regions of the brain. At the ultrastructural level, brain
synapses can be distinguished by the symmetry of their
junctional membranes (Gray, 1959). Asymmetric type 1
synapses are characterized by a prominent electron-dense
postsynaptic thickening, the postsynaptic density (PSD),
and include primarily excitatory synapses that use glutamate as a transmitter. In contrast, symmetric type 2
synapses have a less pronounced postsynaptic thickening;
they include GABAergic and glycinergic inhibitory synapses (Gray, 1959; Landis and Reese, 1974; Shepherd and
Greer, 1990; Peters et al., 1991; Ziff, 1997). Immunoelectron microscopy showed that Bassoon is present in presynaptic terminals of both asymmetric and symmetric synapses and thus may play a general role in neurotransmitter
release and/or synaptic vesicle recycling.
MATERIALS AND METHODS
Antibodies
The production, purification, and characterization of
polyclonal and monoclonal Bassoon antibodies have been
described previously (tom Dieck et al., 1998). The monoclonal synaptophysin antibody was obtained from DAKO
(Hamburg, Germany; clone SY 38), and the rabbit polyclonal anti-glutamate receptor 1 (GluR1) antibody was
obtained from Chemicon International Inc. (Temecula, CA;
1:50). GABAA receptors were visualized by using mouse
monoclonal antibody against GABAA receptor ␤ chains
(clone bd 17, 1:30; Boehringer Mannheim, Mannheim,
Germany). Secondary antibodies were purchased from
Dianova (Hamburg, Germany; anti-mouse IgG-biotin) or
from Boehringer Mannheim (anti-rabbit IgG biotin, F[ab8]2
fragment). Fluorescein-isothiocyanate and Texas Red–
conjugated goat anti-mouse or goat anti-rabbit secondary
antibodies were obtained from Sigma (St. Louis, MO) and
Molecular Probes (Eugene, OR), respectively.
In situ hybridization
In situ hybridization was performed essentially as described by Seidenbecher et al. (1998) with the following
oligodeoxynucleotides: (1) GGAAGACAGGGAGGTGGGTGAGGTGCCAGATGTATAGCTA, (2) ACAGCGGTGTCGTCTTCCTCCAAGTTGTCTTCCTCGGCGC, and (3)
TAAGGCTCTCCATCTCCAGCTCAGGCTCCCGGTCTA
GGTT as antisense probes. They all produced identical
results. Controls included competition with 100-fold excess of unlabeled oligonucleotide, RNAse treatment of
sections before hybridization, and hybridization with sense
probe complementary to oligodeoxynucleotide 1. No specific signals were observed under any of these conditions
(see also tom Dieck et al., 1998).
Immunohistochemistry
and immunoelectron microscopy
Thirty-day-old male rats were used for immunohistochemical studies. Perfusion, fixation, sectioning, and preincubation of 60-µm sections were performed as detailed
previously (Richter et al., 1996). After the preincubation
procedure, sections were incubated for 2 days at room
temperature with 1:1,200 diluted rabbit polyclonal antisera, with polyclonal mouse antiserum diluted 1:800 or
with monoclonal Bassoon antibodies diluted 1:10,000 in
phosphate buffered saline (PBS) containing 1% (w/v) bovine serum albumin (BSA) and 0.05% (w/v) sodium azide.
For comparison, a few sections were incubated with a
monoclonal synaptophysin antibody diluted 1:2,000. For
light microscopic analysis, 0.1% (v/v) Triton X-100 was
added. For visualization of primary antibodies, the biotinavidin-peroxidase complex method was used (ABC Elite
kit, Vector, Burlingame, CA). The detection reaction was
Fig. 1. Distribution of Bassoon transcripts in rat brain. A: Hybridization signal on a horizontal section of rat brain that was hybridized
with a 35S-labeled antisense oligonucleotide. B–D: Hippocampus:
Silver grain accumulation over densely packed perikarya of granule
cells (Grp) and discrete cell bodies in the hilus region (hi) of the
dentate gyrus (DG; B) and over the pyramidal cell body layer (Py) in
the CA1 region (C) and CA3 region (D). E: Expression of Bassoon
transcript in the cerebellar cortex (Cbx). Dense labeling is detectable
over the granule cell bodies in the granule cell layer (gr). In addition,
silver grains are found over Purkinje cell bodies (Pu) and cell bodies in
the molecular layer (mol), most probably basket cells (arrowheads).
F: Silver grain accumulation over perikarya of pyramidal cells (arrowheads mark examples) in the cerebral cortex (Cx) layer V. G: In the
caudate-putamen (CPu), the majority of the neuronal cell bodies are
labeled. Cb, cerebellum; Cx, cerebral cortex; Hip, hippocampus; sl,
stratum lucidum; sr, stratum radiatum; so, stratum oriens; ml,
stratum moleculare. Scale bars ⫽ 5 mm in A, 20 µm in B–G.
BASSOON IN EXCITATORY AND INHIBITORY NERVE TERMINALS
Figure 1
439
440
K. RICHTER ET AL.
performed with 0.05% (w/v) diaminobenzidine and 0.01%
(v/v) H2O2.
Tissue preparation for electron microscopic analysis was
done as described by Richter et al. (1996). Ultrathin
sections were examined with a Leo912 electron microscope
(Leo Elektronenmikroskopie, Oberkochen, Germany) and
imaged with a Megascan 2K CCD camera (Gatan, Inc.,
Pleasanton, CA) using the digital Gatan 2.5 software. To
test for nonspecific immunolabeling, sections were incubated exactly as described above but in the absence of the
first antibody, with preimmune rabbit serum or with an
antibody solution that was preincubated with the fusion
protein (2.3 µg/ml). In no case was any nonspecific immunoreactivity observed.
Primary cultures of hippocampal neurons
and immunofluorescence microscopy
Primary cultures of hippocampal neurons were prepared from Sprague-Dawley rat embryos at embryonic day
19 essentially as described by Goslin and Banker (1991),
with modifications according to Ye and Sontheimer (1998).
Hippocampi were dissected out and stored in HEPES
buffered Hank’s balanced salt solution without Ca2⫹ and
Mg2⫹, pH 7.3, and dissociated with the papain dissociation
system (Worthington, NJ). Cells were plated onto poly-Dlysine-coated glass coverslips at densities from 2 to 5 ⫻ 104
cells/coverslip. Conditioned culture medium was used in
plating and maintaining the neurons (Ye and Sontheimer,
1998).
For double labeling, immunofluorescence microscopy
differentiated cultures (after 23 days in vitro) were fixed in
3.7% formaldehyde in PBS, pH 7.4, for 20–30 minutes,
washed twice with PBS, and permeabilized for 5 minutes
with 0.25% Triton X-100. Nonspecific binding was blocked
for 1 hour with PBS containing 2% BSA, 5% fetal calf
serum (FCS), 2% glycine, 50 mM NH4Cl, 0.05% NaN3.
Cells were incubated with primary antibodies diluted in
3% FCS in PBS overnight at 4°C. After washing in PBS,
cells were incubated with either fluorescein-isothiocyanate or Texas Red–conjugated goat anti-mouse or goat
anti-rabbit secondary antibodies. Cultures were rinsed in
PBS and mounted with Vectashield mounting medium
(Vector). Fluorescent images were taken with a Nikon
Diaphot 300 microscope equipped with a Photometrics
CH250 CCD camera and converted to Microsoft PowerPoint images.
Processing of photomicrographs
Light microscopic photographs, taken with a Leica/
LEITZ (Bensheim, Germany) DMRD system, were scanned
with an AGFA ARCUS (Orangeburg, NY) scanner (gray
scale, 600 ppi), scaled, and adjusted in brightness by using
the graphic software Adobe Photoshopy, version 3.0.3, to
mount composite displays. Digital electron microscopic
and fluorescent images were imported into Adobe Photoshop and processed in the same way. All hard copies were
printed with a FUJI Pictography 3000 printer (FUJI Photo
Film Europe, Düsseldorf, Germany).
Animals
All experiments were conducted in accordance with the
NIH guidelines for animals in research and with the
ethical principles defined by the German Animal Welfare
Act.
RESULTS
Distribution of Bassoon transcripts
Bassoon is encoded by an ⬇13-kb transcript that is
specifically expressed and widely distributed in the rat
brain (tom Dieck et al., 1998). By in situ hybridization, we
have assessed the distribution of Bassoon transcripts in
the rat brain in detail. Most intense hybridization signals
are observed in the cerebellar cortex, the hippocampal
formation, and the cerebral cortex; in other brain regions,
lower expression levels are detectable (Fig. 1A). At a
cellular level, a strong accumulation of silver grains is
detected over perikarya of excitatory neurons. These include granule cells in the dentate gyrus (Fig. 1B), pyramidal cells in the Ammon’s horn regions of the hippocampus
(Fig. 1C,D), granule cells in the cerebellum (Fig. 1E), and
pyramidal cells in the cerebral cortex (Fig. 1F). In addition, inhibitory GABAergic neurons express Bassoon. Examples of these neurons include basket cells in the molecular layer of the cerebellum and cerebellar Purkinje cells
(Fig. 1E). Moreover, in the caudate putamen, the vast
majority (about 90%) of neurons are GABAergic (Mugnaini
and Oertel, 1985; Graybiel, 1990). As shown in Figure 1G,
many neurons of this brain region including GABAergic
ones are decorated with silver grains. Taken together, the
in situ hybridization data indicate that throughout the
brain a wide variety of both excitatory and inhibitory
neurons express Bassoon.
Spatial distribution of Bassoon
immunoreactivity
The spatial distribution of Bassoon in the brain of
30-day-old rats was studied by immunohistochemistry at
light and electron microscopic levels. Rabbit and mouse
polyclonal antisera and mouse monoclonal antibody mab7f
(tom Dieck et al., 1998) raised against a recombinant
fragment of Bassoon produced virtually identical staining
patterns. Rabbit and mouse preimmune sera did not react
with brain sections, and preincubation of antisera with
recombinant Bassoon antigen resulted in an almost complete elimination of immunostaining (not shown). Bassoon
immunoreactivity is widely distributed in the brain (Fig.
2A). In general, strong staining is found in synaptic
neuropil regions; perikaryal regions are stained to a
significantly lesser extent, and white matter areas are
essentially devoid of immunoreactivity. The highest levels
of Bassoon immunoreactivity are observed in the molecular layer of the cerebellum and in the neuropil regions of
the hippocampus, the olfactory tubercle, and the olfactory
bulb including the accessory olfactory bulb. Marked staining is also found in the caudate putamen, the cerebral
cortex, the thalamic nuclei, inferior colliculus, and superior colliculus (superficial gray layer; Fig. 2A). The globus
pallidus is less intensely stained than the caudate putamen (Fig. 2B). In the cerebral cortex, moderate immunolabeling that outlines dendritic and somatic profiles of
neurons (Fig. 2C) is found in all cortical layers. In semithin
sections, a punctate distribution of the immunoreactivity
on neuronal surfaces becomes apparent (Fig. 2D), suggesting a synaptic localization of Bassoon. In the piriform
cortex, intense labeling is seen in layer Ia, whereas layers
Ib, II, and III are labeled to a lesser extent; the adjacent
lateral olfactory tract is not labeled (Fig. 2E). In the main
olfactory bulb, high levels of immunoreactivity are observed in the glomeruli and in the external plexiform layer,
Fig. 2. Spatial distribution of Bassoon immunoreactivity in rat
brain. A: Low magnification photograph of a sagittal section of a
30-day-old rat brain (corresponding to Fig. 81 in the rat stereotaxic
atlas by Paxinos and Watson, 1986). High levels of Bassoon immunoreactivity were detected throughout neuropil regions of the whole brain,
with highest levels in the hippocampus, the cerebellar cortex, and the
olfactory bulb. The irregular light and dark areas of staining in the
cerebral cortex are not reproducibly seen on all sections examined.
B: Labeling of the caudate putamen (CPu) and globus pallidus (GP);
fibers of the internal capsule (ic) are free of reaction product.
C: Immunoreactivity in layers I–VI of the cerebral cortex. D: Higher
magnification of layer V (semithin section). Note the punctate staining
that leaves blank neuronal perikarya (p) and dendrites (d). E: Intense
immunostaining of layer Ia and less intense staining of layers Ib–II
are observed in the piriform cortex. The lateral olfactory tract (lot) is
not stained. F: Main olfactory bulb. The glomeruli (gl) and the external
plexiform layer (epl) show strong immunoreactivity, whereas the
ganglion cell layer (gcl) shows only moderate staining. AOB, accessory
olfactory bulb; Cb, cerebellum; Cx, cerebral cortex; CPu, caudate
putamen; SC, superior colliculus; IC, inferior colliculus; Hip, hippocampus; OB, olfactory bulb; Th, thalamic nuclei; Tu, olfactory tubercle.
Scale bars ⫽ 2 mm in A, 200 µm in C, 100 µm in B,E,F, 20 µm in D.
442
whereas the ganglion cell layer is only moderately stained
(Fig. 2F).
Cell-type distribution and ultrastructural
localization of Bassoon in hippocampus
and cerebellar cortex
A detailed analysis of the cell-type distribution and
subcellular localization of Bassoon was performed in the
hippocampus and the cerebellar cortex because of their
well-known circuitry, the relatively small number of constituent neuron types, and the segregation of different
classes of synaptic boutons into easily distinguishable
cellular layers within these brain structures.
Hippocampus. In the neuropil regions of the hippocampus, a very distinct laminated staining pattern that essentially reflects the innervation and intrinsic synaptic circuitry of this brain region (Brown and Zador, 1990; Amaral
and Witter, 1995) is observed with Bassoon antisera (Fig.
3A). Both the stratum oriens and stratum radiatum of the
CA1 and CA3 regions are strongly immunoreactive. The
stratum lacunosum moleculare of CA1 shows significantly
less staining. Prominent labeling also occurs in the stratum lucidum of CA3 (see also Fig. 3C) and in the hilus
region (polymorphic cell layer). The molecular layer of the
dentate gyrus is characterized by a bipartite staining
pattern, with moderate Bassoon immunoreactivity in its
outer two-thirds and strong reactivity in the proximal
one-third (Fig. 3A). Perikarya of CA1–3 pyramidal cells
and granule cell bodies of the dentate gyrus appear almost
unstained (Fig. 3A,C). Hippocampal sections processed in
parallel with anti-synaptophysin antibody show a staining
pattern that is very similar to that of Bassoon (Fig. 3B).
An analysis of semithin sections through the CA3 region
showed a clearly punctate, most likely synaptic, distribution of Bassoon immunoreactivity in the neuropil, e.g., the
stratum lucidum and stratum radiatum (Fig. 3C). In the
stratum lucidum, punctae are larger and more intensely
stained than those in the stratum radiatum (Fig. 3C). In
various neuropil regions of the hippocampus, synaptic
junctions were analyzed by electron microscopy (Fig. 3D–
J). The examination showed a strictly presynaptic localization of Bassoon immunoreactivity. Moreover, immunoreactivity appeared to be most prominent at sites of the
presynaptic membrane facing PSDs, as indicated by a
strong concentration of peroxidase reaction product at
these sites. This is clearly visible in the large mossy fiber
terminals in the stratum lucidum of the CA3 region, which
are tightly packed with synaptic vesicles (SVs) and form
contacts with several postsynaptic compartments (tom
Dieck et al., 1998; see Fig. 3D for another example). Via
mossy fiber boutons, CA3 pyramidal neurons receive excitatory input from dentate granule cells (Brown and Zador,
1990; Amaral and Witter, 1995). In the molecular layer of
the dentate gyrus, the polymorphic cell layer of the hippocampal hilus, the stratum radiatum of the CA1 area, and
the stratum lucidum of the CA3 region, Bassoon is present
at both shaft and spine synapses (Fig. 3E–J). Most of these
synapses are asymmetric and thus may be excitatory
(Peters et al., 1991; Ziff, 1997).
In addition Bassoon-containing terminals of symmetric
synapses are found in the hippocampus. Figure 3E shows
an example of a dendrite that is contacted by two synaptic
terminals, one of which is clearly asymmetric and the
K. RICHTER ET AL.
other possibly symmetric. Also, Figure 3G shows Bassoon
immunoreactivity in the axon terminal of a presumably
symmetric synapse of the molecular layer of the dentate
gyrus. Although the symmetric synapses of the transmitter type is unknown in these examples, Figure 3 shows a
Bassoon-positive GABAergic nerve terminal of a basket
cell making contact with a granule cell body (Kosaka et al.,
1984).
Cerebellum. At low magnification in the light microscope, the molecular layer of the cerebellum shows an
intense uniform immunostaining with Bassoon antibodies,
whereas staining in the granule cell layer is patchy.
Purkinje cell bodies and white matter are devoid of immunoreactivity (Fig. 4A). In semithin sections, in the stratum
moleculare (Fig. 4B), a punctate staining pattern outlining
Purkinje cell somata and primary dendrites is visible. In
the adjacent granular layer, punctate staining is confined
to distinct patches, most likely glomeruli (Fig. 4B). An
ultrastructural analysis of the cerebellar cortex confirmed
the observations made in the hippocampus (Fig. 4C–G).
Both excitatory and inhibitory GABAergic synaptic terminals are found to contain Bassoon. Prominent examples of
excitatory synapses are the mossy fiber terminals in
glomeruli of the granule cell layer (Fig. 4C), which originate from various spinocerbellar projections (Somogyi et
al., 1986; Garthwaite and Brodbelt, 1990; Llinás and
Walton, 1990; Voogd, 1995). As in hippocampal mossy fiber
boutons, Bassoon immunoreactivity is virtually restricted
to regions near synaptic contact sites (Fig. 4C). The
molecular layer receives predominantly excitatory input
Fig. 3. Localization of Bassoon immunoreactivity in the hippocampus. A: Overview of the hippocampus in a sagittal brain section from a
30-day-old rat immunostained with Bassoon. The neuropil regions
stratum oriens (so) and stratum radiatum (sr) and the hilar region (hi)
are intensely stained, the stratum lacunosum-moleculare (slm) shows
moderate staining, and cell bodies in the pyramidal cell layer of the
CA1–3 regions and of the granule cell layer in the dentate gyrus (DG)
are essentially devoid of reaction product. The molecular layer (ml) of
the DG shows moderate staining in its outer layers and intense
staining in the inner part. B: Synaptophysin immunoreactivity in a
sagittal section treated in parallel to the section shown in A. The
overall distribution pattern of this synaptic vesicle protein in the
hippocampus resembles that of Bassoon. C: Semithin section from the
Bassoon-immunostained CA3 region. Note the marked punctate staining in the stratum lucidum (sl) versus the fine punctate staining in the
stratum radiatum (sr). Pyramidal cells (Py) are unstained. D–I: Electron
micrographs of synapses from the sl of the CA3 region (D), the hilus
region (polymorphic cell layer, E), the ml (inner part, F,G; outer part,
I), and the granule cell layer (J) of the DG. Arrowheads mark
postsynaptic densities (PSDs) and asterisks postsynaptic sides of
symmetric synapses. D: Mossy fiber bouton (mf) densely filled with
vesicles contacts spiny dendritic processes of CA3 pyramidal cells. The
peroxidase reaction product is restricted to the presynaptic element
and is highly concentrated at regions apposing PSDs. E: Profile of a
dendrite (d) that receives en passant contact from two Bassoonimmunopositive terminals; the synaptic junctions are different with
respect to the thickness of postsynaptic densities. F: Shaft synapse
with apparently separate junctional zones. In the presynaptic element, Bassoon immunoreactivity appears most intense at sites facing
PSDs. G: Symmetric junction between a dendritic shaft and a Bassoonimmunopositive presynaptic element filled with pleomorphic vesicles.
H: Immunopositive terminal making contact with a dendritic shaft.
Immunoreactivity gradually increases toward the plasma membrane
facing the PSD. I: Asymmetric synaptic junctions between an immunopositive presynaptic element and a dendritic spine. J: Symmetric
synaptic contact between a basket cell axon and a granule cell
perikaryon (Grp). Scale bars ⫽ 500 µm in A,B, 50 µm in C, 0.6 µm in D,
0.3 µm in E–G,I,J, 0.2 µm in H.
BASSOON IN EXCITATORY AND INHIBITORY NERVE TERMINALS
Figure 3
443
444
K. RICHTER ET AL.
Figure 4
BASSOON IN EXCITATORY AND INHIBITORY NERVE TERMINALS
from cerebellar granule cells via parallel fibers and from
the inferior olive via climbing fibers (Palay and ChanPalay, 1974; Somogyi et al., 1986; Llinás and Walton,
1990). Both climbing and parallel fiber terminals forming
asymmetric type 1 synapses with Purkinje cell dendrites
and interneurons are immunolabeled with Bassoon antibodies (Fig. 4D,E).
In addition, axosomatic terminals on Purkinje cells that
derive from basket cells (Fig. 4G) and Golgi cell terminals
contacting granule cell dendrites in glomeruli (Fig. 4F) are
found to contain Bassoon immunoreactivity. Both synapses use GABA as a neurotransmitter (Ottersen and
Storm-Mathisen, 1984; Ottersen et al., 1987). Thus, also in
the cerebellum Bassoon appears to be present in excitatory
and inhibitory GABAergic synapses.
Colocalization of Bassoon with marker
proteins of glutamatergic and
GABAergic synapses
The immunoelectron microscopy data indicate the presence of Bassoon in identifiable axon terminals thought to
release either excitatory amino acids or GABA. Doublelabeling immunocytochemical studies with antibodies
against Bassoon and marker proteins of glutamatergic or
GABAergic postsynapses were performed on primary cultures of hippocampal neurons to further assess the association of Bassoon with excitatory and inhibitory synapses,
respectively. In neurons cultured for 23 days in vitro, many
but clearly not all Bassoon-immunopositive puncta along
dendritic profiles were found to colocalize with those
immunoreactive for GluR1 subunits of ␣-amino-3-hydroxy5-methyl-4-isoxazole-propionate (AMPA) receptors, suggesting that Bassoon is present at glutamatergic synapses
(Fig. 5A,B). Analogous double-labeling experiments with
anti-Bassoon and GABAA receptor ␤-subunit antibodies
showed that some of the Bassoon-immunopositive puncta
are also positive for GABAA receptors (Fig. 5C,D). In
essence, this set of data also supports the view that
Fig. 4. Localization of Bassoon immunoreactivity in the rat cerebellar cortex. A: Photomicrograph of a sagittal section through the
cerebellum showing an overview of staining in the cerebellar layers.
The molecular layer (mol) is strongly stained. Significantly less
staining is seen in the granule cell layer (gr). Purkinje cell layer (Pc)
and white matter (wm) appear unstained. B: Semithin section of the
cerebellar cortex showing clear punctate staining in the molecular
layer (mol) and a patchy distribution of punctae in the granule cell
layer (gr), probably representing glomeruli (arrows). Purkinje cell
dendrites and perikarya (Pu) are unlabeled. C–G: Electron micrographs of various cerebellar synaptic junctions (arrowheads mark
postsynaptic densities and asterisks mark the postsynaptic elements
of symmetric synapses). C: Localization of immunoreactivity in a
mossy fiber terminal (mf) of the granule cell layer. Apposing dendritic
profiles of granule cells (d) are free of reaction product. The inset
shows the concentration of immunoreactivity at the synaptic junction.
D: Immunopositive axon terminals or varicosities contacting dendritic
spines in the molecular layer. E: Immunoreactivity in a parallel fiber
terminal making synaptic contact with the perikaryon (p), probably of
a stellate cell. F: Immunoreactivity in a Golgi cell terminal that
contacts a dendrite (d) of a granule cell. Note the gradient of increasing
amounts of reaction product toward the synaptic cleft. G: Axon,
probably of a basket cell (Bax), contacting a Purkinje cell perikaryon
(Pu) at two symmetric junctions. Vesicles and immunopositive material colocalize at this presumably GABAergic junction. Grp, granule
cell perikaryon. Scale bars ⫽ 200 µm in A, 25 µm in B, 0.7 µm in C, 0.3
µm in D,G, 0.2 µm in E,F, inset in C.
445
Bassoon occurs at the majority of glutamatergic and
GABAergic synapses.
DISCUSSION
Bassoon has been identified recently as a novel protein
tightly associated with the cytomatrix at the active zone of
presynaptic nerve terminals (tom Dieck et al., 1998). The
aims of the present study were to examine the overall
distribution of Bassoon and its transcripts in the adult rat
brain, to identify types of synapses containing the protein,
and to determine the ultrastructural localization of Bassoon within these synapses.
Bassoon transcripts are widely expressed in the brain;
regions of highest intensity of expression coincide with
regions of highest cell density, e.g., the hippocampus,
cerebellar cortex, cerebral cortex, or olfactory bulb (Fig. 1;
see also tom Dieck et al., 1998). This distribution resembles that of transcripts of the integral synaptic vesicle
protein synaptophysin (Marquèze-Pouey et al., 1991) and
the vesicle-associated protein synapsin I (Melloni et al.,
1993). Synapsin I isoforms occur in the vast majority of
presynaptic terminals of the brain regardless of the transmitter type (De Camilli et al., 1983a; Südhof et al., 1989),
and synaptophysin has been estimated to be present in
more than 90% of clear synaptic vesicles from rat brain
(Wiedenmann and Franke, 1985; Floor and Feist, 1989).
The widespread distribution of Bassoon transcripts is
consistent with a general transmitter type-independent
synaptic distribution of the Bassoon protein. Analysis of in
situ hybridization data at a cellular level supports this
view. In addition to the intense labeling of excitatory
neurons, e.g., granule cells in the cerebellum and the
dentate gyrus or pyramidal neurons in the hippocampus
and cerebral cortex, clear hybridization signals are found
over identifiable inhibitory neurons, including Purkinje
cells and basket cells in the cerebellar cortex and principal
GABAergic neurons in caudate putamen (Mugnaini and
Oertel, 1985; Graybiel, 1990).
Immunohistochemical experiments with Bassoon antibodies showed a general labeling of synaptic neuropil
regions. Most intense staining is observed in regions with
high density of synaptic contacts, e.g., the molecular layer
of the cerebellum, the various strata of the hippocampus,
or plexiform layers of main and accessory olfactory bulbs.
The Bassoon staining pattern is very similar to that
obtained with synaptophysin antibodies in parallel sections. A virtually complete overlap of the distribution of
Bassoon and synaptophysin was also shown in primary
hippocampal neurons after 21 days in culture (tom Dieck
et al., 1998). Also, these observations on the protein
distribution are in agreement with a largely general
synaptic occurrence of Bassoon.
By immunoelectron microscopy, individual synaptic contacts were analyzed for the presence of Bassoon in their
presynaptic compartment. In the two brain regions analyzed at the ultrastructural level, i.e., the hippocampus
and the cerebellum, nerve terminals of asymmetric type 1
and symmetric type 2 synapses are found to contain
Bassoon. Some of the identified Bassoon-positive synapses
have been characterized previously with respect to their
neurotransmitter type. They include excitatory synapses,
e.g., mossy fiber terminals in the hippocampus and the
cerebellum or parallel, climbing fiber synapses in the
cerebellar molecular layer, and inhibitory synapses, e.g.,
446
K. RICHTER ET AL.
Fig. 5. Bassoon codistributes with both GABAA and glutamate
receptors (GluR). Double images of primary hippocampal neurons
after 23 days in culture fluorescently labeled with antibodies against
Bassoon (A) and the GluR1 receptor (B) and against Bassoon (C) and
the GABAA receptor ␤ subunit (D). Arrows in A and B mark examples
of colocalization; arrowheads mark examples of Bassoon immunoreactivity that does not colocalize with GluR1. Insets in C and D are
close-ups of a region particularly rich in GABAergic synapses. Scale
bars ⫽ 10 µm.
axosomatic synapses of GABAergic basket cells onto Purkinje cells, GABAergic axodendritic synapses between
Golgi cells and granule cells in the cerebellum, and GABAergic basket cell synapses onto granule cells of the dentate
gyrus. The occurrence of Bassoon in excitatory and inhibitory synapses is further confirmed in cultured hippocampal neurons by the colocalization with AMPA receptors and
GABAA receptors, respectively. Moreover, in the rat retina,
excitatory ribbon synapses and GABAergic conventional
synapses contain Bassoon (J.H. Brandstätter, E.L. Fletcher,
C.C. Garner, E.D. Gundelfinger, and H. Wässle, personal
communication). Taken together, these data are consistent
with the in situ hybridization data and demonstrate that
Bassoon is a presynaptic protein found in a wide variety of
excitatory and inhibitory synapses throughout the central
nervous system. It is worth noting that high levels of
Bassoon transcripts are present in dopaminergic cells of
the substantia nigra (Richter et al., unpublished observation), suggesting that dopamine release sites also contain
Bassoon.
Within presynaptic terminals of excitatory synapses of
the hippocampal CA3 region, Bassoon has a very restricted
distribution, i.e., immunoreactivity is highly concentrated
in the vicinity of the active zone (tom Dieck et al., 1998).
We have shown that this very specific localization is also
found in many synapses of other brain regions and is
independent of the transmitter type of a synapse. Particular examples are the large mossy fiber terminals in the
cerebellar cortex that, like the mossy fiber boutons in the
stratum lucidum of the hippocampal CA3 region, are large
fusiform structures making multiple synaptic contacts
with postsynaptic neurons. They are filled with excitatory
BASSOON IN EXCITATORY AND INHIBITORY NERVE TERMINALS
amino acids containing synaptic vesicles (Llinás and Walton, 1990; Amaral and Witter, 1995). Bassoon immunoreactivity appears to be highly concentrated at presynaptic
regions facing PSDs. A clear gradient of immunoreactivity
with most intense labeling at the neurotransmitter release
site is also seen in GABAergic synaptic terminals, e.g., of
cerebellar Golgi cells on granule cell dendrites. Frequently,
smaller synaptic terminals of both symmetric and asymmetric synapses are filled with the product of peroxidase
reaction; this may, however, be due to diffusion of the
reaction product rather than to a generally different
distribution of Bassoon in these synapses.
The highly specific localization of Bassoon within presynaptic nerve terminals is clearly different from that of other
integral and associated synaptic vesicle proteins, such as
synaptophysin (Wiedenmann and Franke, 1985; Kagotani
et al., 1991) or synapsin (De Camilli et al., 1983b; Pieribone et al., 1995; tom Dieck et al., 1998), but resembles
that of Piccolo and Rim, two recently described presynaptic proteins (Cases-Langhoff et al., 1996; Wang et al.,
1997). All three proteins copurify with marker proteins of
the PSD, although they are clearly of presynaptic origin
(Cases-Langhoff et al., 1996; Wang et al., 1997; tom Dieck
et al., 1998). Rim is a ⬃180-kDa zinc-finger protein
thought to be involved in Rab3-dependent regulation of
neurotransmitter release (Wang et al., 1997), whereas the
functions of Piccolo and Bassoon are unknown.
In conclusion, our data show that the distribution of
Bassoon is not restricted to synapses of a single transmitter type but is found in most synapses throughout the
brain. Therefore, its role may be a general one in the
assembly and organization of presynaptic structures. Interestingly, during development Bassoon, like other presynaptic marker proteins such as synapsin or synaptophysin
(Fletcher et al., 1991), appears in axons and growth cones
before synaptogenesis (G. Olias and C.C. Garner, unpublished observation) and therefore could well be involved in
early processes of synapse formation. Based on its biochemical properties, the multidomain structure, and its exquisite distribution within nerve terminals (tom Dieck et al.,
1998; present study), we assume that Bassoon is a scaffold
protein of the presynaptic cytomatrix that serves to organize the presynaptic active zone, perhaps by clustering the
machinery necessary for the release of neurotransmitter
and the recycling of synaptic vesicles.
ACKNOWLEDGMENTS
We are grateful to members of the technical staff of the
Departments of Neurochemistry/Molecular Biology and
Auditory Plasticity and Speech of the IfN for expert
technical assistance and to Constanze Seidenbecher for
critically reading the manuscript. This study was supported by grants from the Deutsche Forschungsgemeinschaft (SFB 425/A1, KR 1879/1-1) and the Fonds der
Chemischen Industrie to E.D.G. and M.R.K. and by grants
from the National Institutes of Health (P50 HD32901, AG
12978-02, AG 06569-09) and the Keck Foundation (931360)
to C.C.G.
LITERATURE CITED
Amaral DG, Witter MP. 1995. Hippocampal formation. In: Paxinos G,
editor. The rat nervous system. London: Academic Press. p 443–494.
Betz WJ, Angleson JK. 1998. The synaptic vesicle cycle. Annu Rev Physiol
60:347–363.
447
Brodin L, Löw P, Gad H, Gustafsson J, Pieribone VA, Shupliakov O. 1997.
Sustained neurotransmitter release: new molecular clues. Eur J Neurosci 9:2503–2511.
Brown TH, Zador AM. 1990. Hippocampus. In: Shepherd GM, editor. The
synaptic organization of the brain. New York: Oxford University Press
Inc. p 346–388.
Burns ME, Augustine GJ. 1995. Synaptic structure and function: dynamic
organization yields architectural precision. Cell 83:187–194.
Cases-Langhoff C, Voss B, Garner AM, Appeltauer U, Takei K, Kindler S,
Veh RW, De Camilli P, Gundelfinger ED, Garner CC. 1996. Piccolo, a
novel 420 kDa protein associated with the presynaptic cytomatrix. Eur
J Cell Biol 69:214–223.
De Camilli P, Takei K. 1996. Molecular mechanisms in synaptic vesicle
endocytosis and recycling. Neuron 16:481–486.
De Camilli P, Cameron R, Greengard P. 1983a. Synapsin I (protein I), a
nerve terminal specific phosphoprotein. I. Its general distribution in
synapses of the central and peripheral nervous system demonstrated by
immunofluorescence in frozen and plastic sections. J Cell Biol 96:1337–
1354.
De Camilli P, Harris SM, Huttner WB, Greengard P. 1983b. Synapsin I
(protein I), a nerve terminal-specific phosphoprotein. II. Its specific
association with synaptic vesicles demonstrated by immunocytochemistry in agarose-embeddeed synaptosomes. J Cell Biol 96:1355–1373.
Fletcher TL, Cameron P, De Camilli P, Banker G. 1991. The distribution of
synapsin I and synaptophysin in hippocampal neurons developing in
culture. J Neurosci 11:1617–1626.
Floor E, Feist BE. 1989. Most synaptic vesicles isolated from rat brain carry
three membrane proteins, SV2, synaptophysin, and p65. J Neurochem
52:1433–1437.
Garthwaite J, Brodbelt AR. 1990. Glutamate as the principal mossy fibre
transmitter in rat cerebellum: pharmacological evidence. Eur J Neurosci 2:177–180.
Geppert M, Südhof TC. 1998. RAB3 and synaptotagmin: the yin and yang of
synaptic membrane fusion. In: Cowan WM, Shooter EM, Stevens CF,
Thompson RF, editors. Annual reviews in neuroscience. Volume 21. Palo
Alto: Annual Reviews Inc. p 75–95.
Goslin K, Banker G. 1991. Rat hippocampal neurons in low-density culture.
In: Banker G, Goslin K, editors. Culturing nerve cells. Cambridge (MA):
MIT Press. p 251–281.
Gray EG. 1959. Axo-somatic and axo-dendritic synapses of the cerebral
cortex: an electron microscope study. J Anat 93:420–433.
Graybiel AM. 1990. Neurotransmitters and neuromodulators in the basal
ganglia. Trends Neurosci 13:244–245.
Hirokawa N, Sobue K, Kanda K, Harada A, Yorifuji H. 1989. The cytoskeletal architecture of the presynaptic terminal and molecular structure of
synapsin 1. J Cell Biol 108:111–126.
Kagotani Y, Picart R, Barret A, Wiedenmann B, Huttner WB, Tixier-Vidal
A. 1991. Subcellular localization of secretogranin II and synaptophysin
by immunoelectron microscopy in differentiated hypothalamic neurons
in culture. J Histochem Cytochem 39:1507–1518.
Kosaka T, Hama K, Wu J-Y. 1984. GABAergic synaptic boutons in the
granule cell layer of rat dentate gyrus. Brain Res 293:353–359.
Landis DMD, Reese TS. 1974. Differences in membrane stucture between
excitatory and inhibitory synapses in the cerebellar cortex. J Comp
Neurol 155:93–126.
Landis DMD, Hall AK, Weinstein LA, Reese TS. 1988. The organization of
cytoplasm at the presynaptic active zone of a central nervous system
synapse. Neuron 1:201–209.
Langnaese K, Seidenbecher C, Wex H, Seidel B, Hartung K, Appeltauer U,
Garner A, Voss B, Mueller B, Garner CC, Gundelfinger ED. 1996.
Protein components of a rat brain synaptic junctional protein preparation. Mol Brain Res 42:118–122.
Llinás RR, Walton KD. 1990. Cerebellum. In: Shepherd GM, editor. The
synaptic organization of the brain. New York: Oxford University Press.
p 214–245.
Marquèze-Pouey B, Wisden W, Malosio ML, Betz H. 1991. Differential
expression of synaptophysin and synaptoporin mRNAs in the postnatal
rat central nervous system. J Neurosci 11:3388–3397.
Melloni JRH, Hemmendinger LM, Hamos JE, DeGennaro LJ. 1993.
Synapsin I gene expression in the adult rat brain with comparative
analysis of mRNA and protein in the hippocampus. J Comp Neurol
327:507–520.
Mugnaini E, Oertel WH. 1985. An atlas of the distribution of GABAergic
neurons and terminals in the rat CNS as revealed by GAD immunohistochemistry. In: Björklund A, Hökfelt T, editors. Handbook of chemical
448
neuroanatomy. Volume 4, GABA and neuropeptides in the CNS, part I.
Amsterdam: Elsevier Science Publishers BV. p 436–575.
Ottersen OP, Storm-Mathisen J. 1984. Glutamate- and GABA-containing
neurons in the mouse and rat brain, as demonstrated with a new
immunocytochemical technique. J Comp Neurol 229:374–392.
Ottersen OP, Davanger S, Storm-Mathisen J. 1987. Glycine-like immunoreactivity in the cerebellum of rat and Senegalese baboon, Papio papio: a
comparison with the distribution of GABA-like immunoreactivity and
with 3H glycine and 3H GABA uptake. Exp Brain Res 66:211–221.
Palay SL, Chan-Palay V. 1974. Cerebellar cortex. Berlin: Springer-Verlag.
Paxinos G, Watson C. 1986. The rat brain in stereotaxic coordinates. San
Diego: Academic Press.
Peters A, Palay SL, Webster H. 1991. The fine structure of the nervous
system. Neurons and their supporting cells, 3rd ed. Oxford: Oxford
University Press. p 138–211.
Pieribone VA, Shupliakov O, Brodin L, Hilfiker-Rothenfluh S, Czernik AJ,
Greengard P. 1995. Distinct pools of synaptic vesicles in neurotransmitter release. Nature 375:493–497.
Richter K, Hamprecht B, Scheich H. 1996. Ultrastructural localization of
glycogen phosphorylase predominantly in astrocytes of the gerbil brain.
Glia 17:263–273.
Seidenbecher CI, Gundelfinger ED, Böckers TM, Trotter J, Kreutz MR.
1998. Transcripts for secreted and GPI-anchored brevican are differentially distributed in rat brain. Eur J Neurosci 10:1621–1630.
Shepherd GM, Greer CA. 1990. Olfactory bulb. In: Shepherd GM, editor.
The synaptic organization of the brain. New York: Oxford University
Press. p 133–169.
K. RICHTER ET AL.
Somogyi P, Halasy K, Somogyi J, Storm-Mathisen J, Ottersen OP. 1986.
Quantification of immunogold labelling reveals enrichment of glutamate in mossy and parallel fibre terminals in cat cerebellum. Neuroscience 19:1045–1050.
Südhof TC. 1995. The synaptic vesicle cycle: a cascade of protein–protein
interactions. Nature 375:645–653.
Südhof TC, Czernik AJ, Kao HT, Takei K, Johnston PA, Horiuchi A, Kanazir
SD, Wagner MA, Perin MS, DeCamilli P, Greengard P. 1989. Synapsins:
mosaics of shared and individual domains in a family of synaptic vesicle
phosphoproteins. Science 245:1474–1480.
tom Dieck S, Sanmartı́-Vila L, Langnaese K, Richter K, Kindler S, Soyke A,
Wex H, Smalla K-H, Kämpf U, Fränzer J-T, Stumm M, Garner CC,
Gundelfinger ED. 1998. Bassoon, a novel zinc-finger CAG/glutaminerepeat protein selectively localized at the active zone of presynaptic
nerve terminals. J Cell Biol 142:499–509.
Voogd J. 1995. Cerebellum. In: Paxinos G, editor. The rat nervous system.
San Diego: Academic Press. p 309–350.
Wang Y, Okamoto M, Schmitz F, Hofmann K, Südhof TC. 1997. Rim is a
putative Rab3 effector in regulating synaptic-vesicle fusion. Nature
388:593–598.
Wiedenmann B, Franke WW. 1985. Identification and localization of
synaptophysin, an integral membrane glycoprotein of Mr 38.000 characteristic of presynaptic vesicles. Cell 41:1017–1028.
Ye ZC, Sontheimer H. 1998. Astrocytes protect neurons from neurotoxic
injury by serum glutamate. Glia 22:237–248.
Ziff EB. 1997. Enlightening the postsynaptic density. Neuron 19:1163–
1174.
Документ
Категория
Без категории
Просмотров
3
Размер файла
1 279 Кб
Теги
757
1/--страниц
Пожаловаться на содержимое документа