close

Вход

Забыли?

вход по аккаунту

?

937

код для вставкиСкачать
??????? ?? ?????????, ???. 182: 174?179 (1997)
EXPRESSION OF PARATHYROID HORMONE-RELATED
PEPTIDE (PTHrP) IN GASTRIC TUMOURS
????? ????????? ??????1, ???????? ???1, ???????? ?????????1, ???? ?????1, ????????? ????????1,
????? ???????2, ???????? ?????????2 ??? ?????? ??????1*
1
Department of Pathology, Atomic Disease Institute, Nagasaki University School of Medicine, Nagasaki, Japan
Department of Cell Physiology, Atomic Disease Institute, Nagasaki University School of Medicine, Nagasaki, Japan
2
SUMMARY
Parathyroid hormone-related peptide (PTHrP) is produced by various neoplasms. It has been suggested that it acts as a cytokine for
cell proliferation and tumour progression. The purpose of this study was to evaluate PTHrP expression in gastric cancers by
immunohistochemistry. PTHrP was expressed in 71 of 92 (77�per cent) gastric adenocarcinomas without humoral hypercalcaemia. In
contrast, one case (5 per cent) out of 20 adenomas and none of the background non-neoplastic epithelium showed PTHrP
immunoreactivity. In carcinomas, PTHrP immunoreactivity was higher in moderately differentiated adenocarcinomas (21/22; 95�per
cent) and poorly differentiated adenocarcinomas (34/34; 100 per cent) than in well-differentiated adenocarcinomas (10/23; 43 per cent).
Furthermore, PTHrP expression was more intense in the deeply invasive portions than in the mucosal carcinomas. High percentages of
metastatic tumour cells in regional lymph nodes were immunopositive. PTHrP mRNA expression was confirmed by in situ hybridization
in gastric adenocarcinomas. Reverse transcription-polymerase chain reaction (RT-PCR) studies of normal gastric mucosa and four
human gastric cancer cell lines detected PTHrP transcription in NUGC-1 (poorly differentiated) and NUGC-3 (poorly differentiated)
but not in normal gastric mucosa, MKN-1 (well differentiated), and KATO-III (signet ring cell). These findings suggest
that overexpression of PTHrP may be involved in the malignant transformation and progression of gastric carcinomas. ? 1997 by
John Wiley & Sons, Ltd.
J. Pathol. 182: 174?179, 1997.
No. of Figures: 3. No. of Tables: 4.
KEY WORDS?PTHrP;
No. of References: 31.
immunohistochemistry; in situ hybridization; RT-PCR; gastric cancer; tumour progression
INTRODUCTION
Parathyroid hormone-related peptide (PTHrP) was
initially characterized as a main causative factor of
humoral hypercalcaemia of malignancy.1?3 Subsequently, PTHrP has been found in various normal and
neoplastic tissues without hypercalcaemia.4?7 In previous studies, we reported strong expression of PTHrP
in the invasive components of pituitary tumours and
thyroid carcinomas.8,9 Increased levels of PTHrP expression have also been demonstrated in skeletal metastasis
of human breast cancer10 and in advanced stages of
prostatic cancer.11 These findings suggest that PTHrP is
involved in tumour proliferation and progression. Furthermore, PTHrP production has been correlated with
the degree of differentiation of squamous cell tumours.12
Recently, it was demonstrated that abnormal PTHrP
production can occur in gastric adenocarcinoma without
associated hypercalcaemia.13 The aim of this study was
to clarify the role of PTHrP in the pathogenesis of
gastric adenocarcinoma irrespective of hypercalcaemia.
We examined PTHrP expression in relation to histological differentiation and progression of gastric
cancer, using immunohistochemical staining, in situ
*Correspondence to: Ichiro Sekine, MD, Department of Pathology, Atomic Disease Institute, Nagasaki University School of
Medicine, 1-12-4 Sakamoto, Nagasaki 852, Japan.
CCC 0022?3417/97/060174?06 $17.50
? 1997 by John Wiley & Sons, Ltd.
hybridization, and reverse transcription-polymerase
chain reaction (RT-PCR).
MATERIALS AND METHODS
Materials
All tumour specimens were obtained from patients
operated on at Nagasaki University Hospital between
1992 and 1994. Each tumour was assigned a histological
type and a depth grading of infiltration according to the
Japanese Classification of Gastric Carcinoma by the
Japanese Research Society for Gastric Cancer.14 Histologically, of the 92 primary human gastric adenocarcinomas that were examined, there were 23 cases of
well-differentiated adenocarcinoma, 22 cases of moderately differentiated adenocarcinoma, 34 cases of poorly
differentiated adenocarcinoma, and 13 cases of signetring cell carcinoma. None was associated with humoral
hypercalcaemia. Control cases were evaluated using
non-neoplastic or non-metaplastic tissue from benign
gastric ulcers. All specimens were reviewed without
knowledge of the clinical outcome. An average of four
sections per tumour were prepared, and paraffin sections
were routinely stained with haematoxylin and eosin and
periodic acid?Schiff.
To compare the prognostic factors with PTHrP
expression, the following morphological details were
reviewed: regional lymph node involvement, grade of
tumour differentiation, and depth of invasion.
Received 28 August 1996
Revised 18 November 1996
Accepted 18 December 1996
175
PTHrP IN GASTRIC TUMOURS
Immunohistochemistry
RT-PCR
Formalin-fixed and paraffin-embedded tissue was
used for immunohistochemistry of PTHrP in this
study. Paraffin-embedded tissue was cut into 3 靘
sections, deparaffinized in xylene, and rehydrated in
phosphate-buffered saline. Deparaffinized sections were
preincubated with normal goat serum to prevent nonspecific binding and then incubated overnight at 4)C
with an optimal dilution (5 靏/ml) of a primary antibody of PTHrP (monoclonal; Oncogene Science,
Uniondale, NY, U.S.A.).15 PTHrP monoclonal antibody was raised to an intermediate fragment (38?64)
of PTHrP with no homology to or cross-reactivity with
parathyroid hormone. The slides were subsequently
incubated with alkaline phosphatase-conjugated goat
anti-mouse immunoglobulin antibodies and a mixture
of 5-bromo-4-chloro-3-indolyl phosphate and nitroblue
tetrazolium chloride (BCIP/NBT) was used for the
alkaline phosphatase reaction. Negative controls were
prepared by replacing the primary antibody with
non-immunized mouse serum. An immunoabsorption
test was also performed to confirm the specific
immunoreactivity of the antibody. Human PTHrPproducing cells were derived from a human lung
squamous cell carcinoma, as previously reported.16
These cells were also taken as an internal parameter
for maximal reactivity, which was characterized as high
antigenic density and denoted as ?+ +?. Definitely
weaker staining intensity was characterized as low
antigenic density, denoted as ?+?. The absence of a
signal was denoted by ?"?. The grade of positivity of
PTHrP expression was determined by the dominant
antigenic intensity observed in each specimen.
Four kinds of clonal cultured cell line established
from human gastric carcinomas were used for the
RT-PCR analysis: MKN-1 (well differentiated), KATOIII (signet-ring cell carcinoma), NUGC-1 (poorly differentiated), and NUGC-3 (poorly differentiated).18,19
Total RNA was extracted by acid guanidine phenol
methods20 from each of the four cell lines and from two
cases of resected non-neoplastic gastric mucosa. A
PTHrP-producing lung cancer cell line was used as a
positive control. Cellular RNA (1 靏) was incubated at
37)C for 1 h in 50 靗 of reverse transcriptase buffer
containing 20 units of RNAsin (Promega Corp.,
Madison, WI, U.S.A.), 100 pmol of random hexamer
primers (Boehringer Mannheim, Mannheim, Germany),
and 400 units of Moloney murine leukaemic virus
reverse transcriptase (GIBCO/BRL). Reverse transcription was terminated by heating at 95)C for 10 min and
20 per cent of the resulting cDNA was removed for
PCR. PCR samples were incubated with 50 pmol of each
primer and 2�units of Taq DNA polymerase. The
human PTHrP PCR primers were 5* AGACTGGTTCAGCAGTGGAG 3* (sense, exon 5) and 5* ATCGAATTCCAGCGACGTTG 3* (antisense, exon 6). The
human �-actin PCR primers were 5* TCCTCCCTGGAGAAGAGCTA 3* (sense, exon 4) and 5* AGTACTTGCGCTCAGGAGGA 3* (antisense, exon 6). The
PTHrP and �-actin primers are predicted to amplify 510
and 313 bp DNA fragments, respectively.9 Samples were
subjected to 28 cycles of PCR amplification using a
thermocycler. Each cycle included denaturation at 94)C
for 1 min, annealing at 57)C for 1 min, and primer
extension at 72)C for 1�min.
Statistics
In situ hybridization
In situ hybridization for the detection of human
PTHrP mRNA expression was performed using
rPLPm 10 cDNA probes complementary to rat PTHrP
mRNA, which has 87 per cent homology with the
human sequence.17 Plasmid cDNA was labelled using
biotinylated 11 d-UTP and a nick translation kit
(BRL, Gaithersburg, MD, U.S.A.). Six cases of poorly
differentiated adenocarcinoma were studied by in situ
hybridization. In all cases, we were able to obtain
relatively fresh (within 5 months) paraffin sections.
The presence of cytoplasmic RNA was confirmed
by using methyl green pyronin stain solution (Muto
Pure Chemicals, Tokyo, Japan). In situ hybridization was carried out as described previously.9,15
Each slide was duplicated; negative controls were
performed on the duplicate sections with biotinylated Bluescript plasmid DNA without the specific
PTHrP cDNA insert. RNase treatment was carried
out prior to hybridization as another negative control. PTHrP-producing human lung squamous cell
carcinoma served as a positive control. The sizes of
both PTHrP and the negative control probes
were 50?200 bp, as estimated by polyacrylamide gel
electrophoresis.
? 1997 by John Wiley & Sons, Ltd.
Statistical analysis was performed using chi-square
analysis.
RESULTS
The results of PTHrP immunopositivity in gastric
tumours are shown in Table I. Non-neoplastic gastric
mucosa was negative for PTHrP. In cases of adenoma,
only one case was immunopositive for PTHrP (1/20; 5
per cent). Of 92 gastric carcinomas, 71 (77�per cent)
were positive for PTHrP immunoreactivity. The incidence of PTHrP-positive cases was significantly greater
in moderately and poorly differentiated than in welldifferentiated adenocarcinomas (P<0�1). Figure 1
shows representative examples of strong immunopositivity in adenocarcinoma invading the subserosa (Fig. 1C)
and of weak expression in mucosal carcinoma (upper
half of Fig. 1A). The expression of PTHrP was localized
in the cytoplasm of tumour cells. We also evaluated
PTHrP immunoreactivity in gastric carcinomas associated with the depth of tumour invasion. PTHrP immunoreactivity differed significantly according to the degree
of tumour infiltration and to invasion depth related to
tumour differentiation (P<0�1), as shown in Tables II
J. Pathol. 182: 174?179 (1997)
176
G. K. ALIPOV ET AL.
Table I?Immunohistochemical expression of PTHrP in human gastric tumours
Histological type*
n
Normal
Adenoma
Carcinoma
Well
Mod
Poor
Sig
15
20
92
23
22
34
13
"
15
19
21
13
1
0
7
+
(100%)
(95%)
(22�)
(56�)
(4�)
(54%)
0
1 (5%)
12 (13�)
9 (39�)
2 (9�)
1 (3%)
0
++
0
0
59
1
19
33
6
(64�)
(4�)
(86�)
(97�)
(46%)
*Normal: normal mucosa; Well: well-differentiated tubular adenocarcinoma, including papillary adenocarcinoma;
Mod: moderately differentiated tubular adenocarcinoma; Poor: poorly differentiated adenocarcinoma, including solid
and non-solid adenocarcinoma; Sig: signet-ring cell carcinoma.
+ + =same or higher antigenic intensity than positive control; + =lower antigenic intensity than positive control;
" =no signal
.
Fig. 1?Immunohistochemistry for PTHrP in gastric adenocarcinomas. PTHrP immunoreactivity in moderately (lower half of A, C) and poorly
differentiated adenocarcinomas (B) is greater than in well-differentiated adenocarcinomas (upper half of A). Concerning tumour invasion, PTHrP
is strongly expressed in gastric carcinoma cells invading the muscularis propria (B) and subserosa (C) but weakly expressed in mucosal carcinomas
(upper half of A)
and III. Cases with deeper invasion showed stronger
PTHrP expression than early invasive cases (Figs. 1B
and 1C). Also, in almost all cases, the invasive front
and/or the peripheral parts of the primary tumour were
intensely positive compared with the superficial and the
central parts. PTHrP immunoreactivity at the primary
site in cases with regional lymph node metastasis was
significantly higher than in cases without lymph node
metastasis (P<0�, Table IV). Furthermore, metastatic
tumour cells in lymph nodes were strongly immunopositive (30/34, 88�per cent).
In accordance with the antigenic intensity shown by
immunostaining, PTHrP mRNA expression by in situ
? 1997 by John Wiley & Sons, Ltd.
hybridization was positive in the cytoplasm of gastric
adenocarcinomas (Fig. 2). No specific hybridization was
observed in gastric adenocarcinomas with the negative
control probe.
The results of RT-PCR for PTHrP mRNA expression
in normal gastric mucosa and in the human gastric
carcinoma cell lines are shown in Fig. 3. Normal gastric
mucosa and MKN-1 (well) and KATO-III (signet) did
not express PTHrP mRNA. In contrast, NUGC-1
(poor) and NUGC-3 (poor) strongly expressed PTHrP
mRNA. �-Actin mRNA, a control to demonstrate that
equivalent amounts of tissue RNA were used for cDNA
synthesis, was detected in all samples.
J. Pathol. 182: 174?179 (1997)
177
PTHrP IN GASTRIC TUMOURS
Table II?PTHrP expression associated with the depth of gastric carcinoma invasion
Depth
n
"
Mucosa
Submucosa
Muscularis propria
Subserosa
Serosa
25
21
10
32
4
18 (72%)
2 (9�)
0
0
1 (25%)
7
3
1
1
0
Total
92
21 (22�)
12 (13�)
+
++
(28%)
(14�)
(10%)
(3�)
0
16
9
31
3
(76�)
(90%)
(96�)
(75%)
59 (64�)
+ + =same or higher antigenic intensity than positive control; + =lower antigenic intensity than positive control;
" =no signal.
Table III?Positivity of PTHrP expression associated with invasiveness classified by differentiation of
gastric adenocarcinomas
Differentiation
n
m
sm
pm
ss
se
Well
Mod
Poor
Sig
23
22
34
13
7/18 (38�)
0/1
"
0/6
3/5 (60%)
11/11 (100%)
5/5 (100%)
"
"
6/6 (100%)
4/4 (100%)
"
"
3/3 (100%)
23/23 (100%)
6/6 (100%)
"
1/1 (100%)
2/2 (100%)
0/1
Total
92
7/25 (28%)
19/21 (90�)
10/10 (100%)
32/32 (100%)
3/4 (75%)
m: mucosa; sm: submucosa; pm: propria muscle; ss: subserosa; se: serosa; Well: well-differentiated tubular
adenocarcinoma, including papillary adenocarcinoma; Mod: moderately differentiated tubular adenocarcinoma; Poor:
poorly differentiated adenocarcinoma, including solid and non-solid adenocarcinoma; Sig: signet-ring cell carcinoma.
Table IV?PTHrP immunopositivity at the primary site in
relation to lymph node (LN) metastasis
PTHrP immunopositivity
at the primary site
LN metastasis
Present
Absent
32/34 (94�)
39/58 (67�)
DISCUSSION
PTHrP is widely expressed in normal and neoplastic
tissues, and is also involved in the regulation of cell
proliferation and differentiation.21 In gastric cancer, the
expression of PTHrP has been controversial and the
reported frequency of PTHrP immunoreactivity varies
widely among investigators.5,13,22 Several forms of
mature fragments are produced by alternative splicing
with the maturation process. Yamamura-Idei et al.
reported a low incidence of PTHrP immunopositivity
(5/29, 17 per cent) for gastric adenocarcinoma without
hypercalcaemia determined by N-terminal monoclonal
antibody. Abdeen et al. indicated that the immunoreactivity of PTHrP in gastric cancer depends on antibodies
for the N-terminal or C-terminal residue of PTHrP. The
application of monoclonal antibody for the C-terminal
residue demonstrated over 90 per cent positivity in
gastric adenocarcinomas without hypercalcaemia.13 In
? 1997 by John Wiley & Sons, Ltd.
this study, a monoclonal antibody for mid-portion residues (38?64) was used; it is known that the mid-portion
of PTHrP is involved in cell proliferation and calcium
metabolism. Gastric adenocarcinomas showed a significantly higher incidence of PTHrP immunoreactivity
than adenomas, and none of the specimens of normal
gastric mucosa was positive for PTHrP. The absence of
PTHrP expression in normal mucosa was confirmed
by in situ hybridization and RT-PCR at transcriptional
levels. These results suggest that PTHrP is expressed
by human gastric epithelium in association with malignant transformation, irrespective of hypercalcaemia
effects.
In the regulation of PTHrP transcription and translation, many cytokines and oncogenes are involved.
Human gastric tumours express a variety of growth
factors that evidently regulate the growth of cancer cells.
It is believed that EGF and TGF-� produced by gastric
cancers enhance tumour progression and that these
growth factors up-regulate PTHrP gene expression in
some cell lines.23?25 EGF or TGF-� and PTHrP may
also play a co-operative role in the development and/or
progression of gastric carcinomas. Our recent study
demonstrated that antisense inhibition of PTHrP gene
expression reduces tumour progression and metastases
in malignant pituitary tumours.26 In this study, metastatic tumour cells overexpressed PTHrP irrespective of
invasion depth and tumour differentiation in the primary sites. This finding suggests that metastatic clonal
J. Pathol. 182: 174?179 (1997)
178
G. K. ALIPOV ET AL.
Fig. 2?PTHrP mRNA expression in gastric cancer by in situ hybridization. PTHrP is demonstrated in
cytoplasm of gastric carcinoma cells at the transcriptional level
Fig. 3?RT-PCR analysis of PTHrP mRNA expression in gastric
tissues using the specific primers pair predicted to amplify fragment
size as shown on the right (a: PTHrP; b: �-actin as internal control).
Total RNA was prepared from two samples of non-neoplastic gastric
mucosa (lanes 6 and 7), four gastric cancer cell lines (lane 2: KATOIII; 3: NUGC-1; 4: NUGC-3; and 5: MKN-1), and one lung cancer cell
line as a positive control (lane 1). Size marker (lane M) is 鰔 174/HinfI
digest
cells acquire the abnormal expression of PTHrP from an
early stage.
The positivity of PTHrP expression is significantly
higher in moderately or poorly differentiated adenocarcinomas than in well-differentiated adenocarcinomas.
This tendency was also evident in our preliminary experiments on cell lines. NUGC-1 and NUGC-3, which are
? 1997 by John Wiley & Sons, Ltd.
cell lines derived from poorly differentiated adenocarcinomas of the stomach, produced PTHrP and grew
rapidly in vivo after subcutaneous transplantation into
BALB/c nude mice. On the other hand, MKN-1, which
is derived from well-differentiated adenocarcinomas, did
not show PTHrP transcription and grew very slowly
in vivo (data not shown). As in prostatic cancers, the
intensity of PTHrP immunohistochemical staining
appeared to correlate inversely with tumour differentiation.11 Unlike poorly differentiated adenocarcinomas,
the immunopositivity in signet-ring cell carcinomas as a
whole was much lower, but in the cases with deeper
invasion, there were no significant differences between
the two types. In these respects, we speculate that
different molecular events occur in the carcinogenesis
of signet-ring cell carcinomas and of intestinal-type
carcinomas.
Luparello et al. indicated that 8701-BC cells, derived
from PTHrP-producing breast carcinoma, produced
extracellular proteolytic enzymes, and they hypothesized
that PTHrP might intervene in local control of the
invasive process in breast carcinoma.27 Adhesion molecules and matrix metalloproteinase have been demonstrated to affect metastatic potential during the process
of oncogenesis.28,29 Interestingly, PTH is known as a
regulator of cell adhesion and extracellular matrix proteins.30 PTHrP exerts its functions through PTH/PTHrP
common receptors31 in an autocrine/paracrine fashion.
The expression of PTH/PTHrP common receptor in
gastric cancers should be evaluated.
In conclusion, this study suggests that the expression
of PTHrP plays an important role in tumour differentiation and in the progression of gastric cancer. Considering the significantly higher PTHrP detected in cancers
with poor differentiation, deep invasion, and metastasis,
PTHrP could be useful for the identification of gastric
cancer patients with a poor prognosis.
J. Pathol. 182: 174?179 (1997)
PTHrP IN GASTRIC TUMOURS
REFERENCES
1. Suva LJ, Wiaslow GA, Wettenhall RE, et al. A parathyroid hormonerelated protein implicated in malignant hypercalcemia: cloning and expression. Science 1987; 237: 893?896.
2. Martin TJ, Suva LJ. Parathyroid hormone related protein in hypercalcaemia of malignancy. Clin Endocrinol 1989; 31: 631?647.
3. Gillespie MT, Martin TJ. The parathyroid hormone-related protein gene
and its expression. Mol Cell Endocrinol 1994; 100: 143?147.
4. Kramer S, Reynolds FH, Castillo M, et al. Immunological identification
and distribution of parathyroid hormone-like protein polypeptides in normal and malignant tissues. Endocrinology 1991; 128: 1927?1937.
5. Yamamura-Idei Y, Kitazawa S, Kitazawa R, et al. Parathyroid hormonerelated protein in gastric cancers with heterotopic ossification. Cancer 1993;
72: 1849?1852.
6. Ikeda K, Weir EC, Mangin M, et al. Expression of messenger ribonucleic
acid encoding a parathyroid hormone-like peptide in normal human and
animal tissues with abnormal expression in human parathyroid adenomas.
Mol Endocrinol 1988; 2: 1230?1236.
7. Thiede MA, Rodan GA. Expression of a calcium-mobilizing parathyroid
hormone-like peptide in lactating mammary tissue. Science 1988; 242:
278?280.
8. Ito M, Enomoto H, Usa T, et al. Expression of parathyroid hormone
related peptide in human pituitary tumours. J Clin Pathol 1993; 46:
682?683.
9. Nakashima M, Ohtsuru A, Luo WT, et al. Expression of parathyroid
hormone-related peptide in human thyroid tumours. J Pathol 1995; 2:
227?236.
10. Powell GJ, Southby J, Danks JA, et al. Localization of parathyroid
hormone-related protein in breast cancer metastases: increased incidence in
bone compared with other sites. Cancer Res 1991; 51: 3059-3061.
11. Iwamura M, di Sant?Agnese PA, Wu G, et al. Immunohistochemical
localization of parathyroid hormone-related protein in human prostate
cancer. Cancer Res 1993; 53: 1724?1726.
12. Kitazawa S, Fukase M, Kitazawa R, et al. Immunohistologic evaluation of
parathyroid hormone-related protein in human lung cancer and normal
tissue with newly developed monoclonal antibody. Cancer 1991; 67: 984?
989.
13. Abdeen O, Pandol SJ, Burton DW, et al. Parathyroid hormone-related
peptide expression in human gastric adenocarcinomas not associated with
hypercalcemia. Am J Gastroenterol 1995; 90: 1864?1867.
14. Japanese Research Society for Gastric Cancer: Japanese Classification of
Gastric Carcinoma (First England Edition). Edited by Japanese Research
Society for Gastric Cancer. Tokyo: Kanehara Press, 1995.
15. Nakashima M, Ito M, Ohtsuru A, et al. Expression of parathyroid hormone
(PTH)-related peptide (PTHrP) and PTH/PTHrP receptor in giant cell
tumour of tendon sheath. J Pathol 1996; 180: 80?84.
16. Ichinose Y, Iguchi H, Ohta M, et al. Establishment of lung cancer cell line
producing parathyroid hormone-related protein. Cancer Lett 1993; 74:
119?124.
? 1997 by John Wiley & Sons, Ltd.
179
17. Yasuda T, Banville D, Rabbani SA, et al. Rat parathyroid hormone-like
peptide: comparison with the human homologue and expression in malignant and normal tissue. Mol Endorinol 1989; 3: 518?525.
18. Takeshima E, Hamaguchi M, Watanabe T, et al. Aberrant elevation of
tyrosine-specific phosphorylation in human gastric cancer cells. Jpn J
Cancer Res 1991; 82: 1428?1435.
19. Koshikawa N, Yasumitsu H, Umeda M, et al. Multiple secretion of matrix
serine proteinases by human gastric carcinoma cell lines. Cancer Res 1992;
52: 5046?5053.
20. Chomczynski P, Sacchi N. Single step method of RNA isolation by acid
guanidium thiocyanate?phenol-chloroform extraction. Anal Biochem 1987;
162: 156?159.
21. Burton PB, Knight DE. Parathyroid hormone-related peptide can regulate
the growth of human lung cancer cells, and may form part of an autocrine
TGF-alpha loop. FEBS Lett 1992; 305: 228?232.
22. Roskams T, Willems M, Campos RV, et al. Parathyroid hormone-related
peptide expression in primary and metastatic liver tumours. Histopathology
1993; 23: 519?525.
23. Hongo T, Kupfer J, Enomoto H, et al. Abundant expression of parathyroid
hormone-related protein in primary rat aortic smooth muscle cells accompanies serum-induced proliferation. J Clin Invest 1991; 88: 1841?1847.
24. Rodan SB, Wesolowski G, Ianacone J, et al. Production of parathyroid
hormone-like peptide in a human osteosarcoma cell line: stimulation by
phorbol esters and epidermal growth factor. J Endocrinol 1989; 122:
219?227.
25. Kiriyama T, Gillespie MT, Glatz JA, et al. Transforming growth factor �
stimulation of parathyroid hormone related-peptide (PTHrP): a paracrine
regulator? Mol Cell Endocrinol 1993; 92: 55?62.
26. Akino K, Ohtsuru A, Yano H, et al. Antisense inhibition of parathyroid
hormone-related peptide gene expression reduces malignant pituitary
tumour progression and metastases in the rat. Cancer Res 1996; 56: 77?86.
27. Luparello C, Burtis WJ, Raue F, et al. Parathyroid hormone-related peptide
and 8701-BC breast cancer cell growth and invasion in vitro: evidence for
growth-inhibiting and invasion-promoting effects. Mol Cell Endocrinol
1995; 111: 225?232.
28. Gunther U, Hofmann M, Rudy W, et al. A new variant of glycoprotein
CD44 confers metastatic potential to rat carcinoma cells. Cell 1991; 65:
13?24.
29. Kato Y, Nakayama Y, Uneda M, et al. Induction of 103-kDa gelatinase/
type IV collagenase by acidic culture conditions in mouse metastatic
melanoma cell lines. J Biol Chem 1992; 267: 11424?11430.
30. Babich M, Foti LR. E-cadherins identified in osteoblastic cells: effects of
parathyroid hormone and extracellular calcium on localization. Life Sci
1994; 54: 201?208.
31. Rabbani SA, Gladu J, Liu B, et al. Regulation in vivo of the growth of
Leydig cell tumours by antisense ribonucleic acid for parathyroid hormonerelated peptide. Endocrinology 1995; 136: 5416?5422.
J. Pathol. 182: 174?179 (1997)
Документ
Категория
Без категории
Просмотров
3
Размер файла
1 563 Кб
Теги
937
1/--страниц
Пожаловаться на содержимое документа