close

Вход

Забыли?

вход по аккаунту

?

Induced expression of theCandida albicans multidrug resistance geneCDR1 in response to fluconazole and other antifungals

код для вставкиСкачать

. 14: 485–492 (1998)
Characterization of the Prk1 Protein Kinase from
Schizosaccharomyces pombe
PETER WATSON AND JOHN DAVEY*
Department of Biological Sciences, University of Warwick, Coventry CV4 7AL, U.K.
Received 18 July 1997; accepted 4 October 1997
We report the isolation and characterization of a protein kinase from the fission yeast Schizosaccharomyces pombe.
The proposed Prk1 protein contains 352 amino acids and has significant homology to the Ume5p kinase (also known
as Srb10p, Ssn3p and Are1p) of the budding yeast Saccharomyces cerevisiae, a cyclin-dependent kinase involved in
regulating the transcription of a diverse set of genes. Disruption of the prk1 gene increases flocculation but does not
appear to have any other significant effect on cell behaviour. This defect can be overcome by expressing the UME5
gene, indicating that Prk1 is the fission yeast homologue of Ume5p. The sequence is in the EMBL data library under
Accession Number Z98977. ? 1998 John Wiley & Sons, Ltd.
Yeast 14: 485–492, 1998.
  — Schizosaccharomyces pombe; protein kinase; cell flocculation; PRK1
INTRODUCTION
Conjugation between haploid cells of Schizosaccharomyces pombe involves the reciprocal
exchange of diffusible mating pheromones; M cells
(of mating type Minus) release M-factor and
respond to the P-factor released by P cells (mating
type Plus) (reviewed in Nielsen and Davey, 1995).
Binding of the pheromones to specific 7-span
receptors on the surface of the target cell activates
an intracellular signalling pathway which leads to
changes in the pattern of gene transcription and
prepares the cell for mating. Responses induced by
the pheromones include a G1 arrest of the cell
cycle, an increase in agglutination, and the elongation of the cell to form a shmoo. Persistent stimulation in the absence of mating does not, however,
*Correspondence to: John Davey, Department of Biological
Sciences, University of Warwick, Coventry CV4 7AL, UK. Tel:
(+44) 01203 524204; fax: (+44) 01203 523701; e-mail:
PDJT@dna.bio.warwick.ac.uk.
Contract/grant sponsor: Cancer Research Campaign (UK).
Contract/grant number: SP1972.
CCC 0749–503X/98/050485–08 $17.50
? 1998 John Wiley & Sons, Ltd.
induce a continuous response as the cells recover
and adapt to the presence of the pheromone
(Davey and Nielsen, 1994; Imai and Yamamoto,
1994). One of the best-characterized mechanisms
for the desensitization of 7-span receptors in
higher eukaryotes involves phosphorylation of
activated receptors by G protein-coupled receptor
kinases (GRKs; reviewed in Lefkowitz, 1993;
Ferguson et al., 1996). No GRK has yet been
described in yeast although the pheromone receptors are phosphorylated following stimulation and
this may contribute to desensitization (Reneke
et al., 1988; Zanolari et al., 1992; Chen and
Konopka, 1996). One approach we are using to
identify potential GRKs in Sz. pombe exploits the
homology that exists within this family and we
have isolated several candidates that are currently
undergoing further analysis. Here, however, we
report the characterization of a non-GRK protein
kinase that we isolated during this work and
present evidence to suggest that Prk1 (protein
kinase) is the Sz. pombe homologue of the Ume5p
.   . 
486
Figure 1. Sequence comparison of various GRKs. The deduced amino acid
sequences of various GRKs were aligned to maximize homology (gaps
introduced to maximize the alignment are indicated by dots). Residues
identical in all sequences are indicated by an asterisk, the unusual DLG
motif is emboldened and the primers used for PCR are indicated above the
alignment. The sequences are from Homo sapiens (Hs) â-adrenergic receptor
kinase type 1 (âARK1; accession number X61157; Benovic et al., 1991) and
type 2 (âARK2; X69117; Parruti et al., 1993); Bos taurus (Bs) rhodopsin
kinase (RhoK, sometimes referred to as GRK3; M73836; Lorenz et al.,
1991); Hs GRK4 (L03718; Ambrose et al., 1992); Hs GRK5 (L15388;
Kunapuli and Benovic, 1993); Hs GRK6 (L16862; Benovic and Gomez
(1993); Drosophila melanogaster (Dm) GPK1 (M80493) and GPK2 (M80494;
Cassill et al. 1991); Caenorhabditis elegans (Ce) YQR1 (Z48006) and YR22
(U22833).
kinase (also called Srb10p, Ssn3p and Are1p) from
the budding yeast Saccharomyces cerevisiae
(Surosky et al., 1994; Kuchin et al., 1995; Liao
et al., 1995; Wahi and Johnson, 1995). Disruption
of the prk1 gene is not lethal and, although it
increases flocculation, it does not appear to have
any other significant effect on cell behaviour.
MATERIALS AND METHODS
Isolation of prk1
Sequence comparison of GRKs from various
organisms identified a pair of oligonucleotides that
would be expected to amplify related proteins
in Sz. pombe (Figure 1). The sense primer
(JO278) TA(C/T)(A/C)GIGA(C/T)(C/T)TIAA(A/
G)CC corresponds to the sequence YRDLKP
(actually HRDLKP in Prk1, residues 138–143) and
the antisense primer (JO280) corresponds to
YMAPEV (actually YRAPEL in Prk1, residues
184–189). BamHI restriction sites were included in
the primers to facilitate cloning of the products
obtained by the polymerase chain reaction (PCR).
Primers were synthesized by Alta Bioscience
(University of Birmingham, UK) on a BioTech
Instruments BT510 Automatic Synthesizer using
materials and conditions recommended by the
manufacturer. Amplification by PCR was performed in 50 ìl volumes, as described by Kocher
? 1998 John Wiley & Sons, Ltd.
et al. (1989), using chromosomal DNA from a
wild-type M cell as template (30 cycles of 94)C
for 30 s, 50)C for 1 min and 72)C for 1 min). The
amplified products were cloned into pBluescript
(Stratagene, Cambridge, UK) and sequenced by
the dideoxynucleotide method using doublestranded DNA as template. One of the products
containing an open reading-frame (ORF) consistent with a kinase having a DLG motif was then
chosen for further analysis.
The prk1 gene was identified by hybridization
screening of an Sz. pombe genomic library using
the cloned PCR product as probe. The library
was provided by Dr Tamar Enoch and is a
SauIIIA partial digest of genomic DNA in ëZAP
(Stratagene). Isolated clones were sequenced using
a series of primers designed to generate overlapping sequence data and the sequence shown in
Figure 2 was determined in both orientations.
DNA manipulations were according to standard
procedures and sequence analysis was performed
using the GCG package (Genetics Computer
Group, Wisconsin, USA). The same sequence was
recently independently identified as part of the Sz.
pombe genome sequencing project by Dr B. Barrell
and colleagues and was deposited in the EMBL
database (Z98977). As the two sequences are identical, we have not made a separate submission of
our work.

. 14: 485–492 (1998)
1    . 
487
Figure 2. Sequence of the prk1 gene. Numbering of the nucleotide
sequence is from the proposed start of the Prk1 protein and the DLG
motif is underlined.
Gene disruption
The prk1 gene was replaced by a 1·8-kb Sz.
pombe ura4+ cassette (Grimm et al., 1988). The
upstream non-coding region was amplified
by PCR using the sense primer JO489 GGGC
AGCTGCTCAAGAGTGCACAGTGGCATGG
(includes an emboldened PvuII site such that
digestion leaves blunt ends that are fully homologous to the chromosomal sequence) and the
? 1998 John Wiley & Sons, Ltd.
antisense primer JO491 GGGGGATCCATCAA
CCTATTCATTATCC (includes a BamHI site
and is complementary to a region immediately
upstream of the initiator codon). The downstream
non-coding region was amplified using primer
JO490 GGGGGATCCGCTGAAATGAGACCC
TACCC (includes a BamHI site and is complementary to a region immediately downstream of the
stop codon) and JO492 GGGCAGCTGTAACT
CATTCTCTTCAAC (includes a PvuII site and

. 14: 485–492 (1998)
488
.   . 
Kozak, 1984, 1986; Yun et al., 1996) and the
antisense primer JO528 GGCAGCTGTTAAAA
ATGGGCTAAAAAGTG (includes a PvuII site
and the stop anticodon TTA). The 1·1-kb PvuII
fragment was then cloned into the end-filled
BamHI site of the expression vector pREP3X
(Maundrell, 1993). This places expression of the
prk1 gene under the control of the thiaminerepressible nmt1 promoter. The UME5 ORF was
amplified using JO529 GGGGATCCACCATG
TATAATGGCAAGGATAGAGC (includes a
BamHI site, the initiator ATG, and an improved
Kozak sequence) and JO530 GGGGATCC
CTATCTTCTGTTTTTCTTTCG (includes a
BamHI site and the stop anticodon CTA) and the
resulting 1·7-kb BamHI fragment was cloned into
the BamHI site of pREP3X. The resultant plasmids (pREP3-Prk1 and pREP3-UME5) were then
transformed into strains carrying the disrupted
prk1 allele. Cells were cultured in defined minimal
medium in the presence or absence of 2 ìthiamine.
Figure 3. Disruption of the prk1 gene. A limited restriction
map of the prk1 locus showing the extent and direction of the
ORF. The fragment used to disrupt the gene in vivo is shown
below the map. Genomic DNA was digested with BglII and
probed with the fragment shown above the map. The first lane
contains DNA from a wild-type strain (prk1 + ) while the other
two lanes contain DNA from independent haploid strains in
which the prk1 allele was disrupted with the ura4 gene
(prk1::ura4 + ).
digestion leaves blunt ends that are fully homologous to the chromosomal sequence). The ura4+
cassette was then introduced between the two
flanking regions as a BamHI fragment. Sz. pombe
strains were transformed with a linear PvuII fragment containing the disruption construct. Transformation was performed using lithium acetate
(Okazaki et al., 1990) and stable Ura+ transformants were initially screened by PCR and the
replacement of the prk1 locus was confirmed by
Southern blotting.
Rescue of prk1 disruptants with prk1 and UME5
The prk1 ORF was amplified using the sense
primer JO527 GGCAGCTGCCACCATGAAA
GACGGTTTTATAAAATTATTGGG (includes
a PvuII site and the initiator ATG, the sequence
immediately upstream of the ATG has been modified from the normal TCAGC to one that is
expected to be more favourable for translation;
? 1998 John Wiley & Sons, Ltd.
Flocculation assay
A culture of cells in late exponential growth
(2108 cells/ml) was sonicated to disperse clumps
and 1·5 ml aliquots were carefully dispensed into
narrow glass tubes (10 mm#60 mm). These were
vortexed and placed on a level surface to allow the
clumps to settle. The top 100 ìl of liquid was
removed from each tube at the appropriate time,
diluted to 1 ml with buffer, sonicated and the cell
number determined in a Coulter Channelyzer
(Coulter Electronics, Luton, UK).
RESULTS AND DISCUSSION
Several members of the GRK family have been
cloned and sequence comparison reveals a number
of conserved features in addition to those found
universally throughout the protein kinase superfamily (Inglese et al., 1993; Penn and Benovic,
1994; Figure 1). Of particular interest is the presence of a DLG (Asp-Leu-Gly) motif within the
catalytic domain, which is considered something
of a signature of the GRKs as the majority of
kinases have either DFG (Asp-Phe-Gly) or DWG
(Asp-Trp-Gly) at this position. We therefore used
the PCR with degenerate oligonucleotide primers
designed against conserved regions from the
GRKs to amplify potential members of this family
in Sz. pombe. A similar approach has been used to

. 14: 485–492 (1998)
1    . 
489
Figure 4. Rescue of the prk1 disruptant by prk1. Cells were grown to
early stationary phase (2108 cells/ml) in minimal medium lacking
thiamine and then assayed for flocculation as described in Materials
and Methods. Briefly, dispersed cells were aliquoted into narrow tubes
and the number of cells remaining in suspension was determined at
various times after flocculation was induced by vortexing. Samples
were also transferred to Petri dishes for photographing. Wild-type
cells (., prk1+) do not show any significant flocculation and remain
in suspension during the course of the experiment. In contrast,
cells lacking prk1 (/, Äprk1) flocculate and settle rapidly. Expression
of prk1 from the thiamine-repressible nmt1 promoter overcomes
the flocculation phenotype of the prk1 disruptant (-, Äprk1 and
pREP3-Prk1).
isolate GRKs from a variety of sources (Cassill
et al., 1991; Haribabu and Snyderman, 1993;
Parruti et al., 1993). The products we obtained
using genomic DNA as template were cloned and
sequenced to identify those containing the DLG
motif. One such product was then used to screen
an Sz. pombe genomic DNA library in ëZAP and
identified several independent isolates, all of which
? 1998 John Wiley & Sons, Ltd.
contained a single segment of chromosomal DNA
with the potential to encode a protein kinase. This
gene is named prk1 for protein kinase (Figure 2).
The chromosomal copy of the prk1 gene was
disrupted by a one-step strategy (Figure 3). No
obvious differences were observed between the
disruptants and wild-type strains with respect to
growth rates, mating efficiencies or their response

. 14: 485–492 (1998)
490
? 1998 John Wiley & Sons, Ltd.
.   . 

. 14: 485–492 (1998)
1    . 
to pheromones. There was also no significant effect
on the sporulation efficiency of a prk1 " /prk1 "
diploid strain. Indeed, the only difference we
observed was the tendency of disruptants to flocculate as the cultures entered stationary phase
(Figure 4). Flocculation was due to the loss of prk1
as plasmid-borne expression of Prk1 completely
rescued the defect (Figure 4).
Database searches revealed significant homology between Prk1 and the Ume5p kinase from
S. cerevisiae (Figure 5A). Ume5p (unscheduled
meiotic gene expression) is a member of the
CMGC group of protein kinases (Hunter and
Plowman, 1997) and is necessary to prevent the
unscheduled expression of meiotic genes during
mitotic growth (Surosky et al., 1994). The same
gene was subsequently identified as SRB10 (encodes a component of the RNA polymerase II
holoenzyme; Liao et al., 1995); SSN3 (encodes a
suppressor of SNF1; Kuchin et al., 1995); and
ARE1 (encodes a protein required for á2 repression; Wahi and Johnson, 1995). Ume5p appears to
be regulated by the cyclin Srb11p (Liao et al.,
1995; the SRB11 gene was also isolated as SSN8;
Kuchin et al., 1995), although it is not thought to
have a direct role in cell cycle control (Poon and
Hunter, 1995). Rather, the complex is involved in
the transcriptional control of a diverse spectrum of
genes and is required not only for the repression
of meiotic transcripts (Strich et al., 1989; Surosky
et al., 1994), but for glucose repression (Kuchin
et al., 1995), phosphate repression of acid phosphatase (Kuchin et al., 1995), and the á2 repression of a-specific genes (Wahi and Johnson, 1995).
Precise details of its regulation and mode of action
remain to be determined but it facilitates the
phosphorylation of the carboxy-terminal domain
of RNA polymerase II and this may control some
event in transcriptional initiation (Liao et al.,
1995). It is perhaps noteworthy that disruption of
UME5 increases the tendency of S. cerevisiae cells
to flocculate (Surosky et al., 1994).
To investigate whether the sequence homology
between Prk1 and Ume5p reflects a functional
relatedness, we introduced the budding yeast gene
491
into the prk1 disruptant (Figure 5B). Expression of
UME5 from the nmt1 promoter almost completely
rescues the flocculation defect of the Sz. pombe
mutant and strongly suggests that these proteins
play the same, or a very similar role, in the
different yeast. A more detailed analysis of gene
expression in the prk1 disruptant under different
growth conditions will be necessary to determine
just how similar they are.
ACKNOWLEDGEMENTS
We thank Lee Haynes and Shahla Abadeh for
their contributions to the early part of this project
and we are grateful to Olaf Nielsen for providing
strains. This work was supported in part by the
Cancer Research Campaign (UK) (ref: SP1972).
J.D. is a Lister Institute Research Fellow.
REFERENCES
Ambrose, C., James, M., Barnes, G., et al. (1992). A
novel G protein-coupled receptor kinase gene cloned
from 4p16.3. Hum. Mol. Genet. 1, 697–703.
Benovic, J. L. and Gomez, J. (1993). Molecular cloning
and expression of GRK6. J. Biol. Chem. 268, 19521–
19527.
Benovic, J. L., Stone, W. C., Huebner, K., Croce, C.,
Caron, M. G. and Lefkowitz, R. J. (1991). cDNA
cloning and chromosomal localization of the human
â-adrenergic receptor kinase. FEBS Lett. 283, 122–
126.
Cassill, J. A., Whitney, M., Joazeiro, C. A. P., Becker,
A. and Zuker, C. S. (1991). Isolation of Drosophila
genes encoding G protein-coupled receptor kinases.
Proc. Natl. Acad. Sci. USA 88, 11067–11070.
Chen, Q. J. and Konopka, J. B. (1996). Regulation of
the G protein-coupled á-factor pheromone receptor
by phosphorylation. Mol. Cell. Biol. 16, 247–257.
Ferguson, S. S. G., Barak, L. S., Zhang, J. and Caron,
M. G. (1996). G protein-coupled receptor regulation:
role of G protein-coupled receptor kinases and
arrestins. Can. J. Physiol. Pharmacol. 74, 1095–1110.
Grimm, C., Kohli, J., Murray, J. and Maundrell, K.
(1988). Genetic engineering of Schizosaccharomyces
pombe: a system for gene disruption and replacement
using the ura4 gene as a selectable marker. Mol. Gen.
Genet. 215, 81–86.
Figure 5. Rescue of the prk1 disruptant by UME5. (A) The deduced sequences for Prk1 (upper) and Ume5p (lower) were
compared using the GCG program ’BestFit’ with a GapWeight of 3·0 and a GapLengthWeight of 0·1. Identity is indicated by a
line between the sequences and conserved changes indicated by two dots (two corresponding bases in a codon). Gaps introduced
to maximize the alignment are indicated by dots within the sequence. (B) Cell were grown to early stationary phase (2108 cells/ml)
in minimal medium lacking thiamine and then assayed for flocculation and photographed. Results for wild-type (., prk1+) and
disrupted (/, Äprk1) cells are included to demonstrate that expression of UME5 from the thiamine-repressible nmt1 promoter
overcomes the flocculation phenotype of the prk1 disruptant (-, Äprk1 and pREP3-UME5).
? 1998 John Wiley & Sons, Ltd.

. 14: 485–492 (1998)
492
Haribabu, B. and Snyderman, R. (1993). Identification
of additional members of human G-protein-coupled
receptor kinase multigene family. Proc. Natl. Acad.
Sci. USA 90, 9398–9402.
Hunter, T. and Plowman, G. D. (1997). The protein
kinases of budding yeast: six score and more. Trends
Biochem. Sci. 22, 18–22.
Inglese, J., Freedman, N. J., Koch, W. J. and Lefkowitz,
R. J. (1993). Structure and mechanism of the G
protein-coupled receptor kinases. J. Biol. Chem. 268,
23735–23738.
Kocher, T. D., Thomas, W. K., Meyer, A., et al. (1989).
Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved
primers. Proc. Natl. Acad. Sci. USA 86, 6196–6200.
Kozak, M. (1984). Compilation and analysis of sequences upstream from the translational start site in
eukaryotic mRNAs. Nucl. Acids Res. 12, 857–872.
Kozak, M. (1986). Point mutations define a sequence
flanking the AUG initiator codon that modulates
translation by eukaryotic ribosomes. Cell 44, 283–292.
Kuchin, S., Yeghiayan, P. and Carlson, M. (1995).
Cyclin-dependent protein kinase and cyclin homologs
SSN3 and SSN8 contribute to transcriptional control
in yeast. Proc. Natl. Acad. Sci. USA 92, 4006–4010.
Kunapuli, P. and Benovic, J. L. (1993). Cloning and
expression of GRK5: a member of the G proteincoupled receptor kinase family. Proc. Natl. Acad. Sci.
USA 90, 5588–5592.
Lefkowitz, R. J. (1993). G protein coupled receptor
kinases. Cell 74, 409–412.
Liao, S.-M., Zhang, J., Jeffery, D. A., et al. (1995). A
kinase-cyclin pair in the RNA polymerase II holoenzyme. Nature 374, 193–196.
Lorenz, W., Inglese, J., Palczewski, K., Onorato, J. J.,
Caron, M. G. and Lefkowitz, R. J. (1991). The
receptor kinase family: primary structure of rhodopsin kinase reveals similarities to the â-adrenergic
receptor kinase. Proc. Natl. Acad. Sci. USA 88, 8715–
8719.
Maundrell, K. (1993). Thiamine-repressible expression
vectors pREP and pRIP for fission yeast. Gene 123,
127–130.
? 1998 John Wiley & Sons, Ltd.
.   . 
Nielsen, O. and Davey, J. (1995). Pheromone communication in the fission yeast Schizosaccharomyces pombe.
Seminars Cell Biol. 6, 95–104.
Okazaki, K., Okazaki, N., Kume, K., Jinno, S.,
Taanaka, K. and Okayama, H. (1990). Highfrequency transformation method and library transducing vectors for cloning mammalian cDNAs
by trans-complementation of Schizosaccharomyces
pombe. Nucl. Acids Res. 18, 6485–6489.
Parruti, G., Ambrosini, G., Sallese, M. and De Blasi, A.
(1993). Molecular cloning, functional expression and
mRNA analysis of human â-adrenergic receptor
kinase 2. Biochem. Biophys. Res. Commun. 190, 475–
481.
Penn, R. B. and Benovic, J. L. (1994). Structure of
the human gene encoding the â-adrenergic receptor
kinase. J. Biol. Chem. 269, 14924–14930.
Poon, R. Y. C. and Hunter T. (1995). Innocent bystanders or chosen collaborators? Curr. Biol. 5, 1243–1247.
Reneke, J. E., Blumer, K. J., Courchesne, W. E. and
Thorner, J. (1988). The carboxy-terminal segment of
the yeast á-factor receptor is a regulatory domain.
Cell 55, 221–234.
Strich, R., Slater, M. R. and Esposito, R. E. (1989).
Identification of negative regulatory genes that govern
the expression of early meiotic genes in yeast. Proc.
Natl. Acad. Sci. USA 86, 10019–10022.
Surosky, R. T., Strich, R. and Esposito, R. E. (1994).
The yeast UME5 gene regulates the stability of
meiotic mRNAs in response to glucose. Mol. Cell.
Biol. 14, 3446–3458.
Wahi, M. and Johnson, A. D. (1995). Identification of
genes required for á2 repression in Saccharomyces
cerevisiae. Genetics 140, 79–90.
Yun, D-F., Laz, T. M., Clements, J. M. and Sherman,
F. (1996). mRNA sequences influencing translation
and the selection of AUG initiator codons in the yeast
Saccharomyces cerevisiae. Mol. Microbiol. 19, 1225–
1239.
Zanolari, B., Raths, S., Singer-Krüger, B. and Riezman,
H. (1992). Yeast pheromone receptor endocytosis and
hyperphosphorylation are independent of G proteinmediated signal transduction. Cell 71, 755–763.

. 14: 485–492 (1998)
Документ
Категория
Без категории
Просмотров
3
Размер файла
192 Кб
Теги
expressions, thecandida, genecdr1, resistance, induced, response, fluconazole, albicans, multidrug, antifungals
1/--страниц
Пожаловаться на содержимое документа