close

Вход

Забыли?

вход по аккаунту

?

GJB2 (connexin 26) mutations are not a major cause of hearing loss in the Indonesian population.

код для вставкиСкачать
American Journal of Medical Genetics 135A:126 –129 (2005)
GJB2 (Connexin 26) Mutations Are Not a Major
Cause of Hearing Loss in the Indonesian Population
Rikkert L. Snoeckx,1 Bulantrisna Djelantik,2 Lut Van Laer,1 Paul Van de Heyning,3 and Guy Van Camp1*
1
Department of Medical Genetics, University of Antwerp, Universiteitsplein, Antwerp, Belgium
Department of ENT, Padjadjaran University Medical School, Bandung, Indonesia
3
Department of ENT, University Hospital of Antwerp (UZA), Antwerp, Belgium
2
Although hereditary hearing loss is a very heterogeneous disorder, variants in one gene, GJB2
(connexin 26), account for up to 50% of autosomal
recessive nonsyndromal sensorineural hearing
loss in most populations. This study investigates
the contribution of GJB2 to autosomal recessive
nonsyndromal hearing loss in the Indonesian
population. We performed DNA sequence analysis
in 120 patients with profound early childhood
nonsyndromal hearing loss and in 100 control
individuals and identified three novel variations
resulting in amino acid substitutions (p.Gly4Asp,
p.Thr5Ala, and p.Gly160Arg). Although we proved
that p.Gly4Asp was not disease-causing, the
pathological nature of p.Thr5Ala and p.Gly160Arg
could not be determined. No recurrent diseasecausing mutation could be detected in this Indonesian population. These findings are in contrast
with the results obtained in other populations
where GJB2 is a major cause of congenital
recessive hearing loss. ß 2005 Wiley-Liss, Inc.
KEY WORDS: hearing loss; gap junction beta-2
(GJB2); Indonesia
INTRODUCTION
Congenital severe-to-profound hearing loss affects 1 in 650
newborn infants [Mehl and Thomson, 2002]. In 50% of these
children, the hearing loss is due to genetic factors [Marazita
et al., 1993], with autosomal recessive inheritance representing approximately 80% of this total. Although 53 recessive
genes have been localized up to now [Hereditary hearing loss
homepage] a large proportion of recessive severe-to-profound
hearing loss is caused by mutations in a single gene, GJB2
[Kelsell et al., 1997; Gasparini et al., 2000]. In addition,
mutations in GJB2 are responsible for autosomal dominant
hearing loss, albeit at a much lower frequency [Denoyelle et al.,
1997].
GJB2 encodes the protein connexin 26, which is presumed to
be a component of the gap junction pathway for potassium
recycling in the inner ear. Loss or malfunction of these gap
Grant sponsor: University of Antwerp; Grant sponsor: Vlaams
Fonds voor Wetenschappelijk Onderzoek (FWO) (to GVC).
*Correspondence to: Guy Van Camp, Department of Medical
Genetics, University of Antwerp, Universiteitsplein 1, B-2610
Antwerp, Belgium. E-mail: guy.vancamp@ua.ac.be
Received 30 July 2004; Accepted 2 February 2005
DOI 10.1002/ajmg.a.30726
ß 2005 Wiley-Liss, Inc.
junctions, as reflected by mutations in GJB2, may disrupt the
potassium flow from the hair cells through the supporting cell
network back to the endolymph, consequently leading to
hearing loss [Spicer and Schulte, 2002]. The resulting hearing
loss involves all frequencies, is of variable severity (from mild
to profound) even within sibships, rarely progresses, and is
symmetrical between two ears in most cases [Cohn and Kelley,
1999; Denoyelle et al., 1999; Murgia et al., 1999]. To date, 48
recessive and 7 dominant disease causing GJB2 mutations
have been identified [Connexin-deafness homepage]. One
mutation, causing the deletion of one guanosine residue from
a stretch of 6 between nucleotide positions 30 and 35 (c.35delG)
resulting in a frame shift, is the most common autosomal
recessive hearing loss-causing allele variant of GJB2 in the
Caucasian population [Denoyelle et al., 1997; Zelante et al.,
1997; Estivill et al., 1998; Kelley et al., 1998; Lench et al., 1998;
Rabionet et al., 2000a].
In non-Caucasian populations, c.35delG is rare, but sometimes other frequent mutations are present. These include the
c.235delC mutation in Japanese and Koreans [Abe et al., 2000;
Kudo et al., 2000; Park et al., 2000], c.167delT in Ashkenazi
Jews [Morell et al., 1998; Sobe et al., 1999], and p.Arg143Trp in
a village in Eastern Ghana [Brobby et al., 1998]. For three of
the recurrent mutations (c.167delT, c.35delG, and c.235delC),
it has been shown that the mutation is derived from a common
founder [Morell et al., 1998; Van Laer et al., 2001; Ohtsuka
et al., 2003]. A deletion truncating the GJB6 gene (connexin 30)
near the GJB2 gene on 13q12, is the accompanying mutation in
50% of deaf GJB2 heterozygotes in Spain [del Castillo et al.,
2002]. This mutation, g.1777179_2085947del (hereafter called
del(GJB6-D13S1830); GenBank NT_024524.13), is present in
many countries with the highest prevalence in France, Spain,
and Israel [Del Castillo et al., 2003]. It is unclear why GJB2
mutations are a frequent cause of autosomal recessive hearing
loss in many ethnically diverse populations while this condition can be caused by over 50 different genes. Nevertheless, it is
clear that GJB2 mutations are a major cause of hearing loss in
most of the populations that have hitherto been studied.
Currently, not much is known about the prevalence of
recessive hearing loss in Indonesia. One study reported an
isolated village in Bali, Benkala, where 2.2% of the people have
profound congenital hearing loss [Friedman et al., 1995]. The
nonsyndromal hearing loss in Benkala is inherited in a
recessive way and is caused by a mutation in the MYO15 gene
[Wang et al., 1998]. In this study, we analyzed the GJB2 coding
region for mutations in 120 Indonesian hearing-impaired
individuals from West Java. We conclude that GJB2 is not a
common cause of early childhood, profound sensorineural
hearing loss in Indonesia.
MATERIALS AND METHODS
A group of 120 unrelated patients with profound nonsyndromal early childhood hearing loss was included in the
present study. All patients were below the age of 20 and were
GJB2 Screening in Indonesia
members of the Cicendo School for the Deaf in Bandung, the
capital of West Java, in Indonesia. The clinical history of each
patient was explored to ensure that the hearing loss was not a
result of acquired environmental factors like infection,
trauma, acoustic trauma or ototoxic drugs. All patients were
investigated through a physical and otological examination by
an ENT specialist for the presence of other symptoms that
could point to a syndromal form of hearing loss, including
diabetes, vision problems, neurological disorders, and skin
disorders. Patients with possible syndromal or acquired
hearing loss were excluded from the analysis. Cheek epithelial
cells were collected with buccal swabs and DNA isolation was
as described by Richards et al. [1993]. A total of 100 adult
Indonesian persons with normal hearing served as a control
group. These persons had no family history suggestive of
hearing or speech problems. DNA from all control persons was
extracted from 10 ml of blood using standard procedures.
The coding region of the GJB2 gene was amplified using
primer pair Cx26F (50 -TCTTTTCCAGAGCAAACCGC-30 )/
Cx26R (50 -GGGCAATGCGTTAAACTGGC-30 ) in all patients
and controls. The PCR product was enzymatically purified
and sequenced with primers Cx26F, Cx26R, Cx26seqi1 (50
CTCATGTCTCCGGTAGGCCAC 30 ), and Cx26seqi2 (50 GCAGCATCTTCTTCCGGGT 30 ) using the Thermo Sequenase
cycle sequencing kit (Amersham Pharmacia Biotech, Uppsala,
Sweden) following the manufacturer0 s instructions. Sequences
were analyzed on an ABI 3100 DNA sequencer and compared
with the GJB2 sequence from genbank (NM_004004). The
presence of the del(GJB6-D13S1830) mutation was investigated as described by del Castillo et al. [2002].
RESULTS AND DISCUSSION
In this study, we analyzed the coding region of the GJB2
gene in 120 unrelated Indonesian individuals with early
childhood, profound nonsyndromal sensorineural hearing loss
and 100 control persons. Additionally, we screened for the
presence of the del(GJB6-D13S1830) mutation. Nine different
amino acid substitutions in the GJB2 coding region were
identified, of whom six were previously described. All detected
GJB2 variations are summarized in Table I. Evolutionary
conservation of the amino acid variants found in the Indonesian population was analyzed by ConSeq, a web server for the
identification of structurally and functionally important
residues in protein sequences. Conservation scores calculated
by ConSeq are a relative measure of evolutionary conservation
127
at each sequence site of the query sequence. These scores were
converted into a conservation scale ranging from 1 (variable) to
9 (highly conserved).
Three previously described missense mutations were identified, but only in a heterozygous state (Table I). Four patients
and three control persons each carried one allele of p.Val37Ile.
The other previously described recessive mutation p.Arg32His
was found in a heterozygous state in one patient and one
control person. The p.Val153Ile mutation was also present in a
heterozygous state in 1 patient, but was not present in the
control population. Since the initial report of the p.Val37Ile
mutation [Kelley et al., 1998], the disease-causing nature of
this mutation has been a matter of debate. Several studies have
concluded that this amino acid substitution is a polymorphism
because it was found in a heterozygous state in the control
population as well as in the patient population with an equal
frequency of approximately 2% [Kelley et al., 1998; Kudo et al.,
2000]. On the other hand, homozygosity for p.Val37Ile and
compound heterozygosity for p.Val37Ile have often been
described in patients with nonsyndromal sensorineural hearing loss, suggesting that p.Val37Ile acts as a recessive
mutation [Kenna et al., 2001; Bason et al., 2002; Liu et al.,
2002]. Recent studies clearly indicated the pathogenicity of
p.Val37Ile when associated with another mutated GJB2 allele
[Abe et al., 2000; Wilcox et al., 2000; Rabionet et al., 2000b;
Kenna et al., 2001]. Additionally, functional analyses demonstrated that p.Val37Ile-containing GJB2 is not functional and
thus the p.Val37Ile variant may be pathologically significant
[Bruzzone et al., 2003].
Two previously described common polymorphisms in the
Japanese population, p.Val27Ile, p.Glu114Gly, were also
detected in Indonesian patients and controls, although the
frequencies were significantly lower when compared to those
found in Japan [Abe et al., 2000]. Additionally, functional
studies showed no significant difference between gating
properties in p.Glu114Gly-containing GJB2 and WT GJB2
transfected cells [Choung et al., 2002]. The p.Ile203Thr
substitution was not found in Indonesian control persons, but
the frequency was high in Japanese control persons, indicating
the polymorphic nature of the variants.
Finally we identified three novel variants, p.Gly4Asp,
p.Thr5Ala, and p.Gly160Arg. The pathogenic nature of
p.Thr5Ala and p.Gly160Arg could not be determined because
they were not detected in controls. The threonine residue on
position 5 has a ConSeq score of 1, indicating that this is a very
variable position in the GJB2 gene. It would therefore be very
TABLE I. Summary of All GJB2 Variants in Indonesian Subjects
Amino acid
substitution
ConSeq
conservation
score
Known polymorphisms
p.Val27Ile
p.Glu114Gly
p.Ile203Thr
Known mutations
pArg32His
p.Val37Ile
p.Val153Ile
Novel variants
p.Gly4Asp
p.Thr5Ala
p.Gly160Arg
DNA substitution
Protein domain
Frequency
in patient
chromosomes
Frequency
in control
chromosomes
9
1
8
c.79G > A
c.341A > G
c.790T > C
TM1
IC2
TM4
7/240
3/240
1/240
7/200
5/200
0/200
Kelley et al. [1998]
Abe et al. [2000]
Kudo et al. [2000]
9
8
4
c.95G > A
c.109G > A
c.457G > A
IC1
TM1
TM3
1/240
4/240
1/240
1/200
3/200
0/200
Mustapha et al. [1998]
Kelley et al. [1998]
Marlin et al. [2001]
4
1
7
c.9G > A
c.12A > C
c.468G > C
IC1
IC1
EC2
12/240
2/240
1/240
20/200
0/200
0/200
References
This study
This study
This study
Three previously published recessive mutations (p.Arg32His, p.Val37Ile, p.Val153Ile) were detected but only in a heterozygous state, in addition to three
previously described polymorphisms (p.Val27Ile, p.Glu114Gly, and p.Ile203Thr). Whether the p.Gly160Arg variant and the p.Thr5Ala variant was disease
causing could not be determined. The new polymorphism p.Gly4Asp is very frequent in Indonesia. ConSeq conservation scores vary from 1 (variable) to 9
(highly conserved).
128
Snoeckx et al.
unlikely that this amino acid change is a possible cause of
hearing loss.
The p.Gly160Arg substitution in the second extracellular
domain is found in one patient without skin abnormalities, in a
single heterozygous state. However, most previously described
dominant mutations cause additional skin abnormalities and
are clustered in the first extracellular domain. Additionally, in
1998, the p.Gly160Ser variation was reported as a polymorphism, as it was found in 2% of controls [Scott et al., 1998]. For
these reasons, it is plausible to assume that the p.Gly160Arg
variation is also a polymorphism. The most frequent variation
in Indonesia is p.Gly4Asp, with an allele frequency of about 7%.
Given the fact that the glycine residue on this position has a
rather low ConSeq score of 4, and that both homozygous and
heterozygous states of the variation were found in controls,
we may conclude that this variation has no pathological
consequences.
It was not surprising that the c.35delG mutation was not
present in the Indonesian population, as in most nonCaucasian populations this mutation is absent or very rare.
Furthermore, the c.167delT and the del(GJB6-D13S1830)
mutations were absent. Even the c.235delC mutation, which
is frequent in the Japanese and Koreans [Abe et al., 2000; Kudo
et al., 2000; Park et al., 2000], could not be detected.
The major finding of this study is the low frequency of
disease-causing GJB2 mutations in Indonesia. Although other
studies have reported a low prevalence of GJB2 mutations in
some populations [Simsek et al., 2001; Najmabadi et al., 2002],
it contrasts with studies in many other countries where
mutations in the GJB2 gene were a major cause of hearing
loss.
Currently, it is unclear why some populations are characterized by recurrent GJB2 mutations, and others are not.
The presence of frequent mutations might be due a heterozygote advantage. A founder mutation can confer a selective
advantage by increasing the fitness of its carrier and this would
foster its spread through a population. A heterozygote
advantage has been proposed for GJB2. Some supporting
evidence has been obtained for one specific mutation,
p.Arg143Trp [Meyer et al., 2002]. Heterozygote carriers of
this mutation are hypothesized to be more resistant to
microbial colonization and to the invasion of pathogens of the
skin due to a significant thicker epidermis and a higher sodium
and chloride concentration in their sweat.
Recently a new hypothesis to explain the high frequency of
connexin 26 hearing loss in some populations was reported by
Nance and Kearsey [2004]. These authors state that two of the
reasons why connexin hearing loss may be prevalent in so
many large populations are relaxed selection and assortative
mating. A low frequency of connexin hearing loss could be due
to the reduced fitness of hearing impaired people in these
countries. For example, Mongolia has only one residential
school for the deaf, and sign language was not introduced until
1995. Moreover, assortative mating is much less frequent than
in Western countries because the fitness of the deaf is still
regarded to be much lower than that of hearing sibs. In this
population, connexin mutations account for only 1.3% of all
deafness [Konig et al., 2001]. Additionally, in Asian populations there is no strong tradition of intermarriages among
hearing impaired persons. In India, where many marriages are
still arranged by parents, marriages between two deaf people
were virtually unheard of in the past. In Indonesia, the fitness
of the hearing impaired people is also much lower when
compared to those in many other countries. Hearing loss is
often seen as a matter of fate, and little empathy is shown for
people with disabilities for which nothing can be done.
Hearing-impaired individuals are generally not considered
valuable members of their community, and many remain
housebound, uneducated and unskilled. Although their
situation has improved during the last decades, this is still
common in Indonesia, especially in rural areas.
However, in exceptional cases deafness is perceived as a form
of naturally occurring diversity and not as a handicap. For
example, in the Balinese village Benkala, hereditary hearing
loss is common, and both hearing and hearing-impaired
members of the community regularly use an ethnic sign
language to communicate [Friedman et al., 1995]. In this very
isolated village, gene drift and consanguinity led to a high
frequency of a mutation in another recessive gene for hearing
loss, MYO15. The frequency of this mutation could be
influenced by the combined effects of relaxed selection and
the nonrandom mating in this population [Nance and Kearsey,
2004].
In this study, we have shown a low prevalence of GJB2
mutations in Indonesia. This may be the consequence of
several factors including the presence of another recurrent
mutated deafness gene, geographical isolation in combination
with social stigmatization leading to reduced fitness and
absence of assortative mating, and specific environmental
factors that may reduce heterozygote advantage.
ELECTRONIC DATABASE INFORMATION
The URLs for this article are as follows:
Hereditary hearing loss homepage: http://webhost.ua.ac.
be/hhh
Connexin-deafness homepage: http://davinci.crg.es/deafness
ConSeq web server: http://conseq.bioinfo.tau.ac.il
ACKNOWLEDGMENTS
The authors are thankful to all individuals for their
collaboration in this study. RLS holds a predoctoral research
position with the Instituut voor de aanmoediging van Innovatie voor Wetenschap en Technologie in Vlaanderen (IWTVlaanderen). LVL holds a postdoctoral research position with
the FWO. This research was performed in the framework of the
Interuniversity Attraction Poles programme P5/19 of the
Belgian Federal Science Policy, Belgium.
REFERENCES
Abe S, Usami S, Shinkawa H, Kelley PM, Kimberling WJ. 2000. Prevalent
connexin 26 gene (GJB2) mutations in Japanese. J Med Genet 37:41–43.
Bason L, Dudley T, Lewis K, Shah U, Potsic W, Ferraris A, Fortina P,
Rappaport E, Krantz ID. 2002. Homozygosity for the V37I Connexin 26
mutation in three unrelated children with sensorineural hearing loss.
Clin Genet 61:459–464.
Brobby GW, Muller-Myhsok B, Horstmann RD. 1998. Connexin 26 R143W
mutation associated with recessive nonsyndromic sensorineural deafness in Africa. N Engl J Med 338:548–550.
Bruzzone R, Veronesi V, Gomes D, Bicego M, Duval N, Marlin S, Petit C,
D'Andrea P, White TW. 2003. Loss-of-function and residual
channel activity of connexin26 mutations associated with non-syndromic deafness. FEBS Lett 533:79–88.
Choung YH, Moon SK, Park HJ. 2002. Functional study of GJB2 in
hereditary hearing loss. Laryngoscope 112:1667–1671.
Cohn ES, Kelley PM. 1999. Clinical phenotype and mutations in connexin 26
(DFNB1/GJB2), the most common cause of childhood hearing loss. Am J
Med Genet 89:130–136.
Del Castillo I, Moreno-Pelayo MA, Del Castillo FJ, Brownstein Z, Marlin S,
Adina Q, Cockburn DJ, Pandya A, Siemering KR, Chamberlin GP,
Ballana E, Wuyts W, Maciel-Guerra AT, Alvarez A, Villamar M, Shohat
M, Abeliovich D, Dahl HH, Estivill X, Gasparini P, Hutchin T, Nance
WE, Sartorato EL, Smith RJ, Van Camp G, Avraham KB, Petit C,
Moreno F. 2003. Prevalence and evolutionary origins of the del(GJB6D13S1830) mutation in the DFNB1 locus in hearing-impaired subjects:
A multicenter study. Am J Hum Genet 73:1452–1458.
del Castillo I, Villamar M, Moreno-Pelayo MA, del Castillo FJ, Alvarez A,
Telleria D, Menendez I, Moreno F. 2002. A deletion involving the
GJB2 Screening in Indonesia
connexin 30 gene in nonsyndromic hearing impairment. N Engl J Med
346:243–249.
Denoyelle F, Marlin S, Weil D, Moatti L, Chauvin P, Garabedian EN, Petit C.
1999. Clinical features of the prevalent form of childhood deafness,
DFNB1, due to a connexin-26 gene defect: Implications for genetic
counselling. Lancet 353:1298–1303.
Denoyelle F, Weil D, Maw MA, Wilcox SA, Lench NJ, Allen-Powell DR,
Osborn AH, Dahl HH, Middleton A, Houseman MJ, Dode C, Marlin S,
Boulila-ElGaied A, Grati M, Ayadi H, BenArab S, Bitoun P, LinaGranade G, Godet J, Mustapha M, Loiselet J, El-Zir E, Aubois A,
Joannard A, Petit C. 1997. Prelingual deafness: High prevalence of a
30delG mutation in the connexin 26 gene. Hum Mol Genet 6:2173–2177.
Estivill X, Fortina P, Surrey S, Rabionet R, Melchionda S, D'Agruma
L, Mansfield E, Rappaport E, Govea N, Mila M, Zelante L, Gasparini P.
1998. Connexin-26 mutations in sporadic and inherited sensorineural
deafness. Lancet 351:394–398.
Friedman TB, Liang Y, Weber JL, Hinnant JT, Barber TD, Winata S, Arhya
IN, Asher JH Jr. 1995. A gene for congenital, recessive deafness DFNB3
maps to the pericentromeric region of chromosome 17. Nat Genet 9:
86–91.
Gasparini P, Rabionet R, Barbujani G, Melchionda S, Petersen M, BrondumNielsen K, Metspalu A, Oitmaa E, Pisano M, Fortina P, Zelante L,
Estivill X. 2000. High carrier frequency of the 35delG deafness mutation
in European populations. Genetic Analysis Consortium of GJB2 35delG.
Eur J Hum Genet 8:19–23.
Kelley PM, Harris DJ, Comer BC, Askew JW, Fowler T, Smith SD,
Kimberling WJ. 1998. Novel mutations in the connexin 26 gene
(GJB2) that cause autosomal recessive (DFNB1) hearing loss. Am J
Hum Genet 62:792–799.
Kelsell DP, Dunlop J, Stevens HP, Lench NJ, Liang JN, Parry G, Mueller
RF, Leigh IM. 1997. Connexin 26 mutations in hereditary nonsyndromic sensorineural deafness. Nature 387:80–83.
Kenna MA, Wu BL, Cotanche DA, Korf BR, Rehm HL. 2001. Connexin 26
studies in patients with sensorineural hearing loss. Arch Otolaryngol
Head Neck Surg 127:1037–1042.
Konig IR, Schafer H, Muller HH, Ziegler A. 2001. Optimized group
sequential study designs for tests of genetic linkage and association in
complex diseases. Am J Hum Genet 69:590–600.
Kudo T, Ikeda K, Kure S, Matsubara Y, Oshima T, Watanabe K, Kawase T,
Narisawa K, Takasaka T. 2000. Novel mutations in the connexin 26 gene
(GJB2) responsible for childhood deafness in the Japanese population.
Am J Med Genet 90:141–145.
Lench N, Houseman M, Newton V, Van Camp G, Mueller R. 1998. Connexin26 mutations in sporadic non-syndromal sensorineural deafness. Lancet
351:415.
Liu XZ, Xia XJ, Ke XM, Ouyang XM, Du LL, Liu YH, Angeli S, Telischi FF,
Nance WE, Balkany T, Xu LR. 2002. The prevalence of connexin 26
(GJB2) mutations in the Chinese population. Hum Genet 111:394–397.
129
Murgia A, Orzan E, Polli R, Martella M, Vinanzi C, Leonardi E, Arslan E,
Zacchello F. 1999. Cx26 deafness: Mutation analysis and clinical
variability. J Med Genet 36:829–832.
Mustapha M, Salem N, Delague V, Chouery E, Ghassibeh M, Rai M, Loiselet
J, Petit C, Megarbane A. 1998. Identification of mutations in the
connexin 26 gene that cause autosomal recessive nonsyndromic hearing
loss. Hum Mutat 11:387–394.
Najmabadi H, Cucci RA, Sahebjam S, Kouchakian N, Farhadi M, Kahrizi K,
Arzhangi S, Daneshmandan N, Javan K, Smith RJ. 2002. GJB2
mutations in Iranians with autosomal recessive non-syndromic sensorineural hearing loss. Hum Mutat 19:572.
Nance WE, Kearsey MJ. 2004. Relevance of connexin deafness (DFNB1) to
human evolution. Am J Hum Genet 74:1081–1087.
Ohtsuka A, Yuge I, Kimura S, Namba A, Abe S, Van Laer L, Van Camp G,
Usami S. 2003. GJB2 deafness gene shows a specific spectrum of
mutations in Japan, including a frequent founder mutation. Hum Genet
112:329–333.
Park HJ, Hahn SH, Chun YM, Park K, Kim HN. 2000. Connexin26
mutations associated with nonsyndromic hearing loss. Laryngoscope
110:1535–1538.
Rabionet R, Gasparini P, Estivill X. 2000a. Molecular genetics of hearing
impairment due to mutations in gap junction genes encoding beta
connexins. Hum Mutat 16:190–202.
Rabionet R, Zelante L, Lopez-Bigas N, D'Agruma L, Melchionda S,
Restagno G, Arbones ML, Gasparini P, Estivill X. 2000b. Molecular basis
of childhood deafness resulting from mutations in the GJB2 (connexin
26) gene. Hum Genet 106:40–44.
Richards B, Skoletsky J, Shuber AP, Balfour R, Stern RC, Dorkin HL, Parad
RB, Witt D, Klinger KW. 1993. Multiplex PCR amplification from the
CFTR gene using DNA prepared from buccal brushes/swabs. Hum Mol
Genet 2:159–163.
Scott DA, Kraft ML, Carmi R, Ramesh A, Elbadour K, Yairi Y, Srisailapathy
CR, Rosengren SS, Markham AF, Mueller RF, Lench NJ, Van Camp G,
Smith RJ, Sheffield VC. 1998. Identification of mutations in the connexin
26 gene that cause recessive nonsyndromic hearing loss. Hum Mutat
11:387–394.
Simsek M, Al-Wardy N, Al-Khayat A, Shanmugakonar M, Al-Bulushi T,
Al-Khabory M, Al-Mujeni S, Al-Harthi S. 2001. Absence of deafnessassociated connexin-26 (GJB2) gene mutations in the Omani population.
Hum Mutat 18:545–546.
Sobe T, Erlich P, Berry A, Korostichevsky M, Vreugde S, Avraham KB,
Bonne-Tamir B, Shohat M. 1999. High frequency of the deafnessassociated 167delT mutation in the connexin 26 (GJB2) gene in Israeli
Ashkenazim. Am J Med Genet 86:499–500.
Spicer SS, Schulte BA. 2002. Spiral ligament pathology in quiet-aged
gerbils. Hear Res 172:172–185.
Marazita ML, Ploughman LM, Rawlings B, Remington E, Arnos KS, Nance
WE. 1993. Genetic epidemiological studies of early-onset deafness in the
U.S. school-age population. Am J Med Genet 46:486–491.
Van Laer L, Coucke P, Mueller RF, Caethoven G, Flothmann K, Prasad SD,
Chamberlin GP, Houseman M, Taylor GR, Van de Heyning CM, Fransen
E, Rowland J, Cucci RA, Smith RJ, Van Camp G. 2001. A common
founder for the 35delG GJB2 gene mutation in connexin 26 hearing
impairment. J Med Genet 38:515–518.
Marlin S, Garabedian EN, Roger G, Moatt L, Matha N, Lewin P, Petit C,
Denoyelle F. 2001. Connexin 26 gene mutations in congenitally deaf
children: Pitfalls for genetic counselling. Arch Otolaryngol Head Neck
Surg 127:927–933.
Wang A, Liang Y, Fridell RA, Probst FJ, Wilcox ER, Touchman JW, Morton
CC, Morell RJ, Noben-Trauth K, Camper SA, Friedman TB. 1998.
Association of unconventional myosin MYO15 mutations with human
nonsyndromic deafness DFNB3. Science 280:1447–1451.
Mehl AL, Thomson V. 2002. The Colorado newborn hearing screening
project, 1992–1999: On the threshold of effective population-based
universal newborn hearing screening. Pediatrics 109:E7.
Wilcox SA, Saunders K, Osborn AH, Arnold A, Wunderlich J, Kelly T, Collins
V, Wilcox LJ, McKinlay Gardner RJ, Kamarinos M, Cone-Wesson B,
Williamson R, Dahl HH. 2000. High frequency hearing loss correlated
with mutations in the GJB2 gene. Hum Genet 106:399–405.
Meyer CG, Amedofu GK, Brandner JM, Pohland D, Timmann C, Horstmann
RD. 2002. Selection for deafness? Nat Med 8:1332–1333.
Morell RJ, Kim HJ, Hood LJ, Goforth L, Friderici K, Fisher R, Van Camp G,
Berlin CI, Oddoux C, Ostrer H, Keats B, Friedman TB. 1998. Mutations
in the connexin 26 gene (GJB2) among Ashkenazi Jews with nonsyndromic recessive deafness. N Engl J Med 339:1500–1505.
Zelante L, Gasparini P, Estivill X, Melchionda S, D'Agruma L, Govea
N, Mila M, Monica MD, Lutfi J, Shohat M, Mansfield E, Delgrosso K,
Rappaport E, Surrey S, Fortina P. 1997. Connexin26 mutations
associated with the most common form of non-syndromic neurosensory
autosomal recessive deafness (DFNB1) in Mediterraneans. Hum Mol
Genet 6:1605–1609.
Документ
Категория
Без категории
Просмотров
5
Размер файла
66 Кб
Теги
major, loss, hearing, population, connexin, mutation, causes, gjb2, indonesia
1/--страниц
Пожаловаться на содержимое документа