close

Вход

Забыли?

вход по аккаунту

?

TheCandida albicans PKC1 gene encodes a protein kinase C homolog necessary for cellular integrity but not dimorphism

код для вставкиСкачать
YEAST
VOL.
12: 723-730 (1996)
Isolation and Characterization of a A-9 Fatty Acid
Desaturase Gene from the Oleaginous Yeast
Cryptococcus curvatus CBS 570
PATRICIA A. E. P. 'MEESTERS AND GERRIT EGGINK*
Agrotechnical Research Institute (ATO-DLO), PO Box 17, 6700 A A Wageningen, The Netherlands
Received 20 September 1995; accepted 3 January 1996
The oleaginous yeast Cryptococcus curvatus is of industrial interest because it can accumulate triacylglycerols up to
60% of the cell dry weight. We are aiming at genetic modification of fatty acid biosynthesis for the production of
tailor-made triacylglycerols in C. curvatus. As a first step in the development of a transformation and expression
system a gene encoding the A-9 fatty acid desaturase of C. curvatus (CBS 570) was cloned. The 1470 bp gene encodes
a protein of 493 amino acids with a calculated molecular mass of 55 kDa. The gene shows strong similarity to
previous cloned A-9 desaturase genes from rat and Saccharomyces cerevisiae, 62 and 72%, respectively. Expression
of the A-9 desaturase gene was studied. Supplementation of the growth medium with oleic acid (C18:l(c9)) showed
a strong repression (90%) on the mRNA level, while supplementation with petroselinic acid (C18:l(c6))had no effect
on the amount of mRNA.
KEY WORDS
~
A-9 fatty acid desaturase; cryptococcus curvatus
INTRODUCTION
The yeast Cryptococcus curvatus belongs to the
group of oleaginous micro-organisms. These microorganisms are characterized by their ability to
accumulate triacylglycerols to more than 20-25%
of the cell dry weight (Ratledge, 1991). Formation
of intracellular lipids is triggered by conditions
in which there is an excess carbon source and
a limiting amount of one of the other nutrients,
for example, nitrogen or phosphorus. The yeast
C. curvatus was first isolated by Moon et al. (1978)
from cheese plant floors and identified as Candida
curvata. In the following years it has been named
Apiotrichum curvatum (Ykema, 1989) and lately it
has been officially called Cryptococcus curvatus
(CBS, personal communication). C. curvatus has
attracted both industrial and academic attention
because it can accumulate triacylglycerols up to
60% of the cell dry weight during growth on cheap
carbon sources like whey permeate (Davies, 1988).
Production of triacylglycerols in fermentation
processes will always be more expensive than the
production of these compounds in plants. For this
*Corresponding author.
CCC 0749-503X/96/080723-08
6 1996 by John Wiley & Sons Ltd
reason Single Cell Oil processes will only be
economically feasible when high-priced lipids and
fatty acids with unique chemical, physical or
nutritional properties can be produced. In the past
decade C. curvatus has been studied in particular
for the production of cocoa butter equivalent
(Ykema et al., 1990). For this purpose the percentage stearic acid in the triacylglycerols of
C. curvatus has to be increased. Alterations in
environmental conditions like growth temperature
and carbon sources resulted in the formation of
triacylglycerols with the desired fatty acid profile.
In addition to these physiological methods, a genetic approach was followed by Ykema et al. (1989),
who obtained a A-9 fatty acid desaturase mutant
unable to synthesize C16:l and C18:1 fatty acids.
Partial revertants of these mutants appeared to be
very suitable for the production of fats resembling
cocoa butter.
Until now there has been no expression and
transformation system available for C. curvatus
and therefore molecular biological techniques have
not been applied to modify fatty acid biosynthesis
in this yeast. As a first step in the development of
a transformation and expression system we have
724
P. A. E. P . MEESTERS AND G. EGGINK
ORF
SP
S
NK
SP
I
I
I I
I
-
d d
-+
- _ _ * _ _ _ *
-+
-
p
I
S
I
+
+ t t
t
t + +
+
Figure 1. A-9 Fatty acid desaturase restriction map and sequence strategy.
Restrictions sites of the 4.3 kb fragment are depicted; Sp, SphI; S, SucI; N, NcoI;
K , KpnI; P, PstI. The 1470 base long ORF is indicated by the large arrow above
the map. Small arrows below the map correspond to subclones and synthetic
primers used for sequencing.
cloned and characterized the A-9 desaturase gene
of C. curvatus.
Animal and fungal cells have a similar
membrane-bound A-9 fatty acid desaturase system
consisting of cytochrome b,, NADH-dependent
cytochrome b, reductase and the A-9 fatty acid
desaturase. The three-component system is responsible for the introduction of a double bond at the
A-9 position in the acyl moieties of palmitoyl-CoA
and stearoyl-CoA. From this type of desaturase
genes, the genes of Saccharomyces cerevisiae
(Stukey et al., 1990), rat (Thiede et al., 1986) and
mouse (Ntambi et al., 1988) have been cloned
and analysed. The protein sequences of the yeast
and rat desaturases contain 60% homology. The
predicted membrane topology for both proteins
including four membrane-spanning regions is very
similar. In this paper we report the cloning and
characterization of a A-9 desaturase gene of C.
curvatus.
MATERIALS AND METHODS
Growth media and yeast strains
The A-9 fatty acid desaturase gene was cloned
from a wild-type C. curvatus strain CBS 570. A A-9
desaturase mutant of C. curvatus (CBS 199.87) was
obtained from Ykema et al. (1989). Yeasts were
grown in Erlenmeyer flasks in a Gallenkamp
rotary shaker at 150 rpm at 30°C on YPD medium
(2% bacteriological peptone, 1% yeast extract, 2”/0
glucose) supplemented with the appropriate fatty
acids; oleic or petroselinic acid (obtained from
Merck or Sigma).
D N A manipulations and cloning of the A-9
desaturase gene
All recombinant DNA manipulations were performed according to standard methods (Sambrook
et al., 1989). Escherichia coli strains JM83 and
JM109 were used for cloning and amplification of
plasmids. Synthetic oligonucleotides were constructed based on homologous regions between the
A-9 desaturase genes of S. cerevisiae (Stukey et al.,
1990) and rat (Thiede et al., 1986), starting at
position 814 and 1370 from the OLE1 gene from
S. cerevisiae. Polymerase chain reaction (PCR)
using the oligonucleotides on genomic DNA of
C. curvatus resulted in a 550 bp fragment, which,
after sequencing, was used to screen an enriched
SacI genomic sublibrary. A 3.4 kb SacI fragment
containing 1.1 kb of the desaturase coding region
was obtained. By genomic walking, using the
600 bp SacI-KpnI fragment as a probe, the flanking part of the coding region of the A-9 desaturase
was isolated (Figure I).
D N A sequencing and analysis
Overlapping subclones from the 3.4 kb SacI
fragment were constructed using the Exonuclease
I11 kit (Pharmacia). For the 900 bp SphI-Sac1
fragment, synthetic sequence primers were constructed. Both strands were sequenced according
to the method of Sanger et al. (1977), using the
T7-polymerase sequencing kit (Pharmacia; Figure
1). The nucleotide and amino acid sequences were
analysed using DNASIS and PROSIS software
packages. The EMBL library (R.39.0, June 1994)
and SwissProt protein database (R.29.0, April
725
A-9 FATTY ACID DESATURASE GENE FROM C. CURVATUS
1994) were used for comparisons. Hydrophilicity
analysis was carried out according to the method
of Hopp and Woods (1981), using DNASIS.
To prove that the cloned fragments contained
the entire open reading frame (ORF), encoding the
A-9 desaturase, we performed an S, nuclease
mapping. Single-stranded DNA (ssDNA) was
made with lambda exonuclease (Pharmacia). The
lambda exonuclease specifically removes a phosphorylated strand, leaving the non-phosphorylated
strand intact. For S, nuclease mapping the noncoding strand is needed. The coding strand was
phosphorylated via phosphorylation of the T,
primer, which was, together with an internal
primer, used in a PCR reaction. This resulted in a
double-stranded DNA fragment from which the
coding strand was phosphorylated. After lambda
exonuclease treatment, the ssDNA was 5' endlabelled with polynucleotide kinase and [ Y - ~ ~ P ]
ATP. This fragment was hybridized with 20 pg
total RNA. The DNA-RNA hybrids were S,
treated and the product was analysed on a 4%
sequencing gel. Control hybridizations were
performed with E. coli-RNA.
Expression of the A-9 desaturase gene under
various growth conditions
C. curvatus cells were grown on YPD medium
and on YPD supplemented with oleic acid (10 mg/
ml; Merck) or petroselinic acid (10 mg/ml; Sigma),
solubilized with Brij 35 (polyoxyethylenlaurylether; Merck). Cells were washed, freeze dried
and used for RNA isolation. Total RNA (10 pg)
was loaded on a glyoxal-gel, which was blotted to
a Hybond' membrane and hybridized with a
32P-a-dCTP-labelledPCR fragment located in the
centre of the coding region of the desaturase gene.
Control hybridizations were performed with a
ribosomal probe. Autoradiograms were quantified
with the optical density scanning function of the
Bio-profil apparatus (Vilber Lourmat).
RESULTS
Molecular cloning of the A-9 fatty acid desaturase
gene of C. curvatus
Stukey et al. (1990) have shown that the A-9
desaturase genes of rat and S. cerevisiae share 60%
similarity in a 257 amino acid internal region.
Based on this similarity, we constructed two
primers located at amino acids 121 and 299,
respectively, of the C. curvatus gene (Figure 2).
C. curvatus
S.cerevisiae
Rat
C. curvatus
s. cerevisisae
Rat
C.curvatus
s . cerevisiae
Rat
C. curvatus
s. cerevisiae
Rat
C.curvatus
S . cerevisiae
Rat
C. curvatus
s. cerevisiae
Rat
C.
curva tus
s . cerevisiae
Rat
SQ?T?lX
AL IQQEQ
RIYRrCD
C. curva tus
S . cerevisiae
Rat
C. curvatus
S.cerevisiae
Rat
GSHKSS*
C. curvatus
S.cerevisiae
C.
curvatus
s . cerevisiae
Figure 2. Amino acid homology between A-9 fatty acid desaturases of C. curvatus, S. cerevisiae and rat. Identical amino
acid residues are aligned and depicted on a shadowed background. Numbers above the sequences correspond to positions
in the genes where homology starts and ends. Primers which are
used for PCR are indicated by arrows above the amino acid
sequence.
PCR with the two primers on genomic DNA of
C. curvatus CBS 570, yielded a DNA fragment
of approximately 550 bp, which was confirmed
to be homologous to the desaturase genes of
S. cerevisiae and rat.
Subsequently, an enriched genomic library of
C. curvatus, constructed in the SacI site of pGem5,
was screened for A-9 desaturase sequences, with
the non-radioactive digoxigenine-labelled PCR
fragment. A 3.4 kb SacI fragment was obtained.
Nucleotide sequence analysis revealed that the
3-4 kb SacI fragment contained only 1.1 kb of the
A-9 desaturase C-terminal coding region. In order
to clone the N-terminal part of the A-9 desaturase
protein, we used the 600 bp SacI-KpnI fragment as
a probe in a genome walking experiment. This way
a 1.5 kb SphI-KpnI fragment was obtained, carrying approximately 400 bp of the coding region of
the gene, forming the N-terminus. A full-length
726
P. A. E. P. MEESTERS AND G. EGGINK
-451
GCATGCAGCAGTAGTAGCGAGCGAGCAAGTAGAAGCGCGGCGGCGACATGGTA
-398
GAGTGGTGGATATGCAGTGCATAGCAAGGGCAAGATCCTGGATAGCCGGCG
-346
TAATACGGGCACAACTTCTCCAAA4AGTTW3ATGCCACCGCTCCTGCGCAT
-294
TATGGGTCGGGCGTGOOCGACATGATGCCCAGACTACTAAAAGAGCCATGCAC
-242
GCTGCGTCCTCTTCCTTCAGTCTCTTTTCTCTCAACTCCTCCTCGCCACCTCG
-190
ACCTCCTCCTCCTCCTCTCTACTCTACTCTTGTGCACGACTGSACGCCGCGCT
-13R
CAAGTARRCCCCCCGGCCACCAACAACCGCTAGACGGCTTATTTACCCCACAA
-
684
CTT GTT GCC GGC CTC GGC TGG GGA GAC TGG AAG GGT GGC CTG
L
V
A
G
L
G
W
G
D
W
K
G
G
L
726
CTT TTC GCT GGT GCC GCT CGC CTT GTT TTC GTC CAC CAC TCG
L
F
A
G
A
A
R
L
V
F
V
H
H
S
-86
GCAATCCGCCACACCCACCCCACTCCACCCTCCACCCCT
-34
GCGGACGATAGCACGTTTCCGCC ATG TCG GCT TCG ACT GCT ACA GCA
M
S
A
S
T
A
T
A
768
ACG TTC TGC GTC AAC TCG CTC GCC CAC TGG CTC GGT GAG ACT
T
F
C
V
N
S
L
A
H
W
L
G
E
T
12
CCA CCA GCA ACA GCT CCG GCT GTT GCC AAC CCT ACT CCT GCT
P
P
A
T
A
P
A
V
A
N
P
T
P
A
810
CCC TTT GAC AAC AAG CAC ACC CCC AAG GAC CAC TTT ATC ACT
P
F
D
N
K
H
T
P
K
D
H
F
I
T
54
GCT GCT TCT GCG GCG GCT GCT GCT CCA GCA GCC ACC AAG GAC
A
A
S
A
A
A
A
A
P
A
A
T
K
D
852
GCG CTT GTG ACC GTC GGC GAG GGC TAC CAC AAC TTC CAC CAC
A
L
V
T
V
G
E
G
Y
H
N
F
H
H
96
AAG GCA GAG ACC ATC GAC CCC GAA TCC GAG CAC TTT GTC GTC
K
A
E
T
I
D
P
E
S
E
H
F
V
V
894
CAG TTC CCC ATG GAC TTC CGC AAC GCC ATC AAG TGG TAC CAG
Q
F
P
M
D
F
R
N
A
I
K
W
Y
Q
138
TCC CAG AAC TAT GTC ACC CGC ACT GTG GAG AAC ATG ACA ATG
S
Q
N
Y
V
T
R
T
V
E
N
M
T
M
936
TAC GAC CCC ACC AAG TGG TTC ATC TGG ACC ATG TCC AAC GTC
Y
D
P
T
K
W
F
I
W
T
M
S
N
V
ieo
CTC CCT CCC GTC ACC TGG AGC AAC CTT CTG CAG AAC ATC CAG
L
P
P
V
T
W
S
N
L
L
Q
N
I
Q
978
GGC CTC GCC TCG CAC CTC AAG AAG TTC CCC GAC AAC GAG ATC
222
TGG ATT TCG TTC ACT GCG CTC ACT GTC CCC CCC GCC ATG GCC
W
I
S
F
T
A
L
T
V
P
P
A
M
A
1020
AAG AAG GGC CAG TAC ACC ATG AAG CTC CAG ATG CTC CAG GAA
K
K
G
Q
Y
T
M
K
L
Q
M
L
Q
E
264
ATC TAC GGC CTC TGC ACT CTC GAG CTC CAG CGC AAG ACT GTC
I
Y
G
L
C
T
L
E
L
Q
R
K
T
V
1062
CAG TCC GGC TCC ATC CAG TGG CCC AAG CAC AGC AAC GAC CTG
Q
S
G
S
I
Q
W
P
K
H
S
N
D
L
306
ATC TGG GCG ATC GTC TAC TAT TTC ATG ACC GGT CTC GGC ATT
I
W
A
I
V
Y
Y
F
M
T
G
L
G
I
1104
CCC GTT ATT TCT TGG GAG GAC TTC CAG GCC GAG GCC AAG GAG
P
V
I
S
W
E
D
F
Q
A
E
A
K
E
34s
ACT GCC GGC TAC CAC CGG CTC TOG GCT CAC CGC GCG TAC AAC
T
A
G
Y
H
R
L
W
A
H
R
A
Y
N
1146
CGC TCC CTT GTG GCT ATC CAC GGG TTC ATC CAC GAC TGC TCC
R
S
L
V
A
I
H
G
F
I
H
D
C
S
330
GCG TCC GCT CCC CT€ CAG TAC TTC CTC GCT CTG TGC GGC GCT
A
S
A
P
L
Q
Y
F
L
A
L
C
G
A
1188
AGC TTC CTC GAG GAC CAC CCG GGA GGC ATC CAC CTG ATC AAG
S
F
L
E
D
H
P
G
G
I
H
L
I
K
432
GGC TCC GTC CAG GGC TCC ATC AAG TGG TGG TCT CGC GGC CAC
1230
AAG GCC ATC GGC ACC GAC GCG ACC ACT GCC TTC TTT GGC GGT
K
A
L
G
T
D
A
T
T
A
F
F
G
G
GTG TAC GAC CAC TCG AAC GCC GCG CAC AAC CTT CTC GCC ATG
V
Y
D
H
S
N
A
A
H
N
L
L
A
M
G
S
V
Q
G
S
I
K
W
W
S
R
G
G
H
L
A
S
H
L
K
K
F
P
D
N
E
I
474
CGC GCG CAC CAC CGC TAC ACC GAC ACC AAG CTC GAC CCC TAC
R
A
H
H
R
Y
T
D
T
K
L
D
P
Y
1272
516
TCT GCG CAC GAG GGT TTC TGG TGG GCC CAC GTC GGA TGG ATG
S
A
H
E
G
F
W
W
A
H
V
G
W
M
1314
ATG CGT GTT GGT ATC CTC GAC GGC GGC ATG GAG GTC GAG TCC
M
R
V
G
I
L
D
G
G
M
E
V
E
S
558
CTC GTC AAG CCC CGC GGC AAG ATT GGC GTC GCC GAC ATT TCC
L
V
K
P
R
G
K
I
G
V
A
D
I
S
1356
CTC AAG CTC GAG AAC CTC CAG CGC TCC ATG TCT GTC TCG TCT
L
K
L
E
N
L
Q
R
S
M
S
V
S
S
600
GAC CTC AGC CGC AAC CCC GTC GTC AAG TGG CAG CAC AAC AAC
D
L
S
R
N
P
V
V
K
W
Q
H
N
N
1398
ATG GAG TCG GAC GCT GCG TCC TCT GCC TCG TCG GTT TCC GTG
M
E
S
D
A
A
S
S
A
S
S
V
S
V
1440
TCT TCC ATC TCT CCG AGG TGG CCG CAC TAGTGATATCCCG
S
S
I
S
P
R
W
P
H
'
642
TAT GTC ATG CTC ATG GTC CTC ATG GGT CTT GTC TTC CCC ACT
Y
V
M
L
M
V
L
M
G
L
V
F
P
T
Figure 3 . Nucleotide and deduced amino acid sequence of the A-9 fatty acid desaturase gene from C. curvutus
CBS 570. The consensus TATA sequence preceding the 1470 base long ORF is indicated by a line above the
sequence.
clone of the A-9 desaturase gene was constructed,
via ligation of the SphI-KpnI fragment to the
KpnI-Sac1 fragment. Sequence analysis revealed
the presence of one ORF, running from position 1
to position 1470 (Figure 3).
To verify that this fragment contained the entire
ORF, an S, nuclease mapping was performed.
The complementary strand was obtained via
h-exonuclease, end labelled and hybridized with
20 pg total RNA derived from a C. curvatus culture grown in YPD medium. The S, experiment
showed that the 4.3 kb fragment indeed contained
the entire coding region.
The putative translation site is the first ATG
after the TATA box indicated in Figure 3. The
4.3 kb fragment thus contains about 450 bp of
the promoter region. In the region upstream of the
transcription initiation site a sequence characteris-
tic for a promoter is present. The sequence
TATTTA found at - 93 resembles a TATA-box.
The sequence CCGCC preceding the ATG shares
homology with the known consensus sequence for
an eukaryotic translation initiation site: CCACC.
Translation of the ORF would produce a 493
amino acid residue protein with a calculated
molecular mass of 55 kDa. The coding region has
a high G + C content (60.9%), which is reflected in
the codon usage showing a strong preference for C
in the third base position (Table 1).
Comparison of the C. curvatus A-9 desaturase
gene with other desaturase genes
The deduced amino acid sequence of the A-9
desaturase was compared with all the sequences
in the SwissProt protein database (R.29.0, April
1994), using PROSIS software. A strong homology
727
A-9 FATTY ACID DESATURASE GENE FROM C. CURVATUS
Table 1. Codon usage in the desaturase gene of C. curvatus.
Phe
Phe
Leu
Leu
TTT
TTC
TTA
TTG
4
17
0
0
Ser
Ser
Ser
Ser
TCT
TCC
TCA
TCG
9
16
0
11
Tyr
Tyr
Leu
Leu
Leu
Leu
CTT
CTC
CTA
CTG
8
27
0
5
Pro
Pro
Pro
Pro
CCT
CCC
CCA
CCG
Ile
Ile
Ile
Met
ATT
ATC
ATA
ATG
5
18
0
18
Thr
Thr
Thr
Thr
Val
Val
Val
Val
GTT
GTC
GTA
GTG
6
22
0
5
Ala
Ala
Ala
Ala
***
***
TAT
TAC
TAA
TAG
3
12
Cys
Cys
1
Trp
TGT
TGC
TGA
TGG
3
16
3
4
His
His
Gln
Gln
CAT
CAC
CAA
CAG
0
26
0
16
Arg
Arg
Arg
Arg
CGT
CGC
CGA
CGG
ACT
ACC
ACA
ACG
12
14
3
1
Asn
Asn
Lys
Lys
AAT
AAC
AAA
AAG
0
19
0
23
Ser
Ser
Arg
Arg
AGT
AGC
AGA
AGG
0
4
0
1
GCT
GCC
GCA
GCG
18
19
4
12
Asp
Asp
Glu
Glu
GAT
GAC
GAA
GAG
0
20
2
16
Gly
Gly
Gly
Gly
GGT
GGC
GGA
GGG
8
22
3
1
with other known yeast-type desaturases was
found. When conservative amino acid substitutions (A/S/T/P/G, N/D/E/Q, H/R/K, M/L/I/V,
F/Y/W) are included, the aligned amino acid sequence shows 72% similarity with the S. cerevisiae
desaturase and 62% similarity with the rat desaturase. Homology starts for C. curvatus at amino
acid 112, for S. cerevisiae at amino acid 148 and
for rat at amino acid 106. An alignment of these
sequences is shown in Figure 2.
The nucleotide sequence was compared with the
EMBL library (R.39.0, June 1994). On the nucleic
acid level the cloned gene showed 53% homology
with the A-9 desaturase of S. cerevisiae and 48%
with both rat and mouse stearoyl-CoA desaturase
genes. Homology comprises 330 amino acids of the
coding region. Both the N- and C-terminal parts of
the desaturase show little homology. Hydrophilicity plots of the A-9 desaturases of C. curvatus, S.
cerevisiae and rat are also very similar (Figure 4),
suggesting a comparable secondary structure. All
three proteins contain two long hydrophobic
stretches at similar positions, which are long
enough to form a double transmembrane loop.
Stukey et al. (1990) presented a model for the
orientation of the yeast desaturase in the endoplasmic reticulum membrane. The hydrophilicity plot
for the A-9 desaturase of C. curvatus corresponds
well to the model proposed by Stukey et al. (1990).
In addition to homology to other known desaturases, the SwissProt comparisons revealed a
0
***
0
4
0
19
1
12
0
1
striking homology to a number of nitrate reductase
and cytochrome b, proteins at the carboxylterminal part of the desaturase protein. Starting at
amino acid 380 and ending at amino acid 454,
there is 40% homology to a 74 amino acid stretch
of the nitrate reductase 1 of tobacco and 33%
homology to a 74 amino acid stretch of cytochrome b, of horse (Figure 5). This domain is
supposed to play a role in heme binding of proteins
belonging to the cytochrome b, superfamily
(Crawford et al., 1988; Daniel-Vedele et al., 1989).
Expression of the A-9 desaturase gene
The effect of exogenous fatty acids on the expression of the A-9 desaturase gene of C. curvatus
was examined. Total RNA was extracted and
analysed on Northern blot using the initial 550 bp
PCR fragment of the cloned A-9 desaturases gene
as a probe (Figure 6). The hybridization signal is
depicted by an arrow. Lane 1 shows RNA derived
from cells grown in the absence of fatty acid
(control). Lane 2 contains RNA of cells grown
in the presence of oleic acid in the growth medium.
In this case expression of the gene is strongly
repressed. Quantification, corrected for the total
amount of RNA determined by hybridization with
a ribosomal probe, revealed that expression of the
8-9 desaturase gene is approximately 90% reduced.
In contrast, the presence of petroselinic acid shown
in Figure 6 lane 3, has no effect on the expression
of the desaturase gene.
728
P. A. E. P . MEESTERS AND G. EGGINK
-‘1
c_1
Desaturase of cryptococcus curvatus
’ Nitrate reductase of Tobacco
’ Cytochrome b, of horse
l&X
Figure 5 Ammo acid sequence comparison between the A-9
desaturase gene of C curvatur, the nitrate reductase 1 of
tobacco and the horse cytochrome b, Identical ammo acids are
depicted on a shadowed background The numbers above the
A-9 desaturase gene correspond to the position in the gene
3
B
2
1
0
I
0
120
240
360
600
480
-
1
2
3
Index
3 1
C
0
120
240
360
480
6W
Figure 4. Hydrophilicity plots of A-9 desaturase of C.
curvatus, S. cerevisiue and rat. Hydrophilicity profiles of the A-9
fatty acid desaturase proteins were analysed according to Hopp
and Woods (1981). This method depicts hydrophobic parts
below the y-axis and hydrophilic parts above. (A) Plot of C.
curvatus. (B) S. cerevisiae and (C) rat. Presumed membranespanning regions are indicated by lines under the graphs.
DISCUSSION
Characteristics of the C. curvatus A-9 fatty acid
desaturase gene
In this report we describe the cloning of a gene
encoding a A-9 fatty acid desaturase of C. curvatus.
Both sequencing analysis and expression studies
have confirmed the identification of the gene product as the A-9 fatty acid desaturase. The enzyme is
responsible for desaturation of C16:O and C18:O to
C16:l(c9) and Cl8:l(c9) fatty acids respectively.
In C. curvatus oleic acid can successively be desaturated to linoleic acid and a-linoleic acid. In
the synthesis of these fatty acids the A-9 desaturation is the first step. C. curvatus membranes
consist merely of unsaturated C18 fatty acids
Figure 6 . Northern blot of total RNA from C. curvatus grown
in the presence of oleic and petroselinic acid hybridized with a
A-9 desaturase probe. Total RNA (10 pg) from cells grown in
the presence of exogenous fatty acids; lane 1, YPD (control);
lane 2, YPD+oleic acid; lane 3 , YPD+petroselinic acid, was
hybridized with a radioactive labelled A-9 desaturase probe and
exposed for 24 h. The hybridization signal is indicated with an
arrow.
(unpublished data). Therefore it is to be expected
that in the absence of unsaturated fatty acids in the
growth medium, the A-9 desaturase gene is highly
expressed.
Comparison of genes cloned from different
yeasts have shown that differences in expression
levels are reflected in codon usage. Highly expressed genes generally have a high G + C content
and prefer a C at the third position of codons
(Sharp et al., 1986). The gene described in this
study has a G + C content of 60.9% and shows
a strong preference for C in the third position
of codons, as shown in Table 1. These characteristics indicate that the desaturase gene is highly
expressed.
The cloned desaturase gene contains transcription and translation signals normally found in
yeasts. A sequence resembling a TATA-box is
729
A-9 FATTY ACID DESATURASE GENE FROM C. CURVATUS
-
usually present 30 bp adjacent to the transcription initiation site. The TATTTA found at - 93 is
also present in other genes, for instance in genes
from Aspergillus nidulans or Neurospora crassa
(Gurr et al., 1987). In general in eukaryotes there is
a consensus sequence around the translation initiation site consisting of C C A C C B G C (Kozak,
1984). The - 3 position is always an A or G with
a preference for A. The sequence of the cloned
desaturase gene; C C G C C D T C strongly resembles this Kozak consensus sequence, which is
supposed to play a role in ribosome binding.
Influence of exogenousjatty acids on the
expression of the A-9 desaturase gene
The presence of long-chain fatty acids in the
growth medium can have a strong influence on
the expression of the desaturase gene. For S.
cerevisiae, it has been shown that mono- and
polyunsaturated fatty acids have an effect on the
expression of O L E l , the A-9 desaturase gene from
S. cerevisiae (McDonough et ul., 1992). Fatty acids
containing a double bond at the A-9 position were
strong repressors, while fatty acids containing
double bonds at the A-10, A-11 and A-5 positions
showed no repression of desaturase expression. A
similar effect on the expression of the desaturase
gene was found for C. curvatus. Oleic acid supplemented to the growth medium is directly incorporated into the membrane lipids and repressing
de novo synthesis of oleic acid. Expression of the
A-9 desaturase gene was ten-fold repressed when
the growth medium contained oleic acid. This
indicates that there is regulation at the transcription level. Addition of petroselinic acid did not
affect expression of the desaturase gene. Presumably petroselinic acid cannot replace oleic acid in
the membranes of the yeast, so synthesis of oleic
acid is still needed. This assumption is corroborated by our observation that supplementation of the medium with petroselinic acid instead
of oleic acid does not result in growth of the A-9
fatty acid desaturase mutant of C. curvatus (results
n ot shown) .
Similarity of the C. curvatus A-9 desaturase gene
with other genes
The desaturase genes from rat, C. curvatus and
S. cerevisiae show strong sequence similarity in the
internal region. The desaturase genes from the two
yeasts are about the same length, while the rat gene
is approximately 400 bp shorter. The patterns of
the hydrophilicity plots of the three desaturase
genes are also suggesting a comparable secondary
structure. The hydrophobic segments may form
membrane-spanning regions as predicted for the
S. cerevisiae OLEl gene (Stukey et al., 1990). In
the carboxy-terminal part a domain is found with
high homology to nitrate reductase and cytochrome b, proteins. In these proteins this domain
is supposed to play a role in the binding of heme.
Like the nitrate reductases, the yeast-type desaturase is also part of a three-component enzyme
system. A cytochrome b, and an NADHdependent cytochrome b, reductase are involved in
all these membrane-bound systems.
No clear homology was found in the N-terminal
parts of the three desaturase genes. Despite this,
Stukey and coworkers were able to exchange the
coding regions from S. cerevisiae and rat, which
resulted in a functional expression of the rat gene
in an S. cerevisiae A-9 desaturase mutant (Stukey
et al., 1990). A-9 Desaturase genes cloned from
plants and cyanobacteria, which are soluble proteins, occurring in the cytosol, do not share any
homology with the yeast desaturases. Interestingly,
Polashock and coworkers (1992) succeeded in obtaining functional expression of the S. cerevisiae
OLE1 gene in Nicotiana tabacum. OLEl mRNAs
were detected as well as C16:l(c9), a fatty acid
normally not present in tobacco. The functional
exchange of desaturase genes from totally different
origins is an important step towards the production of special fatty acids in for instance oilseeds or
lipid-accumulating yeasts. There is an increasing
industrial demand for tailor-made lipids for both
food and non-food applications. The oleaginous
yeast C. curvatus, growing on cheap carbon
sources like whey permeate, could become the lipid
production organism of choice, provided that a
transformation and expression system is available.
Currently we are developing these genetic tools
using the A-9 desaturase gene described in this
study and the A-9 desaturase mutant obtained by
Ykema et al. (1989).
REFERENCES
Crawford, N. M., Smith, M., Bellissimo, D. and Davis,
R. W. (1988). Sequence and nitrate regulation of
the Arabidopsis thulium mRNA encoding nitrate reductase, a metalloflavoprotein with three functional
domains. Proc. Nutl. Acad. Sci. USA 85, 5006-5010.
Daniel-Vedele, F., Dorbe, M.-F., Caboche, M. and
Rouze, P. (1989). Cloning and analysis of the tomato
nitrate reductase encoding gene: protein domain
730
structure and amino acid homologies in higher plants.
Gene 85, 371-380.
Davies, R. J. (1988). Yeast oil from cheese whey: process
development. In Moreton, R. S. (Ed.), Single Cell Oil.
Longman Scientific & Technical, London, pp. 99-145.
Gurr, S. J., Unkles, S. E. and Kinghorn, J. R. (1987).
The structure and organization of nuclear genes of
filamentous fungi. In Kinghorn, J. R. (Ed.), Gene
Structure in Eukaryotic Microbes. IRL Press, Oxford,
Washington DC, pp. 93-139.
Hopp, T. P. and Woods, K. R. (1981). Prediction of
protein antigenic determinants from amino acid sequences. Proc. Natl. Acad. Sci. USA 78, 3824-3828.
Kozak, M. (1984). Compilation and analysis of sequences upstream from the translational start site in
eukaryotic mRNA’s. Nucl. Acids Res. 12, 857-873.
McDonough, V. M., Stukey, J. E. and Martin, C. E.
(1 992). Specificity of unsaturated fatty acid regulated
expression of the Saccharomyces cerevisiae OLEl
gene. J. Biol. Chem. 267, 5931-5936.
Moon, N. J., Hammond, E. G. and Glatz, B. A. (1978).
Conversion of cheese whey and whey permeate to oil
and single cell protein. J. Dairy Sci. 61, 1537-1547.
Ntambi, J. M., Buhrow, S. A,, Kaestner, K. H., et al.
(1 988). Differentiation induced gene expression in
3T3-Ll preadipocytes. Characterization of a differentially expressed gene encoding stearoyl-CoA desaturase. J. Biol. Chem. 263, 17291-17300.
Polashock, J. J., Chin, C.-K. and Martin, C. E. (1992).
Expression of the yeast A-9 fatty acid desaturase in
Nicotiana tabacum. Plant Physiol. 100, 894-901.
Ratledge, C. (1991). Microorganisms for lipids. Acta
Biotechnol. 11, 429438.
P. A. E. P. MEESTERS AND G. EGGINK
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989).
Molecular Cloning: A Laboratory Manual. Cold
Spring Harbor Press, Cold Spring Harbor, NY.
Sanger, F., Nicklen, S. and Coulson, A. R. (1977). DNA
sequencing with chain terminating inhibitors. Proc.
Natl. Acad. Sci. USA 74, 5463-5467.
Sharp, P. M., Tuohy, T. M. F. and Mosurski, K. R.
(1986). Codon usage in yeast: cluster analysis clearly
differentiates highly and lowly expressed genes. Nucl.
Acids Res. 14, 5125-5143.
Stukey, J. E., McDonough, V. M. and Martin, C. E.
(1990). The OLEl gene of Saccharomyces cerevisiae
encodes the A-9 fatty acid desaturase and can be
functionally replaced by the rat stearoyl-CoA
desaturase gene. J. Biol. Chem. 265, 2014&20149.
Thiede, M. A,, Ozols, J. and Strittmatter, P. (1986).
Construction and sequence of cDNA for rat liver
stearyl coenzyme A desaturase. J. Biol. Chem. 261,
13230-1 3235.
Ykema, A. (1989). Lipid production in the oleaginous yeast Apiotrichum curvatum. Ph.D. thesis. Free
University Amsterdam, The Netherlands.
Ykema, A., Verbree, E. C., Nijkamp, H. J. J. and Smit,
H. (1989). Isolation and characterization of fatty
acid auxotrophs from the oleaginous yeast Apiotrichum curvatum. Appl. Microbiol. Biotechnol. 32,
76-84.
Ykema, A., Verbree, E. C., Venvoert, I. I. G. S., Van der
Linden, K. H., Nijkamp, H. J. J. and Smit, H. (1990).
Lipid production of revertants of Ufa mutants from
the oleaginous yeast Apiotrichum curvatum. Appl.
Microbiol. Biotechnol. 33, 176-182.
Документ
Категория
Без категории
Просмотров
6
Размер файла
682 Кб
Теги
thecandida, dimorphic, homology, encoded, necessary, protein, genes, albicans, cellular, pkc1, integrity, kinases
1/--страниц
Пожаловаться на содержимое документа