close

Вход

Забыли?

вход по аккаунту

?

GPC3 mutations in seven patients with SimpsonтАУGolabiтАУBehmel syndrome.

код для вставкиСкачать
ß 2007 Wiley-Liss, Inc.
American Journal of Medical Genetics Part A 143A:1703 – 1707 (2007)
GPC3 Mutations in Seven Patients With
Simpson–Golabi–Behmel Syndrome
Satoru Sakazume,1,6,7* Nobuhiko Okamoto,2 Toshiyuki Yamamoto,3,4 Kenji Kurosawa,4
Hironao Numabe,5 Yuko Ohashi,1 Yuko Kako,1 Toshiro Nagai,6,8 and Hirohumi Ohashi1
1
Division of Medical Genetics, Saitama Children’s Medical Center, Saitama, Japan
Department of Planning and Research, Osaka Medical Center and Research Institute for Maternal and Patient Health,
Osaka, Japan
3
International Research and Educational Institute for Integrated Medical Sciences, Tokyo Women’s Medical University,
Tokyo, Japan
4
Division of Medical Genetics, Kanagawa Children’s Medical Center, Yokohama, Japan
5
Department of Medical Genetics, Kyoto University Hospital, Kyoto, Japan
6
Department of Pediatrics, Koshigaya Hospital, Dokkyo University School of Medicine, Koshigaya, Japan
7
Division of Medical Genetics, Gunma Children’s Medical Center, Shibukawa, Gunma, Japan
8
Solution Oriented Research for Science and Technology (SORST), Japan Science and Technology (JST), Kawaguchi, Japan
2
Received 13 September 2006; Accepted 19 March 2007
We analyzed mutations of the GPC3gene in seven males with
typical manifestations of Simpson–Golabi–Behmel syndrome (SGBS). Genomic DNA was PCR amplified for its all
eight exons and exon–intron boundaries using designed set
of primers, and PCR products were directly sequenced. All
eight males studied had mutations: One patient had a large
deletion spanning introns 6 and 7, four each had a C ! T
base substitution resulting in a stop codon formation in
exons 2, 3, and 4, one had a single-base insertion in exon 2,
and the other had a six-base deletion and a three-base
insertion in exon 3; all resulting in loss-of-function of the
glypican-3 protein. These results, together with previous
studies of GPC3 mutations, indicate that there is no hot spot
for GPC3 mutations or deletions in the patients with the
syndrome. Also, no correlation has been noted between
the location and nature of mutations and the phenotype of
the patients studied, as is the case of the present study.
ß 2007 Wiley-Liss, Inc.
Key words: Simpson–Golabi–Behmel syndrome (SGBS);
overgrowth syndrome; GPC3 mutation
How to cite this article: Sakazume S, Okamoto N, Yamamoto T, Kurosawa K, Numabe H, Ohashi Y, Kako Y,
Nagai T, Ohashi H. 2007. GPC3 mutations in seven patients with Simpson–Golabi–Behmel syndrome.
Am J Med Genet Part A 143A:1703–1707.
INTRODUCTION
Simpson–Golabi–Behmel syndrome (SGBS) is an
X-linked MCA/MR syndrome characterized by preand postnatal overgrowth, ‘‘coarse’’ facial appearance, cleft lip and palate, macroglossia, a mild groove
of the lower lip and/or tongue, supernumerary
nipples, and various visceral and skeletal anomalies
including congenital cardiac defects, diaphragmatic
hernia, enlarged and dysplastic kidneys, and vertebral and rib anomalies [Neri et al., 1988]. The spectrum
of its manifestations is broad, with phenotypes
varying from very mild form to infantile lethal forms
[Terespolsky et al., 1995]. The syndrome is also
associated with a high risk for the development of
embryonic tumors, including Wilms tumor and
neuroblastoma during early childhood [Lapunzina,
2005]. Mutations in the GPC3 gene at Xq26 were
shown to cause SGBS in two female patients with
X-autosome translocations [Pilia et al., 1996]. GPC3
spans more than 500 kb of genomic DNA, contains
eight exons, and encodes glypican-3 protein, i.e., a
cell-surface heparan sulfate proteoglycan that plays
a role in the control of cell growth and cell division
by acting on Igf2 receptor in the presence of Igf2
[Pellegrini et al., 1998]. GPC3 mutations so far
Grant sponsor: Ministry of Health, Labor, and Welfare of Japan; Grant
sponsor: Kawano Masanori Memorial Foundation for Promotion of
Pediatrics.
*Correspondence to: Dr. Satoru Sakazume, Division of Medical
Genetics, Gunma Children’s Medical Center, 779 Shimohakoda, Hokkitu,
Shibukawa, Gunma 377-8577, Japan.
E-mail: saka377@gcmc.pref.gunma.jp
DOI 10.1002/ajmg.a.31822
American Journal of Medical Genetics Part A: DOI 10.1002/ajmg.a
1704
SAKAZUME ET AL.
reported in SGBS included large and small deletions,
point mutations, and frameshift mutations, distributed throughout the entire gene without any mutational hot spots [Hughes-Benzie et al., 1996; Pilia
et al., 1996; Lindsay et al., 1997; Veugelers et al., 1998;
Okamoto et al., 1999; Xuan et al., 1999; Veugelers
et al., 2000; Li et al., 2001; Mariani et al., 2003;
Rodriguez-Criado et al., 2005]. While loss-of-function
of glypican-3 is believed as the pathogenesis for
SGBS, no genotype/phenotype correlation has yet
been established.
Herein, we describe the results of GPC3 mutation
analysis in seven Japanese patients with typical
SGBS.
standard methods; PCR reaction was performed
using AmpliTaq Gold DNA polymerase (Applied
Biosystems, Foster City, CA) with 10% DMSO in PCR
buffer, and according to a touch-down PCR protocol
[Sambrook and Russell, 2001]. Briefly, enzyme activation at 968C for 5 min was followed by denaturation at 968C for 30 sec, and extension at 728C for 30
sec. First-cycle annealing was performed at 658C for
30 sec. In the following 9 cycles, temperature was
decreased from 658C stepwise by one degree to 568C,
and maintained at 558C throughout the remaining
cycles. A total of 45 cycles were carried out with an
ABI2400 thermal cycler. Amplification products were
electrophoresed with TAE 1% agarose gel, and
sequenced using an ABI310 sequencer and Big Dye
Terminator ver3.1 cycle sequence kit (Applied
Biosystems). In Patients 6 and 7, PCR had already
been carried out (by one of us, T.Y.) using the
primers of Huber et al. [1997] before designing the
primers above. In Patient 7, amplification of exon
7 was unsuccessful. In view of this, a pair of intronic
primers, each placed in introns 6 and 7, was used in
the reaction (Table II).
MATERIALS AND METHODS
Patients
Seven male patients with SGBS, ranging in age
from 15 months to 15 years (average 7 years), were
ascertained by clinical geneticists (Table I, Fig. 1). Six
patients were sporadic, whereas one (Patient 5) was
familial having a younger brother with prenatal
overgrowth, accessory nipples, and high-arched
palate. G-banded chromosomes in the seven patients
were all 46,XY.
RESULTS
Mutations or deletions causative of the syndrome
were identified in all the seven patients studied
(Table III). Four patients had C ! T substitutions
resulting in stop codon formation: Patients 1 and 2 in
exon 3, Patient 3 in exon 4, and Patient 6 in exon 2.
Patient 4 had a single-base insertion in exon 2, and
thereby, frameshift change of codon 116 in exon 3,
leading to a stop codon. Patient 5 showed a 6-bp
deletion and 3-bp insertion in exon 3 causing a
nonsense mutation. PCR of the genomic DNA from
Patient 7 failed to amplify exon 7. PCR using primers
placed in introns 6 and 7 resulted in abnormally
Mutation Analysis of GPC3
We designed PCR primers capable of amplifying
each of the eight exons and exon–intron junctions of
GPC3 with a single PCR reaction (Table II). In five
of the seven patients, our newly designed primers
were used with following protocol: Blood samples
or lymphoblastoid cells were collected from the
patients, and genomic DNA was extracted following
TABLE I. Clinical and Laboratory Findings in Seven Patients with Simpson–Golabi–Behmel Syndrome (SGBS)
Patients
1
Age (year)
Sex
Birth weight (SD)
Postnatal overgrowth (height SD)
Delayed speech
Delayed motor milestones
CNS abnormalities
Characteristic facial features
Cleft lip and/or palate
Macroglossia
Supernumerary nipples
Cardiac defects
Diaphragmatic hernia
Umbilical or inguinal hernia
Urinary tract abnormalities
Skeletal abnormalities
Embryonic tumors
3
Male
þ1.5
þ
þ
þ
CL&P
þ
þ
þ
þ
þ
þ
2
10
Male
þ0.8
þ1
þ
þ
þ
CL
þ
n
þ, present; , not present; n, not reported; a, died of pulmonary infection.
3
9 months
Male
þ2.6
þ
þ
þ
CL
þ
n
4
8
Male
þ2.6
þ3.5
þ
þ
þ
þ
þ
5
a
15 months
Male
þ3.8
þ
þ
þ
þ
þ
6
7
Total
15
Male
þ2.6
þ3.5
þ
þ
þ
þ
þ
þ
þ
3
Male
þ2.7
þ3.1
þ
þ
þ
þ
7/7
4/7
5/7
6/7
0
7/7
3/7
7/7
4/7
0
2/7
2/7
2/7
3/5
0
American Journal of Medical Genetics Part A: DOI 10.1002/ajmg.a
GPC3 MUTATIONS IN JAPANESE
1705
FIG. 1. Patient 4 at age 7 years (A and B) and Patient 7 at age 18 months (C). Note a tongue groove (A and B) and accessory nipples (C). [Color figure can be viewed in
the online issue, which is available at www.interscience.wiley.com.]
short 273-bp products both in the patient and his
mother (Fig. 2A). Direct sequencing of the 273-bp
fragment indicated a deletion of 35,074-bp (between
g.132445395 and g.132480524) spanning introns 6
and 7 and including entire exon 7 (Fig. 2B).
DISCUSSION
All seven patients we studied had typical clinical
manifestations of SGBS, including pre- and postnatal
overgrowth, and a characteristic face that became
‘‘coarse’’ during childhood (Table I). All seven
patients were found to have a mutation in GPC3;
one patient had a large deletion, four had single-base
substitutions, one had a single-base insertion, and
the other had a combination of a six-base deletion
and a three-base insertion—all resulting in loss-of-
function of glypican-3. These deletions/mutations
were detected in exons 2, 3, 4, and 7 of GPC3.
A deletion study by Pilia et al. [1996] examined six
of the eight exons of GPC3 in six families with SGBS,
and identified deletions in three families. One (family
a) of the three families, later turned out to have a
13-bp deletion and a consequent frameshift in exon 2
[Xuan et al., 1999]. This suggested that large deletions
might be responsible for a significant proportion of
cases of SGBS. This would not be unreasonable given
the large region of genomic DNA covered by GPC3.
Subsequent deletion studies, including those that
analyzed all eight exons of GPC3, detected 13
families and sporadic patients with deletions among
43 families and patients studied, giving a frequency
of 30% [Hughes-Benzie et al., 1996; Lindsay et al.,
1997; Veugelers et al., 1998; Li et al., 2001]. These
American Journal of Medical Genetics Part A: DOI 10.1002/ajmg.a
1706
SAKAZUME ET AL.
TABLE II. Primers Used for PCR and Sequencing
PCR primer
GPC3exon1F
CAGGTAGCTGCGAGGAAACT
GPC3exon1R
ctcagggtacagccaccac
GPC3exon2F
ggtgtgggtgtgtgagagag
GPC3exon2R
gcccaaataatgatgccact
GPC3exon3F
ttttcacactggattttcatgc
GPC3exon3R
tacctgctactggccacctc
GPC3exon4F
tgggggaagaaattgaagtg
GPC3exon4R
tttcactctagtggtttttgacctt
GPC3exon5F
ttgcctcttatgcacagatgtt
GPC3exon5R
tttctggtgcaattaatggaga
GPC3exon6F
gcttttcctttgtttgggact
GPC3exon6R
ctctctctctccccctcctc
GPC3exon7F
tgcagacccacctgagaaat
GPC3exon7R
ttgtgtgttgcagggaatgt
GPC3exon8F
gctcgagctgtgcatagtgt
GPC3exon8R
CCCTTTATCGAGGAAGACCAC
Reading primer in exon 3
GPC3exon3internalFor
GAGCAAGACGTGACCTGAAA
GPC3exon3internalRev
CGGCCACAGTCCTTACTGA
Intronic primers placed introns 6 and 7
Intronic primer6
ccacatggcttctgtccagag
Intronic primer7
cccagtgcttcttcttgtgcta
Product length
(base pairs)
Intron in amplicon
(base pairs)
393
53
40
21
47
47
70
52
15
82
38
55
37
90
72
277
831
302
267
255
327
306
Capital letter sequences are quoted from cDNA and lower-case letter sequences from genomic introns.
studies involved PCR amplification of the exons of
GPC3 of genomic DNA. The gene is not expressed in
readily available samples such as blood cells or
fibroblasts, so that its cDNA is not easily accessible.
The deletions detected in these studies ranged in
size from one to six exons, covered all eight exons
of GPC3, and in some instances involved exon 8
and extended to the centromere [Hughes-Benzie
et al., 1996; Lindsay et al., 1997; Veugelers et al.,
1998].
Mutation status of GPC3 was analyzed in five
studies, and three large deletions and nine mutations
were identified among 15 families and sporadic
patients with SGBS [Okamoto et al., 1999; Xuan et al.,
1999; Veugelers et al., 2000; Mariani et al., 2003;
Rodriguez-Criado et al., 2005]. The frequency of
large-scale deletions (20%) was much less than previously thought. Other mutations encountered
included nonsense mutations (three cases), a missense mutation (one case), frameshift mutations
(three cases), and splice-site mutations (two cases).
These studies may be biased toward the patients with
typical clinical manifestations of the syndrome,
although no correlation has been noted between
the location and nature of mutations and the
phenotype of the patients studied. Possible exceptions to the rule are males in family SGB-5 reported
by Lindsay et al. [1997] with deletion of exons 4 and 5,
and a patient by Li et al. [2001] with a deletion of exon
8. These patients had atypical facies.
In conclusion, we identified a gross deletion and
loss-of-function mutations in all seven patients with
typical SGBS studied. Further mutation studies are
desirable of patients with both typical and atypical
clinical manifestations of SGBS.
ACKNOWLEDGMENTS
We thank patients and their families for their
participation in this study. This work was supported
in part by a grant for Research on Children and
Families from the Ministry of Health, Labor, and
Welfare of Japan, and Kawano Masanori Memorial
Foundation for Promotion of Pediatrics.
TABLE III. GPC3 Mutations Detected in Seven Patients with SGBS
Patient
1
2
3
4.
5
6
7
Exon
Mutationa
Type of mutation
Amino acid changeb
3
3
4
2
3
2
7
c. 760C > T
c. 691C > T
c. 1159C > T
c. 240dupA
c. 780_785del insAGC
c. 256 C > T
g. 132445395–132480524 del
Nonsense
Nonsense
Nonsense
Frameshift
Nonsense
Nonsense
Deletion
p. Arg254X
p. Gln231X
p. Arg387X
p. Tyr81IlefsX36
p. Trp260X
p. Arg86X
Data are from the coding sequence of GPC3 (NM_004484), and data for Patient 7 are from the genomic sequence database
(Ensembl v34).
a
Experimentally determined.
b
Theoretically deduced.
American Journal of Medical Genetics Part A: DOI 10.1002/ajmg.a
GPC3 MUTATIONS IN JAPANESE
1707
FIG. 2. GPC3 mutation identified in Patient 7. A: Abnormally short PCR products of 273 bp are seen in both Patient 7 and his mother, when using a primer set spanning
introns 6 and 7. Lanes M, 1, 2, and 3 are a size marker, father, Patient 7, and mother, respectively. B: Electropherogram of direct sequence of the patient’s PCR product
indicating a 35,074-bp deletion between introns 6 and 7. Deletion extent was based on the genomic sequence database, Ensembl v34.
REFERENCES
Huber R, Crisponi L, Mazzarella R, Chen CN, Su Y, Shizuya H,
Chen EY, Cao A, Pilia G. 1997. Analysis of exon/intron
structure and 400 kb of genomic sequence surrounding the
50 -promoter and 30 -terminal ends of the human glypican 3
(GPC3) gene. Genomics 45:48–58.
Hughes-Benzie RM, Pilia G, Xuan JY, Hunter AG, Chen E, Golabi
M, Hurst JA, Kobori J, Marymee K, Pagon RA, Punnett HH,
Schelley S, Tolmie JL, Wohlferd MM, Grossman T, Schlessinger D, MacKenzie AE. 1996. Simpson–Golabi–Behmel
syndrome: Genotype/phenotype analysis of 18 affected males
from 7 unrelated families. Am J Med Genet 66:227–234.
Lapunzina P. 2005. Risk of tumorigenesis in overgrowth
syndromes: A comprehensive review. Am J Med Genet Part
C 137C:53–71.
Li M, Shuman C, Fei YL, Cutiongco E, Bender HA, Stevens C,
Wilkins-Haug L, Day-Salvatore D, Yong SL, Geraghty MT,
Squire J, Weksberg R. 2001. GPC3 mutation analysis in a
spectrum of patients with overgrowth expands the phenotype
of Simpson–Golabi–Behmel syndrome. Am J Med Genet
102:161–168.
Lindsay S, Ireland M, O’Brien O, Clayton-Smith J, Hurst JA, Mann
J, Cole T, Sampson J, Slaney S, Schlessinger D, Burn J, Pilia G.
1997. Large scale deletions in the GPC3 gene may account for
a minority of cases of Simpson–Golabi–Behmel syndrome. J
Med Genet 34:480–483.
Mariani S, Iughetti L, Bertorelli R, Coviello D, Pellegrini M,
Forabosco A, Bernasconi S. 2003. Genotype/phenotype correlations of males affected by Simpson–Golabi–Behmel syndrome with GPC3 gene mutations: Patient report and review
of the literature. J Pediatr Endocrinol Metab 16:225–232.
Neri G, Marini R, Cappa M, Borrelli P, Opitz JM. 1988. Simpson–
Golabi–Behmel syndrome: An X-linked encephalo–tropho–
schisis syndrome. Am J Med Genet 30:287–299.
Okamoto N, Yagi M, Imura K, Wada Y. 1999. A clinical and
molecular study of a patient with Simpson–Golabi–Behmel
syndrome. J Hum Genet 44:327–329.
Pellegrini M, Pilia G, Pantano S, Lucchini F, Uda M, Fumi M, Cao A,
Schlessinger D, Forabosco A. 1998. Gpc3 expression correlates with the phenotype of the Simpson–Golabi–Behmel
syndrome. Dev Dyn 213:431–439.
Pilia G, Hughes-Benzie RM, MacKenzie A, Baybayan P, Chen EY,
Huber R, Neri G, Cao A, Forabosco A, Schlessinger D. 1996.
Mutations in GPC3, a glypican gene, cause the Simpson–
Golabi–Behmel overgrowth syndrome. Nat Genet 12:241–
247.
Rodriguez-Criado G, Magano L, Segovia M, Gurrieri F, Neri G,
Gonzalez-Meneses A, Gomez de Terreros I, Valdez R, Gracia
R, Lapunzina P. 2005. Clinical and molecular studies on two
further families with Simpson–Golabi–Behmel syndrome.
Am J Med Genet Part A 138A:272–277.
Sambrook J, Russell DW. 2001. Touch down PCR. In:
Sambrook J, Russell DW, editors. Molecular Cloning. Cold
Spring Harbor, New York: Cold Spring Harbor Laboratory
Press. p 112.
Terespolsky D, Farrell SA, Siegel-Bartelt J, Weksberg R. 1995.
Infantile lethal variant of Simpson–Golabi–Behmel syndrome associated with hydrops fetalis. Am J Med Genet 59:
329–333.
Veugelers M, Vermeesch J, Watanabe K, Yamaguchi Y, Marynen
P, David G. 1998. GPC4, the gene for human K-glypican,
flanks GPC3 on xq26: Deletion of the GPC3-GPC4 gene cluster
in one family with Simpson–Golabi–Behmel syndrome.
Genomics 53:1–11.
Veugelers M, Cat BD, Muyldermans SY, Reekmans G, Delande N,
Frints S, Legius E, Fryns JP, Schrander-Stumpel C, Weidle B,
Magdalena N, David G. 2000. Mutational analysis of the GPC3/
GPC4 glypican gene cluster on Xq26 in patients with
Simpson–Golabi–Behmel syndrome: Identification of lossof-function mutations in the GPC3 gene. Hum Mol Genet
9:1321–1328.
Xuan JY, Hughes-Benzie RM, MacKenzie AE. 1999. A small
interstitial deletion in the GPC3 gene causes Simpson–
Golabi–Behmel syndrome in a Dutch–Canadian family.
J Med Genet 36:57–58.
Документ
Категория
Без категории
Просмотров
4
Размер файла
134 Кб
Теги
patients, mutation, simpsonтауgolabiтауbehmel, seven, syndrome, gpc3
1/--страниц
Пожаловаться на содержимое документа