close

Вход

Забыли?

вход по аккаунту

?

394

код для вставкиСкачать
Int. J. Cancer (Pred. Oncol.): 74, 540–544 (1997)
r 1997 Wiley-Liss, Inc.
Publication of the International Union Against Cancer
Publication de l’Union Internationale Contre le Cancer
DETECTION OF DISSEMINATED TUMOR CELLS IN PERIPHERAL BLOOD OF
COLORECTAL CANCER PATIENTS
Marc G. DENIS1*, Cecile LIPART2, Joël LEBORGNE3, Paul-Antoine LEHUR3, Jean-Paul GALMICHE4, Michele DENIS1,
Erik RUUD5, Alain TRUCHAUD2 and Patrick LUSTENBERGER1
1Laboratoire de Biochimie Spécialisée, Institut de Biologie, Nantes, France
2Laboratoire de Technologie Biomédicale, Institut de Biologie, Nantes, France
3Clinique Chirurgicale II, Hôtel-Dieu, Nantes, France
4Service de Gastroentérologie, Hôtel-Dieu, Nantes, France
5Dynal A.S., Oslo, Norway
All cancer staging systems seek to identify clinical and
pathological features that can predict outcome or guide
therapy. In particular, a non-invasive method for the early
detection of disseminating disease would be of great interest.
We investigated the use of cytokeratin genes expression to
detect blood metastases from colorectal tumors. Epithelial
tumor cells were isolated from whole blood using the monoclonal antibody (MAb) BerEP4 and magnetic beads, and
detected by reverse transcription-polymerase chain reaction
using oligonucleotides derived from the cDNA sequences of
cytokeratins 8, 19 and 20. The sensitivity of this assay was
determined by spiking SW620 colon carcinoma cells in normal blood. Using cytokeratin 19 expression we were able to
detect 1 epithelial tumor cell in 1 ml of whole blood. The
clinical applicability of this technique was explored by evaluating patients with a colorectal carcinoma. Epithelial cells were
detected in the blood of 12 out of 23 patients, 2 (20%) of 10
with Astler-Coller stage A or B, and 10 (77%) of 13 with stage
C or D cancer. In conclusion, this test is a non-invasive,
sensitive, and specific assay for detecting circulating epithelial
cells in blood. It may be useful for the early diagnosis of
disseminating disease, to determine whether the presence of
micrometastatic cells at the time of surgery is correlated
with an early relapse and for monitoring adjuvant therapeutic
trials. Int. J. Cancer 74:540–544, 1997.
r 1997 Wiley-Liss, Inc.
Metastasis is an important factor that regulates the prognosis of
patients with cancer. In the process of metastasis, tumor cells are
scattered from the original site, are spread hematogenously, and are
arrested in small vessels. These cells must then adhere to the vascular
endothelium, migrate into the extracellular space, establish a microenvironment, escape host defense mechanisms, and finally grow into
secondary tumors. Detection of such tumor cells circulating in the
peripheral blood is of interest to detect micrometastases at an early
stage. This is likely to provide clinicians with an important predictive
tool with respect to recurrence and metastases and to result in a more
appropriate selection of patients for adjuvant therapy.
Immunocytochemical procedures have been used to detect
micrometastases in bone marrow and lymph nodes. But this
technique is tedious for routine analysis of 5–10-ml blood samples.
An alternative is to analyze nucleic acid following amplification by
means of the polymerase chain reaction (PCR). Based on the high
sensitivity of the PCR, in conjunction with tumor specific genetic
alterations, a few tumor cells can be detected in a great excess of
non-malignant cells. In the case of solid tumors, the p53 tumor
suppressor gene and the ras oncogene are the most consistently
mutated genes (Hollstein et al., 1991). For instance, p53 mutations
have been used to detect bladder tumor cells in urine of patients
(Sidransky et al., 1991), and mutated ras gene has been used as a
marker of cells from colorectal cancer in stools (Sidransky et al.,
1992) and in lymph nodes (Hayashi et al., 1995). However, these
single mutations have not been consistently found, and therefore
this technique can be applied only to a limited number of patients.
Alternatively, the phenotypic characteristics of the tumor cells
can be used (Denis et al., 1996a; Pelkey et al., 1996). The detection
relies on the tissue specific expression of a gene. This gene has to
be expressed in cancer cells but not in cells that are normally
present in blood. A high level of expression facilitates detection.
This gene can even be expressed in the corresponding normal
tissue, assuming that in most cases, normal cells (e.g., melanocytes
or colonocytes) will not circulate in blood. For instance, tyrosinase,
a key enzyme of melanogenesis specifically expressed by melanocytes (both normal and melanoma cells), is used to detect melanoma cells in blood. The prostatic specific antigen is used to detect
prostate cancer cells. Total RNA is prepared from blood. The specific
RNA is reverse transcribed and this cDNA is then amplified by PCR.
In most cases a two-stage amplification is performed by using
nested primers to further increase the detection sensitivity.
Amplification of cytokeratins mRNA can be used to detect
micrometastases of epithelial tumors in lymph nodes (Gunn et al.,
1996; Schoenfeld et al., 1996). Therefore, we investigated the use
of cytokeratin genes expression to detect blood metastases from
colorectal tumors. In this report, we show that by combining
immunomagnetic separation (IMS) to enrich for epithelial cells and
nested reverse transcription-polymerase chain reaction (RT-PCR),
we can specifically detect a few cells in blood and we present the
results of the first clinical specimen investigated.
MATERIAL AND METHODS
Reverse transcription and polymerase chain reaction
The reverse transcription reaction and PCR amplification were
performed in a Crocodile III thermal reactor (Appligene, Illkirch,
France). Aerosol resistant tips (Stratagene, La Jolla, CA) were used
to prevent contamination. Primers were designed from the published sequence for human cDNAs using the Genejockey software
(Biosoft, Cambridge, UK). They were selected on different exons
of the corresponding gene so that DNA amplified from genomic
DNA would be larger than the fragment amplified from cDNA. The
sequences of these primers and the length of the amplified DNA
fragments are indicated in Table I. The primers for cytokeratin 19
were selected to maximize mismatches between cytokeratin 19
mRNA and the cytokeratin 19 pseudogene sequences (Savtchenko
et al., 1988) to avoid amplification of this processed pseudogene.
Total RNA was heated at 72°C for 3 min and cooled on ice. It
was then combined with 100 pmoles of the 38 outer oligonucleotide, transcription buffer (50 mM Tris-hydrochloride pH 8.3, 75
mM KCl, 3 mM MgCl2), DTT (2 mM), dNTPs (1 mM each),
RNasin (50 units; Promega, Lyon, France), and Superscript reverse
transcriptase (200 units; Life Technologies, Gaithersburg, MD) in a
total volume of 25 µl. Incubation was performed at 42°C for 60
min. Amplification was performed with 2.5 µl of cDNA in a total
Contract grant sponsor: Fondation de France, Lisue Départementale (44)
Contre le Cancer.
*Correspondence to: Laboratoire de Biochimie Spécialisée, Institut de
Biologie, 9, Quai Moncousu F-44035, Nantes, France. Fax: (33)
02.40.08.40.82; E-mail: [email protected]
Received 27 March 1997; Revised 2 June 1997
HEMATOGENOUS DISSEMINATION OF COLON CANCER
TABLE I – OLIGONUCLEOTIDES USED FOR SYNTHESIS AND AMPLIFICATION OF CYTOKERATIN
Genes for:
Cytokeratin 8
PCR1
PCR2
Cytokeratin 19
PCR1
PCR2
Cytokeratin 20
PCR1
PCR2
1The
58 oligonucleotides
541
cDNA FRAGMENTS1
38 oligonucleotides
Size (bp)
CAGTTACGGTCAACCAGAGC (exon 1)
AGACCCTGAACAACAAGTTTGC (exon 1)
CTTGTTCTTGAAGTCCTCCACC (exon 2)
CGCCTAAGGTTGTTGATGTAGC (exon 2)
341
160
GTGGAGGTGGATTCCGCTCC (exon 2)
ATGGCCGAGCAGAACCGGAA (exon 2)
TGGCAATCTCCTGCTCCAGC (exon 4)
CCATGAGCCGCTGGTACTCC (exon 4)
433
328
CCAGACACACGGTGAACTATGG (exon 1)
TGAAGTATGAGACTGAGAGAGG (exons 2–3)
ATGATGACGCCAAGGTTCAGGC (exon 4)
ACCTCCACATTGACAGTGTTGC (exon 4)
570
210
nucleotides underlined represent reported differences from the pseudogene for cytokeratin 19.
volume of 50 µl containing 13 PCR buffer (10 mM Trishydrochloride pH 9.0, 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton
X-100 and 0.2 mg/ml gelatin), 200 µM of each dNTP, 100 pmoles
outer primers, and 1 unit Taq DNA polymerase (Appligene). Thirty
cycles were then carried out (94°C for 30 sec, 56°C for 45 sec,
72°C for 60 sec) followed by a 5 min final extension at 72°C. For
reamplification with the nested primers, 0.5 µl of the first amplification was amplified in a final volume of 50 µl with inner primers as
described above. The final products were analyzed by electrophoresis on 2% agarose gels containing ethidium bromide.
Immuno-magnetic separation
Blood sampling was performed immediately before the beginning of surgery. Blood samples (5 ml) were collected in heparinized
tubes and stored at 4°C for a maximum of 2 hr before treatment.
The samples were washed 3 times with cold PBS. Magnetic beads
covalently coated with the BerEP4 MAb (DYNAL, Oslo, Norway)
were then added (4 3 106 beads/ml of blood). Following incubation performed at 4°C for 30 min, cells bound to the beads were
retrieved using a magnetic field. The beads were then washed 3
times with PBS. Total RNA was extracted from the cells immobilized on the beads with TRIZOL reagent as described by the
manufacturer (Life Technologies). cDNA was synthesized and
amplified as described above.
RESULTS
Colon cancer cell lines
We have used a combination of reverse transcriptase and
polymerase chain reaction (2 successive amplifications) to synthesize and amplify a fragment of cytokeratin genes (8, 19 and 20).
Cytokeratins genes were chosen as target genes as they are
supposed to be specifically expressed in epithelial cells. We first
analyzed expression of these genes in cultured cells from colon
carcinoma (HCT8R, SW948, SW1116, SW48, CaCO2, HT29). A
DNA fragment of the expected size (Table I) was detected in all
these cell lines after the first PCR amplification with primers
corresponding to the cytokeratin 8 or 19 mRNA (data not shown),
indicating a high level of expression. The nested amplification was
required to obtain the expected DNA fragment in all these cell lines
with oligonucleotides corresponding to cytokeratin 20 (not shown),
indicating a lower expression than for cytokeratin 8 and 19.
In order to determine the sensitivity of the RT-PCR, serial
dilutions of total RNA prepared from the colon carcinoma cell line
HT29 were performed and processed for cDNA synthesis and
nested amplification. A clear signal was obtained with primers
corresponding to cytokeratins 8 and 19 with as little as 1 pg of total
RNA, potentially detecting the corresponding mRNA from a single
colon carcinoma cell (data not shown).
Whole blood
We then analyzed normal blood samples collected in heparinized
tubes. Total cellular RNA was extracted using a modification of the
original acid guanidinium thiocyanate/phenol/chloroform extraction detailed elsewhere (Denis and Lustenberger, 1993). Approximately 100 µg of total RNA were obtained from 10-ml blood
samples. Reverse transcription and amplification were performed.
No signal was detected after the first amplification (not shown).
The second PCR yielded an amplified product of the expected size
in most of the normal samples (Fig. 1), thus making the use of these
genes as markers of circulating colorectal carcinoma cells nonspecific and not suitable for this purpose.
Immuno-magnetic separation
One way to circumvent this lack of specificity was to include an
enrichment step based on the use of a specific MAb coupled to
magnetic beads. We have used the BerEP4 MAb. This antibody
recognizes an epitope on the protein moiety of two 34 and 39 kDa
glycopeptides expressed at the surface of epithelial cells in normal
and malignant tissues (Momburg et al., 1987). It has been shown to
react with all the colorectal tumors analyzed (Latza et al., 1990).
This antibody was covalently linked to magnetic beads.
The efficiency of separation was first tested by using these beads
with normal blood or blood supplemented with SW620 colon
carcinoma cells. These cells, as well as all the colon carcinoma cell
lines we have tested (SW48, SW620, SW480, HT29, HCT8R,
Colo205, ALT-I, ALT-F, ALT-G), were found to express the BerEP4
antigen at their surface as determined by indirect immunofluorescence (data not shown). Following IMS, RNA was extracted from
the cells immobilized on the magnetic beads. Nested RT-PCR was
then performed. Cytokeratin 8 was detected with normal blood
(Fig. 2). By contrast, analysis using oligonucleotides derived from
cytokeratins 19 or 20 revealed no signal for normal blood, whereas
a strong signal was seen when colon carcinoma cells were added in
the sample prior to IMS. As cytokeratin 19 expression was higher
than cytokeratin 20 expression in all the cell lines examined,
cytokeratin 19 was used in subsequent experiments.
In order to determine the sensitivity of this assay, SW620 colon
carcinoma cells were spiked in normal blood. As shown in Figure
3, we were able to detect 1 cell in 1 ml of whole blood, i.e., in 5 3
106–107 nucleated cells. This amplification was reverse transcriptasedependent, demonstrating that DNA was amplified from the
cytokeratin 19 transcript and not from the processed pseudogene.
This was further confirmed by restriction analysis of the amplified
fragments using the HinfI restriction endonuclease (data not
shown).
Controls
Blood collected from 26 healthy donors and 16 patients with
gastrointestinal diseases (alcoholic hepatitis, diverticulosis, Crohn’s
disease, sigmoiditis, gastric ulcers) was tested. The median age was
60 years (range: 34–87), with 25 males and 17 females. All these
samples were negative.
Colorectal tumor patients
The clinical applicability of our technique was explored by
evaluating patients with a colorectal carcinoma. Blood samples
were collected before they underwent surgical therapy. The median
age of the patients was 64 years (range: 33–85) with 11 males and
12 females. The data obtained from these patients are presented in
Table II. The clinical staging of these patients was performed
DENIS ET AL.
542
FIGURE 2 – Nested RT-PCR detection of cytokeratins 8 (1), 19 (2)
and 20 (3) expression following IMS. (A) Blood from a healthy
volunteer. (B) Same blood sample supplemented with 100 SW620
colorectal cancer cells per ml of blood.
FIGURE 1 – Nested RT-PCR detection of cytokeratins 8 (A), 19 (B)
and 20 (C) expression in whole blood. Total cellular RNA was
extracted from whole blood of 8 healthy volunteers. Reverse transcription and amplification were performed. The star indicates DNA
fragments amplified from genomic DNA.
according to Astler and Coller (1954). We also determined the
serum concentration of tumor markers carcinoembryonic antigen
(CEA) and CA19.9 in these samples. Two patients presenting a
tumor no deeper than the submucosa (stage A) were tested. None
had epithelial cells detected in their blood. Eight patients of stage B
(with invasion to the muscularis propria or to the serosa without
nodal involvement) were analyzed. Two samples (from patients 6
and 26) were found to contain epithelial cells. In both cases, tumor
markers were normal. Eight patients with histologic evidence of
loco-regional lymph node involvement, i.e., stage C of the classification, were analyzed. Six of them (patients 1, 3, 5, 7, 8 and 25) had
detectable epithelial tumor cells in their blood. Three of these
positive patients (patients 1, 5 and 25) had normal tumor markers.
Finally, we analyzed 5 patients with distant metastases (stage D).
Four of them had circulating epithelial tumor cells in their blood.
Patient 27, presenting with lung metastases, had epithelial tumor
cells in his blood and normal tumor markers.
DISCUSSION
Using an RT-PCR amplification method, the potential of several
target genes that could be used to detect colorectal tumor cells in
peripheral blood has been evaluated. We initially examined several
normal blood samples for CEA, which is commonly used as a
tumor marker. A signal was obtained for all the samples (Denis and
Lustenberger, 1995). We performed a similar analysis with primers
derived from cytokeratin genes, which are, in higher vertebrates,
expected to display some specificity for epithelial cells. Again,
nested RT-PCR yielded detectable DNA fragments corresponding
to all these genes from normal blood RNA. Similar results have
been reported for cytokeratin 19 (Krisman et al., 1995). There are 2
possible explanations for this. On one hand, cells of non-epithelial
origin expressing these cytokeratin genes (Traweek et al., 1993)
might be present in peripheral blood. It has been shown, for
instance, that cytokeratins are expressed in smooth muscle cells
(Jahn et al., 1993). On the other hand, all the cells from peripheral
blood may express scant amount of cytokeratin mRNAs. This may
reflect a general process of illegitimate transcription. A similar
observation has been reported by Chou et al. (1994), who found
FIGURE 3 – Sensitivity of the IMS-RT-PCR technique. IMS was
performed with 1 ml of blood from a healthy volunteer (1), 1 ml of
blood supplemented with 1 (2) or 10 (3) SW620 colorectal cancer cells.
The reverse transcription was performed in the absence (2) or in the
presence (1) of reverse transcriptase.
that albumin mRNA, previously used as a marker of circulating
hepatocytes in hepatocellular carcinoma, could be detected in
peripheral blood of most normal subjects and is therefore not
suitable for this purpose. The prostate-specific antigen, used to
detect micrometastases of prostate cancer in the blood, has also
been shown to be expressed in nonprostatic cells (Smith et al.,
1995).
To increase the specificity of detection, immunomagnetic beads,
labeled with an epithelium-specific MAb, were used to isolate
epithelial colorectal tumor cells from blood. This antibody has
already been used to enrich for epithelial colorectal cells (Hardingham et al., 1993), but the authors used mutation of codon 12 of
K-ras to detect these cells following IMS. The major problem is
that approx. 50% of colorectal carcinomas do not have a mutated
ras gene. Thus the use of this technique is limited. By using
cytokeratin 19 gene as a target gene, we do not encounter this
limitation. By combining 2 techniques, one based on the detection
of a membrane antigen by a MAb, the other on nested RT-PCR, we
find that the clinical specificity appears to be high, based on the
absence of a false-positive in our control group.
The 2 stage A patients tested did not present circulating epithelial
tumor cells. By contrast, 4 out of 5 patients with a clinically
HEMATOGENOUS DISSEMINATION OF COLON CANCER
543
TABLE II – CLINICAL AND BIOLOGICAL STATUS OF 23 PATIENTS WITH COLORECTAL CARCINOMA
Patient
Sex/age
Staging (Astler
and Coller)
Metastases
Epithelial tumor
cells in blood
CEA1
(ng/ml)
CA19.92
(U/ml)
2
16
9
12
26
6
11
22
23
24
15
25
1
3
5
7
8
19
4
10
20
27
28
F33
M85
F71
F70
M69
F80
M57
M88
F83
F71
F61
F70
M66
M49
F63
M59
M55
M59
M70
F49
F46
M68
F54
A
A
B1
B1
B1
B2
B2 (local relapse)
B2
B2
B2
C1
C1
C2
C2
C2
C2 (local relapse)
C2
C2
D
D
D
D
D
—
—
—
—
—
—
—
—
—
—
lymph nodes
lymph nodes
lymph nodes
lymph nodes
lymph nodes
lymph nodes
lymph nodes
lymph nodes
peritoneum 1 liver
liver
liver
lung
liver
2
2
2
2
1
1
2
2
2
2
2
1
1
1
1
1
1
2
1
2
1
1
1
1.2
3.5
0.8
1.1
1.1
5.2
34.7
2.0
12.0
1.5
0.6
1.4
0.6
19.0
1.8
4.0
16.2
1.0
20920.0
21.6
26.2
1.3
101.2
2
12
7
9
5
8
2
11
29
10
25
8
2
22
26
246
150
10
526
106
770
11
3633
1Normal
range: 10 ng/ml.–2Normal range: 37 U/ml.
established metastatic disease had tumor cells in their blood. This is
in agreement with the 5-year survival rates after surgery for these
patients, which are .90% and ,5%, respectively (Sinicrope and
Sugarman, 1995). The results obtained for stage C patients are also
consistent with the published 5-year survival rate, which varies
from 50 to 65% for stage C1 to 25 to 45% for stage C2. This clearly
shows that an overwhelming majority of these patients have, in
addition to established lymph node metastases, potential distant
metastases in their blood. Finally, for 2 of the 8 patients who had no
detected node involvement (stage B), we were able to identify early
a disseminating disease.
All cancer staging systems seek to identify clinical and pathological features that can predict outcome or guide therapy. In the case
of colorectal cancer, adjuvant chemotherapy is usually applied to
stage C patients. In resected lymph-node positive colon cancer,
5-fluorouracil and levamisole have been shown to increase survival
rates. By contrast, the optimal treatments for patients with stage B
colon cancer (negative pericolic lymph nodes) is unclear. The
5-year survival rate of these patients varies from 80 to 85% (stage
B1) to 70 to 75% (stage B2). The clinical problem is therefore
straightforward: how can the patients with stage B disease be
selected who could benefit from adjuvant therapy after surgery and
how can we avoid unnecessary treatment of patients with a low
probability of recurrence? Detection of epithelial tumor cells in
blood might help in the selection of patients at high risk for
metastases in the group of patients who are presently assessed with
a good prognosis. Detection of early blood micrometastases in
some of these patients might be used to guide therapy.
Additional studies to monitor epithelial tumor cells in blood of
stage C patients receiving an adjuvant therapy (chemotherapy,
radiotherapy, and immunotherapy, either alone or in combination)
will also be of critical importance. As mentioned above, adjuvant
chemotherapy has been shown to be highly effective for patients
with stage C colon cancer. If the circulation is cleared of epithelial
tumor cells after treatment, then the procedure described here could
also be used to monitor early detection of relapse. Finally,
tumor-cell shedding by surgical manipulation, which has been
reported for prostate tumors (Eschwège et al., 1995) and melanoma
(Denis et al., 1996b) can also be assessed for colorectal carcinomas
by using this method.
We conclude that IMS combined with a nested RT-PCR is a
non-invasive, sensitive, and specific assay for detection of circulating epithelial tumor cells in the blood. This test may be useful for
the early detection of disseminating disease and for monitoring
adjuvant therapies. Clearly, further studies and longer follow-up
are required to establish the prognostic significance of these
circulating cells.
ACKNOWLEDGMENTS
This work was supported by the European Brite Mebioce project
(Pr. Bisconte). We are most grateful to Dr. Cassagnau for providing
the anatomopathological data.
REFERENCES
ASTLER, V.B. and COLLER, F.A., The prognostic significance of direct
extension of carcinoma of the colon and rectum. Ann. Surg., 139, 846–852
(1954).
CHOU, H.C., SHEU, J.C., HUANG, G.T., WANG, J.T. and CHEN, D.S., Albumin
messenger RNA is not specific for circulating hepatoma cells. Gastroenterology, 107, 630–631 (1994).
DENIS, M., TRUCHAUD, A. and LUSTENBERGER, P., Detection de metastases
de tumeurs solides dans la circulation sanguine par PCR. Immunoanal. Biol.
Spec., 11, 361–371 (1996a).
DENIS, M.G. and LUSTENBERGER, P., A simple method of RNA isolation
from large blood samples. Methods Mol. Cell. Biol., 4, 128–130 (1993).
DENIS, M.G. and LUSTENBERGER, P., Qualitative low-level internal control
for nested RT-PCR. Biotechniques, 19, 906–908 (1995).
DENIS, M.G., TESSIER, M.H., DRENO, B. and LUSTENBERGER, P., Circulating
micrometastases following oncological surgery. Lancet, 347, 913 (1996b).
ESCHWÈGE, P., DUMAS, F., BLANCHET, P., LEMAIRE, V., BENOIT, G., JARDIN,
A., LACOUR, B. and LORIC, S., Haematogenous dissemination of prostatic
cells during radical prostatectomy. Lancet, 346, 1528–1530 (1995).
GUNN, J., MCCALL, J.L., YUN, K. and WRIGHT, P.A., Detection of
544
DENIS ET AL.
micrometastases in colorectal cancer patients by K19 and K20 reverse
transcription polymerase chain reaction. Lab. Invest., 75, 611–616 (1996).
HARDINGHAM, J.E., KOTASEK, D., FARMER, B., BUTLER, R.N., MI, J.X.,
SAGE, R.E. and DOBROVIC, A., Immunobead-PCR: a technique for the
detection of circulating tumor cells using immunomagnetic beads and the
polymerase chain reaction. Cancer Res., 53, 3455–3458 (1993).
HAYASHI, N., ITO, I., YANAGISAWA, A., KATO, Y., NAKAMORI, S., IMAOKA, S.,
WATANABE, H., OGAWA, M. and NAKAMURA, Y., Genetic diagnosis of
lymph-node metastasis in colorectal cancer. Lancet, 345, 1257–1259
(1995).
HOLLSTEIN, M., SIDRANSKY, D., VOGELSTEIN, B. and HARRIS, C.C., p53
mutations in human cancers. Science, 253, 49–53 (1991).
JAHN, L., KREUZER, J., VONHODENBERG, E., KUBLER, W., FRANKE, W.W.,
ALLENBERG, J. and IZUMO, S., Cytokeratin-8 and cytokeratin-18 in smooth
muscle cells-detection in human coronary artery, peripheral vascular, and
vein graft disease and in transplantation-associated arteriosclerosis. Arteriosclerosis Thrombosis, 13, 1631–1639 (1993).
KRISMAN, M., TODT, B., SCHRODER, J., GAREIS, D., MULLER, K.M., SEEBER,
S. and SCHUTTE, J., Low specificity of cytokeratin 19 reverse transcriptasepolymerase chain reaction analyses for detection of hematogenous lung
cancer dissemination. J. clin. Oncol., 13, 2769–2775 (1995).
LATZA, U., NIEDOBITEK, G., SCHWARTING, R., NEKARDA, H. and STEIN, H.,
Ber-EP4: new monoclonal antibody which distinguishes epithelia from
mesothelia. J. clin. Pathol., 43, 213–219 (1990).
MOMBURG, F., MOLDENHAUER, G., HÄMMERLING, G.J. and MÖLLER, P.,
Immunohistochemical study of the expression of a Mr 34,000 human
epithelium-specific surface glycoprotein in normal and malignant tissues.
Cancer Res., 47, 2883–2891 (1987).
PELKEY, T.J., FRIERSON, H.F. and BRUNS, D.E., Molecular and immunological detection of circulating tumor cells and micrometastases from solid
tumors. Clin. Chem., 42, 1369–1381 (1996).
SAVTCHENKO, E.S., SCHIFF, T.A., JIANG, C.K., FREEDBERG, I.M. and
BLUMENBERG, M., Embryonic expression of the human 40-kD keratin:
evidence from a processed pseudogene sequence. Amer. J. hum. Genet., 43,
630–637 (1988).
SCHOENFELD, A., LUQMANI, Y., SINNETT, H.D., SHOUSHA, S. and COOMBES,
R.C., Keratin 19 mRNA measurement to detect micrometastases in lymph
nodes in breast cancer patients. Brit. J. Cancer, 74, 1639–1642 (1996).
SIDRANSKY, D., TOKINO, T., HAMILTON, S.R., RINGKER, K.W., CEVIM, B.,
FROST, P. and VOGELSTEIN, B., Identification of ras oncogene mutations in
the stools of patients with curable colorectal tumors. Science, 256, 102–105
(1992).
SIDRANSKY, D., VON ESCHENBACH, A., TSAI, Y.C., JONES, P., SUMMERHAYES,
I., MARSHALL, F., PAUL, M., GREEN, P., HAMILTON, S.R., FROST, P. and
VOGELSTEIN, B., Identification of p53 gene mutations in bladder cancers and
urine samples. Science, 252, 706–709 (1991).
SINICROPE, F.A. and SUGARMAN, S.M., Role of adjuvant therapy in
surgically resected colorectal carcinoma. Gastroenterology, 109, 984–993
(1995).
SMITH, M.R., BIGGAR, S. and HUSSAIN, M., Prostate-specific antigen
messenger RNA is expressed in non-prostate cells: implications for
detection of micrometastases. Cancer Res., 55, 2640–2644 (1995).
TRAWEEK, S.T., JIU, J. and BATTIFORA, H., Keratin gene expression in
non-epithelial tissues. Detection with polymerase chain reaction. Amer. J.
Pathol., 142, 1111–1118 (1993).
Документ
Категория
Без категории
Просмотров
2
Размер файла
117 Кб
Теги
394
1/--страниц
Пожаловаться на содержимое документа