close

Вход

Забыли?

вход по аккаунту

?

Homozygosity for a gross partial gene deletion of the C-terminal end of ATP7B in a Wilson patient with hepatic and no neurological manifestations.

код для вставкиСкачать
American Journal of Medical Genetics 138A:340 –343 (2005)
Homozygosity for a Gross Partial Gene Deletion of the
C-Terminal End of ATP7B in a Wilson Patient With
Hepatic and no Neurological Manifestations
Lisbeth Birk Møller,1 Peter Ott,2 Connie Lund,1 and Nina Horn1*
1
The Kennedy Institute, Gl. Landevej 7, DK 2600 Glostrup, Denmark
Department of Hepato-gastroenterology V, Aarhus University Hospital, DK 8000 Aarhus C, Denmark
2
We identified a partial gene deletion of ATP7B in a
patient with Wilson disease with hepatic onset.
The deletion covered exon 20 including major
parts of the flanking introns. The breakpoints
were identified and the size of the deletion
determined to be 2144 bp. The deletion is predicted to lead to a mutated protein product
containing 45 aberrant amino acids after transmembrane domain 7, and lacking the transmembrane domain 8 as well as the entire C-terminal
cytoplasmic tail. This is the first time a partial
gene deletion has been demonstrated in ATP7B.
The patient presented at age 10 with hepatic
manifestations, including severe jaundice,
hepato-splenomegaly, ascites, and spider naevi.
The liver biopsy showed fibrosis and early signs of
cirrhosis. There was a Kayser–Fleischer ring but
no neurological manifestations. All symptoms
disappeared with penicillamine therapy. This
suggests that the C-terminal cytoplasmatic tail
of ATP7B, is not essential for its neurological
function. Large deletions in ATP7B may be an
overlooked cause of Wilson disease. Patients that
are homozygotes for deletions may be valuable for
the understanding of the function of various
regions of the ATP7B protein.
ß 2005 Wiley-Liss, Inc.
KEY WORDS: Wilson disease; hepatic type;
partial gene deletion; ATP7B;
molecular diagnosis
INTRODUCTION
Wilson disease (WND) [OMIM 277900] is an autosomal
recessive disturbance of copper transport characterized by
copper accumulation in the liver and subsequently in other
organs, mainly brain, kidneys, and cornea, followed by hepatic
and/or neurologic symptoms due to copper toxicity. The
defective gene ATP7B codes for an energy-requiring pump
that is necessary for the incorporation of copper into ceruloplasmin and for biliary excretion of the metal.
Grant sponsor: Novo Nordisk Foundation; Grant sponsor:
Foundation of 1870; Grant sponsor: Ludvig and Sara Elsass
Foundation; Grant sponsor: Apotekerfonden, The Lundbeck
Foundation; Grant sponsor: Ovita and Jeppe Juhl’s Foundation.
*Correspondence to: Nina Horn, Ph.D., D.MSc., The Kennedy
Institute, Gl. Landevej 7, 2600 Glostrup, Denmark.
E-mail: nih@kennedy.dk
Received 6 May 2005; Accepted 17 August 2005
DOI 10.1002/ajmg.a.30977
ß 2005 Wiley-Liss, Inc.
A broad range of disease-causing mutations has been
reported in ATP7B. Non-conservative missense mutations
are prevalent while other types of mutations such as small
insertions or deletions causing frameshift, nonsense mutations, and splice-site mutations are less frequent [Hsi and Cox,
2004]. In a substantial number of patients, no or only one
mutation has been identified. A reason could be that partial
gene deletions of one or more exons are overlooked by current
methods. Gross deletions of ATP7B have not yet been
described, except for an interstitial deletion in the long arm
of chromosome 13 that encompassed the WND and RB1 loci in a
boy showing both Wilson disease and retinoblastoma [Riley
et al., 2001]. However, in that case, the deletion was not
homozygous and the authors postulate that the co-occurrence
of retinoblastoma and Wilson disease was the consequence of
an acquired somatic mutation at the retinoblastoma locus
and an inherited mutation at the Wilson disease locus of
the maternally derived chromosome 13, superimposed on the
hemizygosity associated with the paternally derived deletion.
We now describe a patient with Wilson disease who is
homozygous for a gross partial gene deletion in the 30 end of
the gene.
CLINICAL REPORT
The propositus was born 1970 in Turkey, the third of four
children. The parents are first cousins. The first child, a girl,
born 1964, died at the age of 3 months of unrelated causes. The
second child, a boy born in 1965, presented in 1976 with
jaundice of 2–3 month duration, vomiting, and ascites. He died
of coagulopathy before a suspicion of Wilson disease could be
confirmed. A younger brother born in 1983 was healthy at
examination in 2003.
At age 10 years, the boy presented with hepato-splenomegaly, ascites, jaundice, and spider naevi. A Kayser–Fleischer
ring and undetectable levels of ceruloplasmin established the
diagnosis of Wilson disease. After administration of penicillamine at a final dose of 1 g/day, jaundice disappeared within a
few weeks, and ascites vanished over a year. In 1990, the liver
biopsy still showed fibrosis and elevated copper content (300
ng/mg (w/w); normal <15) and the 24 hr urine copper during
penicillamine treatment (9.1 mmol/day; normal range: 0.3–1.3)
was also elevated even after 10 years of treatment. In 1990, the
Kayser–Fleischer ring had disappeared. Since 2002, he has
been treated with zinc (50 mg elementary Zn t.i.d). At the latest
examination (May 2003) he was well, without clinical signs of
liver disease. He has never had neurological or psychological
symptoms.
MATERIALS AND METHODS
Isolation of Genomic DNA
Genomic DNA was extracted from peripheral blood lymphocytes or cultured fibroblasts using the NaCl method [Grimberg
et al., 1989].
Partial Gene Deletion in a Wilson Patient
341
TABLE I. DNA Primers Used in PCR Reactions
Name
WND8U
WND8L
WND17I
WND19U
WND19L
WND20U
WND20L
WND21U
WND21L
Sequence (50 –30 )
Direction
Location
aacccttcactgtccttgtc
aggcagctcttttctgaac
aatcgcagacgctgtcaagc
ggcagaccccttcctcac
cctgggagagagaagccttt
ctaggtgtgagtgcgagtt
cagcatttgtcccaggt
aatggctcagatgctgtt
gcttgtggtgagtggaggcaag
Forward
Reverse
Forward
Forward
Reverse
Forward
Reverse
Forward
Reverse
Upstream exon 8
Downstream exon 8
Within exon 17
Upstream exon 19
Downstream exon 19
Upstream exon 20
Downstream exon 20
Upstream exon 21
Downstream exon 21
PCR
DNA or cDNA was mixed with 200 nM of each primer, 50 mM
of each dNTP, and 0.04 U/ml of AmpliTaq polymerase.
Amplification was carried out for 40 cycles of 958C for 30 sec,
558C for 1 min, 728C for 2 min, and a final extension at 728C for
7 min. Multiplex PCR of two exons, the exon analyzed for a
deletion and a non-deleted control exon, were investigated
simultaneously in a single PCR reaction. Combinations of
primer sets 8U/8L, 19U/19L, 20U/20L, and 21U/21L were used
(Table I).
Spanning of the Deletion Using Flanking Primers
Selective amplification of the mutated ATP7B allele was
performed using 19U and 21L primers flanking the deleted
exons. Amplification of genomic DNA was performed using 150
nM of each primer, 37.5 mM of each dNTP, and 0.04 U/ml of
AmpliTaq polymerase. The PCR cycling conditions were 40
cycles of 958C for 1 min, 558C for 1 min, 728C for 4 min, and a
final extension at 728C for 7 min. Sequencing of the amplified
fragment with the same primers identified the deletion
breakpoints.
Reverse Transcription (RT-PCR)
Total RNA was isolated from 104 –106 Epstein–Barr virustransformed lymphocytes or cultured skin fibroblasts with the
Rneasy Mini Kit (QIAgen, Bothell, WA). Single-stranded
cDNA was synthesized using Superscript II Rnase H-Reverse
Transcriptase (Life Technologies (Gibco BRL), Gaithersburg,
MD, USA) and a mixture of random hexamer primers
(Amersham Biosciences, Buckinghamshire, UK). The cDNA
was amplified by PCR as described above.
Sequence Analysis
Purified PCR products were sequenced with the dideoxynucleotide chain termination method [Sanger et al., 1977] using
32
P-labeled primer and ThermoSequenase (United States
Biochemical Corp (USB), Cleveland, OH, USA).
RESULTS
We identified a partial gene deletion in the ATP7B gene in a
sample of genomic DNA obtained from our Wilson patient.
Amplification of exons showed that two consecutive exons, 20
and 21 could not be amplified. The presence of a partial gene
deletion was confirmed by multiplex PCR where one of the
exons of interest and a non-deleted exon were tested for
amplification in a single PCR reaction (Fig. 1A).
Using the primer set, 19U/21L, located upstream exon 19
and downstream exon 21, respectively, we were able to span
the deletion and amplify a PCR product of about 600 bp from
the index patient (Fig. 1B). As expected a PCR product of the
same size was demonstrated in both parents (Fig. 1B) but also
in the younger healthy brother (not shown).
Sequencing of the amplified fragments showed that the
deletion covered the fragment starting 87 bp downstream exon
19 and ending 1 bp upstream exon 21. Thus the major part of
intron 19, the entire exon 20 and the entire intron 20 except for
one base pair were deleted [c.4021 þ 87_41252del]. Comparison with the genomic ATP7B sequence (U11700, http://
Fig. 1. A: Identification of deletion by multiplex PCR. Genomic DNA from the index patient (I) was tested for the amplification of selected exons on a 2%
agarose gel. DNA from a control person (C), was included to verify the compatibility of each pair of primers. The sizes of the amplified exons are 299 bp (exon 8),
215 bp (exon 19), 253 bp (exon 20), and 361 bp (exon 21). The marker (L) is fX174DNA HaeIII digest. B: PCR amplification of the junction fragment: PCR
amplification on genomic DNA from the index patient (I), the father (F), the mother (M), and a control person (C) was performed using the primer-pair 19U/
21L (see Table I). The PCR products were separated on a 2% agarose gel. The marker (L) is fX174DNA HaeIII digest. C: Amplification of aberrant transcripts
by RT-PCR: cDNA from the index patient (I), the father (F), the mother (M), and a control person (C) was amplified using the primer-pair 17I/21L (see Table I).
The PCR products were separated on a 2% agarose gel. The marker (L) is Hyperladder IV (Bioline). The identities of the resulting products were confirmed by
DNA sequencing.
342
Møller et al.
Normal intron 19
50309317
Patient
Normal intron20/exon 21 50307175
tgggggttagtgagtggctcactcactggctggctggctagag
IIIIIIIIIIIIIIIIIIIII
tgggggttagtgagtggctcagCTATAAGAAGCCTGACCTGG
IIIIIIIIIIIIIIIIIIIII
ctgttgcgttcctgctttccagCTATAAGAAGCCTGACCTGG
Fig. 2. Exact localization of the breakpoints. The PCR amplified products covering the deletion junction from the index patient were sequenced to identify
the deletion breakpoints. The nucleotide sequence of the recombination joint identified in the patient is shown. Vertical lines mark identical base pairs. The
deletion was from 50309338 in intron 19 to position 50307195 in intron 20 (reference sequence: U11700, http://genome.UCSC.edu).
genome.UCSC.edu) documented that the size of the genomic
deletion was 2,144 bp [g.50309338_50307195del] (Fig. 2).
Using the primer set, 17I/21L, a product of about 800 bp was
obtained from the index patient, his parents, and a normal
control person (Fig. 1C). Sequencing disclosed that the
products were not identical. The product from the index
patient contained exon 18, exon 19, the first part of intron 19,
and the last bp of intron 20. Exon 18 was correctly spliced,
whereas the non-deleted parts of intron 19 (86 bp) and intron
20 (1 bp) were included in the cDNA sequence. The protein
product encoded by the resulting cDNA is predicted to contain
the normal 1,341 amino acids encoded by exon 1–19 plus an
addition of 45 aberrant residues. As exon 20 contains 103 bp,
the obtained product from the control person is differing only
slightly in size from the product obtained from the index
patient.
DISCUSSION
We here report the finding of a homozygous gross deletion in
the C-terminus of ATP7B in a patient with the hepatic type of
WND. This is the first report of this type of mutation in ATP7B.
This is surprising since in Menkes disease, partial gene
deletions account for a substantial proportion of mutations in
the homologous gene, ATP7A [Tümer et al., 2003].
Despite extensive screening of the coding region of ATP7B
using various techniques, the highest mutation detection rate
is about 90%, even after sequencing of all exons [Waldenström
et al., 1996; Curtis et al., 1999]. Our results suggest that partial
gene deletions in ATP7B may be the causative mutation in
some of the uncharacterized alleles. At present, it is impossible
to estimate the relative contribution of gross deletions in
ATP7B in WND. Of the nearly 60 gross gene deletions reported
in ATP7A [Tümer et al., 2003] none are identical, and they are
spread over the entire gene including promotor and terminator
regions.
There are several reasons why partial gene deletions of
ATP7B may have been overlooked. Patients with Wilsons
disease that carry a partial deletion of one or more exons on one
allele may appear to be homozygous for a point mutation on the
opposite allele, if the latter occur within the deleted region.
Therefore, a suspected homozygosity of a point mutation
should be confirmed by analyzing both parents of the Wilson
patient. If the mutation cannot be found in both parents and
paternity is confirmed, this could indicate the presence of a
gross deletion.
In the present case, the deletion in the index patient was
found because it occurred in the homozygous state. The
identification of both breakpoints and definition of primers to
span the deletion allowed direct demonstration of the carrier
state in both parents as well as in the younger brother. Partial
gene deletions in the heterozygous state are not detectable by
exon amplification because the normal allele will mask its
presence. Alternative methods will be required, for example,
quantitative techniques to detect a reduced dosage of an exon.
Development of a method for a large-scale search for deletions,
also in the heterozygous state, is ongoing.
In our patient, the partial gene deletion leads to a protein
product lacking the C-terminus after the transmembrane
segment 7 but enlarged by 45 aberrant amino acids
(p.1341_1465del45ins). The deletion removed several signals
including a di-leucine motif. A homologous di-leucine in ATP7A
[Hsi et al., 2004] has been shown to be important for the
localization of ATP7A in the trans Golgi network [Petris et al.,
1998], and, by analogy, the deletion in our patient may disrupt
the normal trafficking of ATP7B to and from the trans-Golgi
network implicating inadequate loading of ceruloplasmin. A
critical role for the C-terminal of ATP7B in copper loading of
ceruloplasmin was also indicated in experiments in yeast ccc2
where expression of an ATP7B mutant lacking a part of the Cterminus (p.1371_1465del) prevented copper loading of the
ceruloplasmin homolog, Fet3p [Hsi et al., 2004]. In agreement
with these observations, ceruloplasmin was below the detection limit in the patient. This defect is likely to be caused by
instability of the protein due to improper folding [Hsi et al.,
2004].
The clinical case fulfilled the Sternlieb criteria for Wilson
disease [Sternlieb, 1990]. The diagnosis is further supported by
the death of the older brother with a very similar clinical
picture. The two affected brothers presented early, both at the
age of 10. The disease was characterized as an aggressive
hepatitis with clinical signs of cirrhosis and hepatic decompensation at the age of 10. In larger populations, it has been
difficult to establish a clear relationship between the site of the
mutation and the presentation of the disease, even in
homozygous patients. However, the lack of neurological
symptoms in our patient suggests that the C-terminal part of
ATP7B is not essential for its neurological functions. This is in
accordance with the observations in the LEC rat, an animal
model of Wilson disease, characterized by a large gene deletion
resulting in loss of half of the ATP binding domain and the last
two transmembrane domains plus the C terminus [Wu et al.,
1994]. Even in the homozygous state, the deletions primarily
cause hepatic and not neurological disease [Santon et al.,
2003]. Thus, studies of patients who are homozygous for
deletions in the ATP7B gene are valuable for the further
understanding of the relation between structure and function
of this protein.
ACKNOWLEDGMENTS
This study was supported by The Novo Nordisk Foundation,
The Foundation of 1870, Ludvig and Sara Elsass Foundation,
Apotekerfonden, The Lundbeck Foundation, and Ovita and
Jeppe Juhl’s Foundation.
REFERENCES
Curtis D, Durkie M, Balac (Morris) P, Sheard D, Goodeve A, Peake I,
Quarrell O, Tanner S. 1999. A study of Wilson disease mutations in
Britain. Hum Mut 14:304–311.
Grimberg J, Nawoschik S, Belluscio L, McKee R, Turck A, Eisenberget A.
1989. A simple and efficient non-organic procedure for the isolation of
genomic DNA from blood. Nucleic Acids Res 17:8390.
HGMD. 2005. HGMD entry for ATP7B.
Partial Gene Deletion in a Wilson Patient
Hsi G, Cox DW. 2004. A comparison of the mutation spectra of Menkes
disease and Wilson disease. Hum Genet 114:165–172.
Hsi G, Cullen LM, Glerum DM, Cox DW. 2004. Functional assessment of the
carboxy-terminus of the Wilson disease copper-transporting ATPase,
ATP7B. Genomics 83:473–481.
OMIM. 2005a. Gene Symbol: ATP7B; GenBank NM_00053.1; OMIM 606882
http://www.ncbi.nlm.nih.gov/entrez/dispomim.cgi?id¼606882.
OMIM. 2005b. Disease: OMIM 277900 http://www.ncbi.nlm.nih.gov/entrez/
dispomim.cgi?id¼277900.
Petris MJ, Camakaris J, Greenough M, LaFontaine S, Mercer JFB. 1998. A
C-terminal di-leucine is required for localisation of the Menkes protein
in the trans-Golgi network. Hum Mol Genet 7:2063–2071.
Riley D, Witznitzer M, Schwartz S, Zinn AB. 2001. A 13-year-old boy with
cognitive impairment, retinoblastoma and Wilson disease. Neurology
57:141–143.
Sanger F, Nicklen S, Coulson AR. 1977. DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467.
343
Santon A, Irato P, Medici V, D’Inca R, Albergoni V, Sturniolo GC. 2003.
Effect and possible role of Zn treatment in LEC rats, an animal model of
Wilson’s disease. Biochim Biophys Acta 1637:91–97.
Sternlieb I. 1990. Perspectives on Wilson’s disease. Hepatology 12:1234–
1239.
Tümer Z, Møller LB, Horn N. 2003. Screening of 383 unrelated patients
affected with Menkes disease and finding of 57 gross deletions in ATP7A.
Hum Mut 22:457–464.
Waldenström E, Lagerkvist A, Dahlman T, Westermark K, Landegren U.
1996. Efficient detection of mutations in Wilson disease by manifold
sequencing. Genomics 37:303–309.
Wilson Disease Mutation Database, HGMD. 2005. Databases: ATP7B
mutation databases: http://www.uofa-medical-genetics.org/wilson/
index.php and http://www.hgmd.org/ATP7B.
Wu J, Forbes JR, Chen HS, Cox DW. 1994. The LEC rat has a deletion in the
copper transporting ATPase gene homologous to the Wilson disease
gene. Nat Genet 7:541–545.
Документ
Категория
Без категории
Просмотров
4
Размер файла
85 Кб
Теги
patients, gross, terminal, manifestation, wilson, partial, neurological, homozygosity, end, atp7b, hepatica, genes, deletion
1/--страниц
Пожаловаться на содержимое документа