close

Вход

Забыли?

вход по аккаунту

?

PL179166B1

код для вставкиСкачать
(12) OPIS PATENTOWY (19)PL (11) 179166
RZECZPOSPOLITA
POLSKA
(21) Numer zgłoszenia:
(22) Data zgłoszenia:
(13) B1
333484
01.10.1993
(86) Data i numer zgłoszenia międzynarodowego:
01.01.1993, PCT/EP93/02688
(87) Data i numer publikacji zgłoszenia
międzynarodowego:
Urząd Patentowy
Rzeczypospolitej Polskiej
(
5
(30 )
Pierwszeństwo:
(62)
4
(51) IntCl7:
C 1 2 N 15/52
C 12 N 15/70
23.07.1994, WO94/08023,
PCT Gazette nr 09/94
)
02.10.1992,CH,3124/92
15.07.1993,CH,2134/93
Numer zgłoszenia,
z którego nastąpiło wydzielenie:
Sposób wytwarzania biotyny
(73)
LONZA AG., Gampel/Wallis, CH
(72)
Zgłoszenie ogłoszono:
(45)
O udzieleniu patentu ogłoszono:
Twórcy wynalazku:
Olwen Birch, Naters, CH
Johann Brass, Ausserberg, CH
Martin Fuhrmann, Visp, CH
Nicholas Shaw, Visp, CH
308301
(43)
Uprawniony z patentu:
24.07.1995 BUP 15/95
31.07.2000 WUP 07/00
(74)
Pełnomocnik:
Malewska Ewa,
EWA MALEWSKA & PARTNERS
PL 179166 B1
( 5 7 ) 1. Sposób wytwarzania biotyny, obejmujący przemianę detiobiotyny w biotynę w układzie bezkomórkowym za pomocą syntazy bioty nowej, znamienny tym, że przemianę prowadzi się w obecności pirofosforanu tiaminy, S-adenozylometioniny, jonów Fe2+, cysteiny
i co najmniej jeszcze jednego aminokwasu z grupy obejmującej asparaginę, kwas asparaginowy, glutaminę i serynę.
4. Sposób wytwarzania biotyny, obejmujący przemianę detiobiotyny w biotynę w układzie bezkomórkowym za pomocą syntazy biotynowej, znamienny tym, że przemianę prowadzi się w obecności NADPH (zredukowany fosforan dinukleotydu nikotynoamidowo
adeninowego), cysteiny i co najmniej jeszcze jednego aminokwasu z grupy obejmującej
asparaginę, kwas asparaginowy, glutaminę i serynę.
Sposób wytwarzania biotyny
Zastrzeżenia
patentowe
1. Sposób wytwarzania biotyny, obejmujący przemianę detiobiotyny w biotynę w układzie bezkomórkowym za pomocą syntazy biotynowej, znamienny tym, że przemianę prowadzi się w obecności pirofosforanu tiaminy, S-adenozylometioniny, jonów Fe2+, cysteiny i co
najmniej jeszcze jednego aminokwasu z grupy obejmującej asparaginę, kwas asparaginowy,
glutaminę i serynę.
2. Sposób według zastrz. 1, znamienny tym, że przemiany dokonuje się w obecności
flawodoksyny.
3. Sposób według zastrz. 1, znamienny tym, że przemiany dokonuje się w obecności
reduktazy ferredoksyno(flawodoksyno)-NADP+ (fosforan dinukleotydu nikotynoamidowoadeninowego).
4. Sposób wytwarzania biotyny, obejmujący przemianę detiobiotyny w biotynę w układzie bezkomórkowym za pomocą syntazy biotynowej, znamienny tym, że przemianę prowadzi się w obecności NADPH (zredukowany fosforan dinukleotydu nikotynoamidowoadeninowego), cysteiny i co najmniej jeszcze jednego aminokwasu z grupy obejmującej asparaginę, kwas asparaginowy, glutaminę i serynę.
5. Sposób według zastrz. 4, znamienny tym, że przemiany dokonuje się w obecności
flawodoksyny i reduktazy ferredoksyno(flawodoksyno)-NADP+.
6. Sposób według zastrz. 1 albo 4, znamienny tym, że przemianę prowadzi się w obecności frakcji proteinowej, otrzymywanej przez wytrącenie siarczanem amonowym przy nasyceniu 45% ekstraktu komórkowego Escherichia coli.
* * *
Niniejszy wynalazek dotyczy sposobu wytwarzania biotyny obejmującego przemianę
detiobiotyny za pomocą syntazy biotynowej w układzie bezkomórkowym.
Bioty na (witamina H) jest ważną witaminą dla ludzi i zwierząt, której niedobór może
przykładowo wywoływać łojotok, zapalenie skóry, brak apetytu i zmęczenie. Dlatego też
biotyna jest przydatnym dodatkiem do żywności i paszy.
Wytwarzanie biotyny metodami syntetycznej chemii organicznej wymaga dużych nakładów i jest kosztowne. Z tego powodu coraz większe znaczenie mają sposoby biotechnologiczne, w których biotynę można zsyntetyzować za pomocą mikroorganizmów z tanich materiałów wyjściowych, takich jak glukoza.
Escherichia coli (E. coli) jest mikroorganizmem zdolnym do tego, by wychodząc z prostych źródeł węgla, takich jak gliceryna lub glukoza, zsyntetyzować biotynę (fig. 1). Geny
odpowiedzialne za biosyntezę biotyny u E. coli, występują w operonie, który już sklonowano
i który obejmuje pięć genów: bioA. bioB, bioC, bioD oraz bioF (dalej określanych także jako
geny bio) (Gupta i in., Gene 1: 331-345; 1977). Geny te są przez obszar promotora-operatora,
znajdujący się pomiędzy genami bioA i bioB, transkrybowane w dwóch różnych kierunkach.
W odniesieniu do konwencjonalnej mapy genów, geny bioB, bioF, bioC oraz bioD znajdują
się na prawo, a gen bioA - na lewo od obszaru promotor-operator. DNA na lewo od obszaru
promotor-operator obejmuje w dół sekwencji od genu bioA. dalszy gen oznaczony jako ORFI
(ORF = open reading frame, otwarta ramka odczytu), kodujący polipeptyd o 158 aminokwasach i transkrybowany wraz z genem bioA (Otsuka i in., J. Biol. Chem., 263: 19577-19585;
1988). Funkcja tego genu dotąd jest nieznana. Inne szczepy rodziny enterobakterii, przykładowo z gatunku Salmonella lub Citrobacter, mają strukturę operonu biotyny analogiczną do
E. coli (Shiuan i Campbell, Gene, 67; 203-211; 1988).
179 166
3
Znane są już biotechnologiczne sposoby wytwarzania biotyny, wykonywane za pomocą
mikroorganizmów, transformowanych klonowanym operonem biotyny E. coli. Te sposoby
realizuje się wychodząc z glukozy. EP-B-236 429 opisuje np. mikroorganizmy, transformowane operonem biotyny E. coli, przy czym organizmy gospodarza ulegają mutacji w swoim
genie bioA/bioR.
W EP-A-316 229 opisano mutanty E. coli, które wytwarzają mniej octanu i które również przetransformowano klonowanym operonem biotyny.
EP-A-449 724 ujawnia mikroorganizmy transformowane operonem biotyny, wykazujące dodatkowo mutacje, powodujące w następstwie mniejsze zużycie glukozy.
Z EP-A-266 240 znane jest ponadto klonowanie genu odpowiedzialnego za syntezę
biotyny w Bacillus sphaericus oraz oparty na tym sposób wytwarzania biotyny. Metabolizm
Bacillus sphaericus warunkuje, że ten sposób musi być realizowany wychodząc z kosztownego kwasu pimelinowego.
Wydajności, uzyskiwane według dotychczas znanych sposobów biotechnologicznych są
jednak z gospodarczego punktu widzenia niezadowalające.
Celem niniejszego wynalazku jest zatem, dostarczenie sposobu wytwarzania biotyny,
umożliwiającego wyższe wydajności biotyny i tym samym mającego większe znaczenie gospodarcze. Cel ten osiągnięto dzięki opracowaniu sposobu według wynalazku.
Sposób wytwarzania biotyny, obejmujący przemianę detiobiotyny w biotynę w układzie
bezkomórkowym za pomocą syntazy biotynowej, według wynalazku polega na tym, że przemianę prowadzi się w obecności pirofosforanu tiaminy, S-adenozylometioniny, jonów Fe2+,
cysteiny i co najmniej jeszcze jednego aminokwasu z grupy obejmującej asparaginę, kwas
asparaginowy, glutaminę i serynę.
Korzystnie, zgodnie z wynalazkiem przemiany dokonuje się w obecności flawodoksyny.
W sposobie według wynalazku przemiany korzystnie dokonuje się w obecności reduk
tazy ferredoksyno(flawodoksyno)-NADP+.
Sposób wytwarzania biotyny, obejmujący przemianę detiobiotyny w biotynę w układzie
bezkomórkowym za pomocą syntazy biotynowej, zgodnie z wynalazkiem, alternatywnie polega na tym, że przemianę prowadzi się w obecności NADPH, cysteiny i co najmniej jeszcze
jednego aminokwasu z grupy obejmującej asparaginę, kwas asparaginowy, glutaminę i serynę.
Korzystnie, w tym sposobie przemiany dokonuje się w obecności flawodoksyny i re
duktazy ferredoksyno(flawodoksyno)-NADP+.
W sposobie według wynalazku - w obu wyżej określonych odmianach - przemianę korzystnie prowadzi się w obecności frakcji proteinowej, otrzymywanej przez wytrącenie siarczanem amonowym przy nasyceniu 45% ekstraktu komórkowego Escherichia coli.
Wynalazek obecny jest wynikiem kompleksowych prac, których część będąca przedmiotem odrębnego patentu nr . . . (zgłoszenie nr P-308301 z dnia 1.10.1993 r.) dotyczy
ściśle biotechnologicznego sposobu wytwarzania biotyny. We wskazanych pracach wykorzystano fragmenty DNA oraz wektory, zawierające geny bioB, bioF, bioC, bioD oraz bioA lub
ich funkcjonalnie równoważne genetyczne warianty i mutanty z enterobakterii, przy czym te
geny są zorganizowane w jednostkę transkrypcyjną.
Przez jednostkę transkrypcyjną rozumie się tu sekwencję DNA, w której geny są ustawione w kierunku transkrypcji i pod wspólną kontrolą transkrypcji są przepisywane w nieprzerwany transkrypt, przy czym sekwencja DNA obok każdorazowych genów obejmuje także genetyczne elementy kontrolne wymagane dla ekspresji genu, takie jak promotory i miejsca wiązania rybosomów.
Przez „funkcjonalnie równoważne genetycznie warianty i mutanty” rozumie się geny,
które pochodzą od genów dzikiego typu organizmów pierwotnych, tzn. enterobakterii i cechują się zamianą zasad w ramach znanej degeneracji kodu genetycznego. Tego rodzaju zamiany zasad mogą być pochodzenia naturalnego lub mogą być wytworzone sztucznie, np. aby
dopasować sekwencję genu do uprzywilejowanego zastosowania kodonu określonego mikroorganizmu, w którym powinna nastąpić ekspresja. Genetyczne warianty i mutanty obejmują
ponadto delecje, inserty i substytucje zasad lub kodonu, które pozostawiają produkt genu
o tego rodzaju zmienionej sekwencji przy zasadniczo nienaruszonej funkcji. Objęte są
4
179 166
w szczególności sekwencje, które w zwykłych warunkach hybrydyzacji, tzn. w temperaturach
między 55 i 66°C i przy 0,03 do 0,3 M zawartości soli, hybrydyzują z sekwencjami dzikiego
typu, a także sekwencje, które wykazują w wysokim stopniu homologię, np. wyższą niż 70%.
Figura 1 przedstawia enzymy drogi metabolizmu biosyntezy biotyny.
Figura 2 przedstawia schemat budowy plazmidu pBO30.
Figura 3 przedstawia sekwencję plazmidu pB030, pB030A -9 oraz pB030A-15 dla obszaru końca 3' genu bioD oraz końca 5' genu bioA (przerywane strzałki; kodon startowy
bioA podkreślono, stop-kodon bioD zaznaczono kropkami) wraz z miejscami cięcia przez
enzymy restrykcyjne związanymi z konstrukcją plazmidu oraz sekwencją Shine-Dalgamo
(SD) genu bioA. Potencjalne struktury „stem-loop” zaznaczono przerywanymi strzałkami.
Figura 4 przedstawia kroki zmiany sekwencji w górę sekwencji od genu bioB dla przypadku wyjścia z plazmidu pbioB:: lacZ-2 dla konstrukcji ulepszonych miejsc wiązania rybosomów przy danych stosowanych miejscach cięcia enzymami restrykcyjnymi, każdorazowych sekwencjach Shine-Dalgamo (SD) oraz kodonie startowym bioB (Met). Przedstawiono
sekwencję w górę sekwencji od genu bioB oraz końca 5' genu bioB. Linie kreskowane oznaczają wstawiony oligonukleotyd 985E. Nukleotydy przekreślone powinny wedle teorii występować, nie ma ich jednak w plazmidzie pbioB:: lacZ/985E oraz w wyprowadzonych z niego
plazmidach pbioB:: lacZ/9 oraz bioB:: lacZ/16. co powoduje w rezultacie utratę miejsca BamHI (BamHI). „fill-in”: uzupełnienie za pomocą polimerazy Klenowa.
Figura 5 przedstawia schemat budowy plazmidów pBO30A-15/9 oraz BO30A-15/9 orfiI.
Figura 6 przedstawia sekwencję DNA i aminokwasową genu kodującego w plazmidzie
pBO30A-15/9 biosyntezę biotyny wraz z genetycznymi elementami kontrolnymi (SD: sekwencja Shine-Dalgarno). Aminokwasy przedstawione kursywą na końcu COOH genu
bioD15 przedstawiają substytucje w stosunku do sekwencji dzikiego typu genu bioD E. coli.
Figura 7 przedstawia schemat budowy plazmidu pB 074 B wychodząc z plazmidów
pB074-13 oraz pB03; strzałki podają położenie oraz orientację promotora tac oraz genu bio.
Udział wektora plazmidów wytłuszczono. Linie przerywane przedstawiają zakres delecji genu
bioB.
Na figurach 2 oraz 5 zastosowano następujące oznaczenia: A: AatII; B: BamHI: Bg:
BgI I ; C: ClaI; E: EcoRI: H: HindIII; K: KpnI; N: NcoI; Nr: Nru:I; P: PstI; S: SnoI; Sa: SalI;
Se: SseI: Sp: SphI; Ss: SspI oraz X: XbaI. „fill-in” uzupełnienie recesywnych końców 3' za
pomocą polimerazy Klenowa; mbn: usunięcie wystających końców 5'- lub 3' za pomocą nukleazy Phaseolus aureus (nukleaza mung bean); Bal31: progresywna delecja DNA egzonukleaza Bal3 1. Udział wektora plazmidów wytłuszczono. Za pomocą różnie zakreskowanych
elementów oznaczono części plazmidów zastosowane każdorazowo w następującym po tym
etapie klonowania. Strzałki podają położenie i orientację genów bio.
Aby skonstruować wskazane fragmenty DNA i wektory, geny operonu biotyny najpierw celowo wyodrębnia się z chromosomu odpowiedniego mikroorganizmu, a następnie
wzajemnie się łączy pod kontrolą elementów regulujących geny, takich jak promotory i miejsca wiązania rybosomów, tak by znalazły się one w jednej jednostce transkrypcyjnej. Materiałem wyjściowym do izolowania genów bio mogą być szczepy bakteryjne z rodziny enterobakterii, np. gatunku Escherichia, Salmonella lub Citrobacter. Celowo materiałem wyjściowym jest mikroorganizm gatunku Escherichia coli, który jest najlepiej scharakteryzowany.
Konstrukcja omawianych fragmentów DNA i wektorów może nastąpić biorąc za punkt
wyjścia np. bank genów odpowiedniego mikroorganizmu, takiego jak E. coli, z którego
w znany sposób można wyodrębnić i klonować geny bio lub ich fragmenty przez hybrydyzację znaczonymi oligonukleotydami zawierającymi częściowe sekwencje genów bio. Następnie wyodrębnione i klonowane geny bio są przy pomocy znanych metod rekombinacji DNA
pod kontrolą wspólnego promotora wzajemnie łączone, tak aby utworzyły pojedynczą jednostkę transkrypcyjną. Celowo ustawia się geny bio w ten sposób, że gen bioA znajduje się
w kierunku przeciwnym do genów bioB, bioF, bioC oraz bioD. które już są obecne w jednostce transkrypcyjnej w operonie dzikiego typu E. coli. Gen bioB koduje syntazę biotynową kluczowy enzym całej drogi syntezy biotyny, ponieważ przemiana detiobiotyny w biotynę
przy udziale syntazy biotynowej stanowi dotąd stadium określające szybkość pięcioetapowej
179 166
5
drogi syntezy biotyny. Gen bioB jest zatem celowo pierwszym genem w obrębie w jednostki
transkrypcyjnej, ponieważ z powodu bliskości promotora może nastąpić optymalna ekspresja
tego genu (fig. 2, 4, 5 oraz 6).
Druga jednostka transkrypcyjna w operonie dzikiego typu biotyny E. coli, która zawiera
gen bioA, obejmuje ponadto dalszy gen, ORFI, kodujący polipeptyd o 158 aminokwasach.
Próby przeprowadzone z plazmidami ekspresyjnymi, w których nie było żadnego genu ORFI
wykazują, że gen ten w zwykłych warunkach fermentacji nie ma zasadniczego znaczenia dla
biosyntezy biotyny. N ie można jednak wykluczyć, że wspomniany polipeptyd o dotychczas
nieznanej funkcji w określonych warunkach także odgrywa pewną rolę w syntezie biotyny.
Choć obecność genu ORFI we fragmentach DNA istotnych z punktu widzenia obecnego wynalazku również nie jest absolutnie niezbędna, jednostka transkrypcyjna z genami bio w celowej postaci wykonania zawiera dodatkowo także gen ORFI (fig. 2, 5 oraz 6).
We fragmentach DNA oraz wektorach istotnych dla realizacji obecnego wynalazku geny bio korzystnie nie znajdują się pod kontrolą naturalnego promotora biotyny E. coli.
W znacznie większym stopniu geny bio dla polepszenia transkrypcji celowo są ustawione pod
kontrolą silnego obcego promotora. Wybór promotora zależy od żądanych warunków ekspresji, np. od tego, czy pożądana jest ekspresja konstytutywna czy też indukowana lub też od
mikroorganizmu, w którym ma nastąpić ekspresja. Odpowiednimi promotorami są np. promotory P L oraz P R fagu Lambda (por. Schauder i in., Gene 52: 279-283; 1987), promotor
pxylS plazmidu TOL Pseudomonas putida z sąsiednim genem regulatorem xylR (Franklin
i in., J. Bacteriol. 154: 676-685; 1983), promotor trc (Amann i in., Gene 69: 301-315; 1988),
promotor trp (Amann i in., Gene 25: 167-178; 1983), promotor pdegQ z Bacillus subtilis,
czynny w fazie stacjonarnej (Dahl i in., J. Bacteriol. 173: 1539-1547; 1991) oraz promotor
lacUV5 (Amann i in., Gene 25: 167-178; 1983). Jako promotor jest korzystnie wybrany promotor tac, hybryda z promotora trp i lacUV5 z E. coli, który można zastosować jako promotor
konstytutywny lub indukowalny (Russell i Bennett, Gene 20: 231-243; 1982).
Ponadto ustalono, że ekspresję genu bioA w wyżej opisanym korzystnym ustawieniu
można jeszcze udoskonalić, gdy odległość między genami bioD i bioA jest możliwie najkrótsza, tzn. korzystnie jest mniejsza niż 50 bp (par zasad). Nieoczekiwanie stwierdzono, że ekspresja jest szczególnie wysoka, gdy sekwencja końca 3' genu bioD, który koduje zakończenie
COOH syntetazy detiobiotynowej (DTB), zawiera równocześnie miejsce wiązania rybosomów następującego po nim genu bioA. Korzystnie występuje równocześnie nakładanie się
genów bioD i bioA. Tego rodzaju konstelację można osiągnąć, gdy podda się fuzji koniec 5'
genu bioA razem z ich miejscem wiązania rybosomów z genem bioD, tak że koniec 3' jest
podstawiony przez sekwencję z miejscem wiązania rybosomów w górę sekwencji od genu
bioA i , w danym przypadku, końcem 5' genu bioA (fig. 3 i 6; Seq. ID nr: 1, 6 i 8-16). Efekt
ten jest tym bardziej zaskakujący, że przy tego rodzaju fuzji zakończenie COOH syntetazy
DTB można wymienić, bez utraty aktywności enzymu. Podobne nakładanie się występuje
także w operonie biotyny dzikiego typu E. coli między rastrami odczytu genów bioB, bioF,
bioC i bioD.
Ekspresję genu bioB można przez optymalizację miejsca wiązania rybosomów genu
bioB jeszcze zwiększyć. Celowo wychodzi się tu z konstruktu, w którym gen bioB juz znajduje się pod kontrolą silnego promotora, np. promotora tac. Optymalizacja miejsca wiązania
rybosomów genu bioB. tzn. zmiana sekwencji Shine-Dalgarno i ich odległości od końca 5'
genu struktury, może nastąpić za pomocą zwykłych metod rekombinacji DNA. Wpływ określonego miejsca wiązania rybosomów na translację można określić w znany sposób, np. przez
fuzję genu badanego z genem lacZ i następującą po tym próbę z chromogennym substratem 5-bromo-4-chloro-3-indolilo-ß-D-galaktopiranozydem (X-Gal).
Fragmenty DNA obejmujące geny bio w jednostce transkrypcyjnej, można wbudować
przy pomocy znanych technik rekombinacji DNA w wiele wektorów. W ten sposób otrzymano np. plazmidy pB030A-15/9 (fig. 5 i 6, Seq. ID nr: 1 i 6; przykład 1.5.2) oraz pB 047 (przykład 1.7). Plazmid pB030A-15/9 złożono 28.9.1992 w Deutsche Sammlung für Mikroorganismen und Zellkulturen GmbH, D-3300 Braunschweig, Mascheroderweg 1b, w E. coli XL1Blue oraz E. coli BM4062 pod numerami zgłoszenia DSM 7246, względnie 7247 oraz
6
179 166
17.9.1993 w E. coli ED8767 pod numerem zgłoszenia DSM 8554. Plazmid pB 047 złożono
17.9.1993 w Deutsche Sammlung für Mikroorganismen und Zellkulturen GmbH, w Agrobacterium/Rhizobium sp. HK4 pod numerem zgłoszenia DSM 8555.
Zależnie od rodzaju wybranych wektorów można poddać ekspresji geny dla enzymów
drogi syntezy biotyny w różnych organizmach. Jako wektory nadają się zarówno wektory
o specyficznym, jak też wektory o szerokim spektrum gospodarzy (ang.: „broad host range”).
Przykładami wektorów o specyficznym spektrum gospodarzy np. dla E coli są pBR322 (Bolivar i in., Gene 2: 95-113;1977), pUC18/19 (Yanisch-Perron i in., Gene 33: 103-119; 1985),
K18/19 (Pridmore, Gene 56: 309-312; 1987) oraz pRA95 (można otrzymać z Nycomed
Pharma AS, Hvidovre, Dania).
Jako wektory o „szerokim spektrum gospodarzy” można zastosować wszystkie wektory, które są odpowiednie dla bakterii Gram-ujemnych. Przykładami takich wektorów o „szerokim spektrum gospodarzy” są pRK290 (Ditta i in., Proc. Natl. Acad. Sei. USA 77: 73477351; 1980), pKT240 (Bagdasarian i in., Gene 26: 273-282; 1983), pochodne pRK290, jak
pLAFRl (Long i in., Nature 298: 485-488; 1982) oraz pRK290X (Alvarez-Morales i in.,
Nuci. Acid. Res. 14: 4207-4227; 1986), pochodne pKT240, jak pMMB66EH (Fürste i in.,
Gene 48: 119-131, 1986) lu b pGSS33 (Sharpe, Gene 29: 93-102;1984).
Do wytwarzania szczepów produkcyjnych dla fermentacji, tzn. szczepów dla produkcji
biotyny, należy fragment DNA według niniejszego wynalazku wstawić w żądane i odpowiednie dla ekspresji szczepy gospodarza. Mikroorganizmami odpowiednimi dla ekspresji genów
bio, korzystnie szczepów o szerokim spektrum substratów, są np. enterobakterie, korzystnie
gatunku Escherichia lub mikroorganizmy gatunku Rhizobium, Agrobacterium, Rhizobium/Agrobacterium, Acinetobacter, Pseudomonas oraz Comamonas. Szczególnie korzystne
są mikroorganizmy gatunku E. coli, Rhizobium/Agrobacterium s. HK4 (jako opisano w EP-B
158 194), Pseudomonas mendocina, Pseudomonas aeruginosa lub Acinetobacter calcoaceticus. Mikroorganizmy mogą zawierać fragment DNA istotny dla sposobu według wynalazku
na cząsteczce wektora lub zintegrowany w swoim chromosomie. Wstawienie fragmentu DNA
w mikroorganizmy może np. nastąpić przez transformację lub koniugację. Celowo transformuje się wybrane mikroorganizmy znanym sposobem wektorami, które zawierają wskazane
fragmenty DNA. Odpowiednimi szczepami produkcyjnymi są np. E. coli XL 1-Blue, E. coli
BM4062 i E. coli ED8767, każdorazowo zawierając plazmid pB030A-15/9 (DSM 7246,
DSM 7247 i DSM 8554) i Agrobacterium/Rhizobium sp. HK4 z plazmidem pB 047 (DSM
8555).
Wyodrębnienie transformowanych szczepów gospodarza następuje celowo z selektywnej pożywki, do której dodaje się antybiotyk, wobec którego szczepy gospodarza są odporne
dzięki genowi markera znajdującemu się na wektorze lub fragmencie DNA.
Jak wspomniano, obecny wynalazek realizuje sposób wytwarzania biotyny, obejmujący
przemianę detiobiotyny w biotynę w układzie bezkomórkowym za pomocą enzymu syntazy
biotynowej, w którym przemiana dokonuje się w obecności tiaminopirofosforanu, NADPH,
S-adenozylometioniny, jonów Fe2+, cysteiny i co najmniej jeszcze jednego aminokwasu z
grupy obejmującej: asparaginę, kwas asparaginowy, glutaminę i serynę.
Syntazę biotynową można zastosować bądź w postaci oczyszczonej lub w postaci ekstraktu komórkowego. Celowo uzyskuje się ekstrakt komórkowy lub oczyszczoną syntazę
biotynową ze szczepu o zwiększonej ekspresji tej syntazy, np. z E. coli XL 1-Blue z plazmidem pB030A-15/9 (DSM 7246). Wytwarzanie ekstraktu komórkowego i ewentualnie
oczyszczanie syntazy biotynowej może nastąpić według metod typowych w biochemii,
np. przez homogenizację komórek, filtrację żelową, frakcjonowanie siarczanu amonowego
i chromatografię jonowymienną.
Ustalono, że przemianę detiobiotyny w biotynę w układzie bezkomórkowym za pomocą
syntazy biotynowej można przeprowadzić z dobrymi wydajnościami tylko wtedy, gdy następuje ona przy dodaniu kofaktorów i aminokwasów.
Kofaktory niezbędne dla przemiany obejmują S-adenozylometioninę (SAM), tiaminopirofosforan (TPP), zredukowany fosforan adeninodinukleotydu amidu kwasu nikotynowego
179 166
7
(NADH) oraz jony Fe2+. Kofaktory dodaje się celowo w stężeniach od 1 do 500 μM. Do mieszaniny dodaje się także celowo ditiotreitol (DTT) w stężeniu od 0,1 do 10 mM.
Aminokwasami niezbędnymi dla przemiany są cysteina jako donor siarki i co najmniej
jeden inny aminokwas z grupy obejmującej: asparaginę, kwas asparaginowy, glutaminę i serynę. Kwas asparaginowy dodaje się celowo w postaci asparaginianu. Cysteinę dodaje się
celowo w stężeniach od 10 do 500 μM, dalsze aminokwasy w stężeniach od 1 do 50 mM.
Ponadto stwierdzono, że przemiana detiobiotyny w biotynę przy zastosowaniu oczyszczonej syntazy biotynowej zachodzi jedynie w obecności flawodoksyny i reduktazy ferredok
syno(flawodoksyno)-NADP+. Stąd celowo dodaje się przy przemianie, zwłaszcza gdy syntazę
bioty nową stosuje się nie w postaci ekstraktu komórkowego, flawodoksynę i reduktazę ferre
doksyno(flawodoksyno)-NADP+. Flawodoksyna i reduktaza ferredoksyno(flawodoksyno)NADP+ (EC nr 1.18.1.2) są znanymi proteinami, które w znany sposób, np. przez frakcjonowanie siarczanu amonowego i następnie chromatografię jonowymienną i chromatografię
z filtracją żelową, niezależnie od syntazy biotynowej można otrzymać z ekstraktów komórkowych E. coli. Tak np. flawodoksynę i reduktazę ferredoksyno(flawodoksyno)-NADP+ można wyodrębnić zarówno z E. coli XL1-Blue z plazmidem pB030A-15/9 (DSM 7246), wykazującym zwiększoną ekspresję syntazy biotynowej, jak również z E. coli XL 1-Blue z plazmidem pB074 B (DSM 7245), w którym gen syntazy biotynowej bioB uległ delecji (fig. 7).
Plazmid pB 074 B w E. coli XL 1-Blue złożono 28. 9. 1992 w Deutsche Sammlung f ür Mikroorganismen und Zellkulturen GmbH, D-3300 Braunschweig, Mascheroderweg 1b, pod
numerem zgłoszenia DSM 7245.
Ponadto stwierdzono, że dla przemiany detiobiotyny w biotynę oprócz syntazy biotynowej potrzebne są dalsze proteiny, które w typowy sposób są zawarte w ekstrakcie komórkowym E. coli. Proteiny te są zawarte we frakcji proteinowej, którą można uzyskać z ekstraktów komórkowych E. coli przez wytrącanie siarczanem amonowym przy 45% nasyceniu.
Jak wynika z wyodrębniania takiej frakcji proteinowej z E. coli XL 1-Blue z plazmidem
pB074 B (DSM 7245), ekspresja syntazy biotynowej nie jest niezbędna dla obecności oraz
uzyskania tej proteiny. Osad uzyskany po wytrącaniu solą amonową można dalej oczyścić np.
metodami chromatograficznymi, takimi jak chromatografia jonowymienna i chromatografia
z filtracją żelową. Dlatego do mieszaniny reakcyjnej (przemiana detiobiotyny w biotynę),
zwłaszcza gdy nie stosuje się syntazy biotynowej w postaci ekstraktu komórkowego, dodaje
się wyżej opisaną frakcję proteinową.
Przemiana odbywa się w odpowiednim układzie buforowym, celowo wewnątrz obszarów pH i temperatury, w których enzymy są czynne fizjologicznie, korzystnie w obszarze pH
od 6 do 9 i w temperaturze między 4 a 50°C.
Niniejszy wynalazek zostanie objaśniony bliżej przez poniższe przykłady.
Ogólne metody
Endonukleazy restrykcyjne zastosowano według danych producenta w ilości od 3 do
5 jednostek/ng DNA. Znaczenie i fosforylowanie linkerów DNA (uzyskanych z Boehringer
Mannheim, RFN) dla wbudowywania miejsc cięcia enzymami restrykcyjnymi i syntetycznych oligonukleotydów (uzyskanych z Microsynth, Windisch, CH), np. do zastosowania jako
sondy dla hybrydyzacji DNA/DNA i jako „primer” dla reakcji sekwencjonowania, nastąpiły
przy użyciu kinazy T4-polinukleotydowej (Boehringer Mannheim, RFN) według Sambrooka i
in. (Molecular Cloning: A laboratory manual. 2nd edition, Cold Spring Harbour Laboratory.
Cold Spring Harbour, NY; 11.31 i 5.68; 1989). Reakcje ligacji przeprowadzono przy użyciu
ligazy T4-DNA według danych wytwórcy.
Sekwencjonowanie DNA przeprowadzono według metody przerwania łańcucha według
Sangera i in. (Proc. Natl. Acad. Sci. USA 94: 5463-5467; 1977). Wszystkie reakcje sekwencyjne przeprowadzono przy użyciu zestawu do sekwenazy z United States Biochemicals
(Cleveland, OH, USA) według protokołu wytwórcy. Sekwenaza (wersja 2,0, polimeraza T7DNA zmieniona za pomocą technik genetycznych) dała równomierne, dobrze czytelne sekwencje DNA o ponad 600 bp. Kompresje w obszarach DNA bogatych w GC można było
łatwo rozwiązać, jeśli zamiast dGTP zastosowano nukleotyd dITP. Jako matryce dla reakcji
sekwencyjnej stosowano z reguły jednoniciowe postacie wektorów M13mp18/19 (Yanisch-
8
179 166
Perron i in., 1985, ibid.) lub pBluescript KS+/SK+ (apR lacZ’: można uzyskać z Stratagene,
L a Jolla, CA), które wyodrębniono według (Methods Enzymol. 101: 20-79; 1983). Dla sekwencjonowania dwuniciowego plazmidowego DNA, plazmidowe DNA oczyszczono
za pomocą gradientów CsCl lub „Gene Clean” (BIO 101, La Jolla, CA). Jako nukleotyd znaczony radioaktywnie użyto α-[35S]-dATP (NEN-Du Pont, NEG-034H). Rozdzielenie elektroforetyczne nastąpiło bądź przez typowe 4%, względnie 6% żele bis/akrylamidowe z 7 M
mocznika oraz 1 x buforem TBE (90 mM Tris, 90 mM kwasu bornego, 2,5 mM EDTA), lub
przez żele z 5% HydroLink Long Ranger (AT Biochem, Malvern, PA, USA, via Chemie
Brunschwig, Basel) z 7M mocznika i 1,2 x buforem TBE. Żele miały 550 mm długości
i 0,2 mm grubości; elektroforeza nastąpiła w aparaturze makroforowej LKB z termostatem
przy napięciu 2100 V i temperaturze 60°C. Następnie żele suszono na papierze 3 MM Whatmana i poddano autoradiografii przy użyciu filmu rentgenowskiego Fuji RX lub Amersham
Hyperfilm ßmax.
Wyodrębnienie pozachromosomowego DNA wykonano bądź w małych ilościach według metody „szybkiego alkalicznego SDS” („Miniprep”) według Birnboima i Doły (Nucl.
Acid. Res. 7: 1513-1523; 1979), lub, dla wyodrębnienia większych ilości, przez odwirowywanie gradientów gęstości chlorku cezu według zmodyfikowanej metody Clewell i Helsinki
(Proc. Natl. Acad. Sei. USA 42: 1159-1166; 1969). Alternatywnie zastosowano pakiety
QIAGEN Fa. DIAGEN, Düsseldorf (RFN).
Aby przekształcić E. coli plazmidem DNA, komórki uczyniono „kompetentnymi” według Cohen i in. (Proc. Natl. Acad. Sei. USA 69: 2110-2114; 1972) w 50 mM CaCl2- Przekształcenie DNA plazmidowego i selekcja klonów noszących plazmidy nastąpiła według
Sambrookai in., (1989; ibid. 1.82-1.84).
P r z y k ł a d I. Klonowanie operona biotyny E. coli w pojedynczej jednostce transkrypcyjnej.
I.1. Konstrukcja pBO1 oraz M13bioD.
Dla klonowania genów bio wyodrębniono chromosomowe DNA z E. coli DSM 498
(KI2 Typ dziki; Deutsche Sammlung fur Mikroorganismen und Zellkulturen GmbH). Wyodrębnienie wykonano zasadniczo według Hahna i Hennecke (Mol. Gen. Genet. 193: 46-52;
1984). Następnie 2 μg całkowitego DNA z E. coli DSM 498 przecięto enzymem restrykcyjnym PstI. Fragmenty DNA rozdzielono elektroforetycznie w horyzontalnym żelu agarozowym 0,7% w zwykły sposób (Sambrook i in., 1989, ibid.; 6.19 do 6.9) i przeniesiono na
membrany „Gene Screen” (membrany nylonowe NEN-Du Pont) (Southern, J. Mol. Biol., 98:
503-517; 1975). DNA utrwalono przez dwugodzinną inkubację w 80°C w piecu próżniowym
na wysuszonych filtrach. W celu identyfikacji fragmentów DNA operonem bio poddano jako
sondę syntetyczny oligonukleotyd o długości 25 nukleotydów o sekwencji 5'G GCTCACC
GCCCACGCTGGACATTG-3', odpowiadającej sekwencji z końca 5' genu bioB (Otsuka,
A.J., Dysertacja, University o f California, San Diego, CA; 1978) hybrydyzacji z DNA związanym z filtrem. Następnie 40 pMoli tego oligonukleotydu z kinazą polinukleotydową T4
i -[32P]-ATP (75 μ Ci) znaczono na końcu. Hybrydyzację DNA związanego z radioaktywnie
znaczoną sondą przeprowadzono według Sambrook i in., (1989, ibid., 9.52-9.55). Następnie
prehybrydyzowano DNA 2 godz. w 5 x roztworze Denhardta (1 x roztwór Denhardta: 0,02%
albumina osocza krwi wołu, 0,02% Ficoll, 0,01% poliwinylopirolidon), 6 x bufor SSC (1 x
SSC: 150 mM NaCl, 15 mM cytrynian sodowy, pH 7,2) oraz 150 (μg/ml DNA ze spermy łososia, a następnie hybrydyzowano 18 godz. w 2 x roztworze Denhardta, 6 x SSC, 0,5% SDS,
150 μg/ml DNA ze spermy łososia, 2 godz. przemywano i ostatecznie czterokrotnie przemyto
każdorazowo 30 min. w 2 x SSC, 0,1% SDS. Temperatura podczas wszystkich etapów wyniosła 65°C. Znaczony oligonukleotyd hybrydyzował na tym „Southern biot” z fragmentem
Pstl o 5,4 kb.
Dla sklonowania tego fragmentu 5,4 kb PstI z operonem biotyny przecięto najpierw
50 μg całkowitego E. coli DSM 498 przy użyciu PstI i rozdzielono na żelu agarozowym 0,7%
jak wyżej. Fragmenty o wielkości 4,5 kb do 6,5 kb wycięto z żelu i wyodrębniono przez
elektrodializę w wężach do dializy. Około 0,6 μg tych fragmentów poddano ligacji z 0,6 μg
wektora pHE3 przeciętego PstI (Hennecke i in., Gene 19: 231-234; 1982). Wektor ten zawiera
179 166
9
gen oporności na chloramfenikol (CmR), replikon Co1E 1 z pACYC184 (Chang i Cohen,
J. Bacteriol., 134: 1141-1156; 1978) jak również gen pheS z E. coli syntetazy-tRNAfenyloalaninowej, charakteryzujący się miejscem PstI.
0,2 ml „kompetentnych” komórek E coli RR28 (Hannecke i in., 1982, ibid.) w 50 mM
CaCl2 transformowano przy użyciu powyższego tworu ligacyjnego. E. coli RR28 ma w chromosomie mutowany gen pheS (pheS12) i dlatego jest oporny na p-fluorofenyloalaninę
(pFphe) na podłożu wzrostu. Jeśli RR28 jest nośnikiem plazmidu pHE3 z genem dzikiego
typu pheS, szczep jest wrażliwy na pFphe. Wstawienie fragmentów DNA w miejsce cięcia
PstI pHE3 przerywa gen dzikiego typu pheS: stąd RR28 z rekombinowanym plazmidem jest
oporny na pFphe (pFpheR). Transformowane komórki przełożono na pożywce minimalnej
(7,1 g/l Na2HPO4, 13,6 g/l KH2PO4, 13,6 g/l KH2PO4, 0,014 g/l CaCl2 x 2H2O, 0,25 g/l
MgSO4, 1,58 g/l (NH4)2SO4, 15 g/l agaru, 4 g/l glukozy, 0,005 g/l tiaminy, 0,05 g/l leucyny,
0,05 g/l proliny, 0,2 g/l D,L-p-fluorofenyloalaniny, 0,02 g/l chloramfenikolu; (Hennecke i in.,
1982 ibid.) i wyodrębniono ok. 2500 klonów pFpheR CmR, zawierających plazmid pHE3
(CmR) z insertem w genie pheS (pFpheR). 600 tych klonów replikowano na filtrze z nitrocelulozy, leżącym na płytkach z pożywką agarową (NA) (NA: zasada agarowa krwi (Oksoid).
40 g/l; ekstrakt drożdży (Oksoid), 5 g/l z 20 μg/ml Cm. Na filtry z wyrosłymi koloniami
(3-5 mm średnicy) podziałano według procedury Grunsteina i Hognessa (Proc. Natl. Acad.
Sci. USA 72: 3961-3965; 1975), aby poddać komórki lizie i wiązać uwalniany DNA. Filtr
z uległymi lizie i utrwalonymi komórkami E coli poddano hybrydyzacji z wyżej opisanym
oligonukleotydem bioB o 25 nukleotydach znaczonym 32P. Hybrydyzacja nastąpiła według
modyfikacji dla hybrydyzacji kolonii według Sambrooka i in., (1989, ibid., 11.00), tzn. prehybrydyzacja, hybrydyzacja i pierwsza operacja przemywania nastąpiły w 4 x roztworze
Denhardta, 6 x SSC, 100 μg/ml DNA ze spermy łososia, po czym nastąpiło 6 x przemywanie
w 2 x SSC. Temperatura wyniosła 65°C. 3 klony związały oligonukleotyd bioB; z jednego
z klonów wyodrębniono plazmid pBO1 o fragmencie PstI (fig. 2) o 5,4 kb. Analizy restrykcyjne i porównanie z danymi publikowanymi (Szybalski, Szybalski, Gene 19: 93-103;1982)
wykazały, że pBO1 zawierało wszystkie geny operonu biotyny z wyjątkiem bioD.
W celu klonowania genu bioD zastosowano sondę z częściami genów bioC oraz bioD,
składającą się z fragmentu SphI/PstI z pBO1 o długości 520 bp. Fragment ten wyodrębniono
z żelu agarozowego i 0,2 μg wyodrębnionego fragmentu znaczono radioaktywnie (Sambrook
i in., 1989, ibid. 10.8) za pomocą translacji „Nick” polimerazą I DNA (Boehringer Mannheim, RFN; Holoenzym z E. coli; tą tzw. Polimerazę Kronberga zastosowano wraz z DNazą I)
oraz 25 μCi α-[32P]-dATP (NEN-Du Pont, NEG-012H). Hybrydyzacja tej sondy na „Southern
biot”, jak opisano powyżej, przy użyciu chromosomu fragmentu restrykcyjnego E. coli
DSM498 wytworzonego przez SspI wykazała z jednej strony fragment SspI o 1,6 kb znany
z pBO1 z bioF i bioC, a z drugiej strony fragment SspI o 1,1 kb z bioD i sekwencjach sąsiadującego genu uvrB (Sancar i in., Celi, 28: 523-520; 1982).
W celu klonowania fragmentu SspI o 1,1 kb znów nałożono częściowy bank genów.
30 μg DNA E. coli DSM498 poddano cięciu za pomocą SspI i rozdzielono na żelu agarozo
wym 0,7%. Fragmenty o wielkości od 0,9 kb do 1,3 kb wycięto i wyodrębniono przez elektrodializę. 0,5 μg tych fragmentów poddano ligacji z 0,5 μg fagowektora M 13mp19 ciętego
SmaI (Yanisch-Perron i in., 1985, ibid.). Przy użyciu tego tworu ligacyjnego nastąpiła transfekcja E. coli JM109 (Yanisch-Perron i in., 1985, ibid.) według Messing (Methods Enzymol.,
101: 20-79; 1983). 150 klonów fagowych z insertem (fenotyp LacZ') wyodrębniono i namnożono w pożywce NYB. Po odwirowaniu komórek E. coli naniesiono fagi każdorazowo
w 50 μl pozostałości przy użyciu aparatury Schleicher & Schuell „minifold I” jako „dot biot”
na filtrze nitrocelulozowym (Schleicher & Schuell BA 85). W celu denaturacji fagów na filtry
przez 5 min. podziałano buforem 0,1 M NaOH/1,5 M NaCl, a następnie zneutralizowano
0,5 M Tris-HCl, pH 7,5/2,5 M NaCl (5 min.). DNA utrwalono na filtrze przez inkubację
(2 godz.) w 80°C. Filtr, tak jak opisano (Sambrook et al., 1989, ibid., 9.52-9.55), zhybrydyzowano ze znaczonym radioaktywnie fragmentem Sphl/Pstl o 520 bp w 60°C. W ten sposób
zidentyfikowano klon fagu M13bioD o wyżej opisanym fragmencie SspI o 1,1 kb, zawierającym gen bioD (fig. 2).
10
179 166
I.2. Konstrukcja pBO2.
Każdorazowo poddawano cięciu 0,5 μg plazmidu pBO1 i 0,5 μg fagu M13bioD enzymem restrykcyjnym SnoI und HindIII i poddano powtórnej ligacji. Po transformacji E. coli
RR28 otrzymanym tworem ligacyjnym badano rekombinowane plazmidy za pomocą analizy
restrykcyjnej. Wybrano plazmid pB 02 (fig. 2), w którym fragment SnoI/HindIII z pBO1
o ok. 1,5 kb, zawierający część genu bioD i niezasadnicze sekwencje wektora pHE3, jest zamieniony przez fragment Snol/Hindlll (0,95 kb) z M13bioD. Analiza wykazała, że plazmid
pB 02 zawierał kompletny operon bio, tak jak w E. coli, wraz z sekwencjami promotora uvrB
(Sancar et al., Celi 28: 523-530; 1982) w dół sekwencji od bioD.
I.3. Konstrukcja pB 03 i pB06.
Zaobserwowano, że E. coli RR28 z pB 02 na płytkach NA słabiej rośnie niż przy użyciu
pBO1 i tworzy wyraźnie mniejsze kolonie. Powodem tego mogą być sekwencje uvrB w pB02.
W celu delecji tych sekwencji, 20 μg pB02-D N A przecięto przy użyciu HindIII i umieszczono w 150 μl buforu Bal31 (600 mM NaCl, 12,5 mM MgCh, 12,5 mM CaCl2, 1 mM EDTA,
20 mM Tris-HCl, pH 7,2). Następnie w celu stopniowego skracania liniowych plazmidów
dodano Bal31 (z Alteromonas espejiani, Boehringer Mannheim, RFN). Po 3, 6, 9, 12 i 15 min.
inkubacji w 30°C pobierano próbki każdorazowo 30 μl i reakcję Bal31 zatrzymano przez dodanie każdorazowo 2 μl 0,5 M EGTA (kwasu etylenoglikolo-bis-(2-aminoetylo)-czterooctowego), pH 7,5, a następnie ekstrakcję fenolem. Potem przeniesiono próbki do 40 μl bufora nukleazy (mung bean) z Phaseolus aureus (30 mM octanu sodowego, 50 mM NaCl, 1 mM
ZnCh, 5% gliceryny, pH 4,6) oraz podziałano nukleazą Phaseolus aureus (Boehringer Mannheim, RFN) przez 10 min. w 37°C w celu usunięcia niesparowanych pojedynczych końców
nici oraz wytworzenia końców „stępionych”.
Przy działaniu Ba l 3 1 usuwane nie tylko sekwencje uvrB. lecz także zasadnicze sekwencje wektora pHE3. Zatem skrócone plazmidy pBO2 po działaniu nukleazą z Phaseolus
aureus rozcięto EcoRI. aby usunąć część DNA wektora pHE3, skróconą przez Bal31. Następnie zregenerowano pierwotną sekwencję wektora przez ligację plazmidu pB 02, na który
działano z fragmentem DNA (1,5 kb), który po cięciu BamHI. działaniu nukleazą z Phaseolus
aureus oraz dalszym cięciu EcoRI wyodrębniono z pB 02 i który posiada uprzednio deletowane zasadnicze sekwencje wektora pHE3. Ponieważ wskutek tej ligacji zregenerowano
w pełni oporność Cm, można rozpoznać nienaruszone plazmidy na podstawie ich właściwości: oporności przeciw Cm.
E. coli RR28 transformowano przy użyciu tworów ligacyjnych i przełożono na płytkach
NA μ l /ml Cm. Zaobserwowano małe, powoli rosnące kolonie typowe dla przypadku BO2
oraz wielkie, normalnie rosnące kolonie. Liczba wielkich kolonii na próbkę pBO2 wzrastała
wraz z trwaniem inkubacji Bal3 1.
Z 22 normalnie rosnących kolonii wyodrębniono plazmid DNA i zbadano za pomocą
analizy restrykcyjnej i sekwencyjnej. W ten sposób otrzymano plazmidy pB 03 i pB 06,
w których poddano delecji 330 bp, względnie 410 bp obszaru uvrB, lecz które jednak wciąż
zawierały gen bioD.
I.4. Klonowanie genów bio w jednostce transkrypcyjnej.
I.4.1. Konstrukcja pBO22: promotor tac przed bioB.
Dla wbudowania odpowiedniego promotora przed genem bioB należy usunąć niepożądany promotor dzikiego typu przed genami bioBFCD. Może to nastąpić przez cięcie za pomocą NcoI, wskutek czego równocześnie odsłania się kodon startowy genu bioB. W danym
przypadku wybrano w charakterze promotora tac (Russell i Bennett, 1982, ibid.), ponieważ
może on być zastosowany jako promotor konstytutywny lub indukowalny i wykazuje bardzo
dobrą aktywność nie tylko w E. coli, ale również w wielu innych bakteriach Gram-ujemnych.
Fragment DNA z promotorem tac z końcami HindIII oraz BamHI uzyskano z Pharmacia-LKB (Uppsala, Szwecja) i wbudowano w plazmid pUC18 pocięty HindIII i BamHI
(Yanisch-Perron i in., 1985, ibid.). W wyniku uzyskano plazmid pUC 18/tac (fig. 2). 8 μg tego
plazmidu cięto następnie BamHI. a dla wypełnienia recesywnych końców 3' za pomocą po
limerazy Klenowa (Polimeraza I DNA z E. coli; Boehringer Mannheim, RFN) w buforze polimerazy Klenowa (20 mM Tris-HCl, pH 7,5, 10 mM MgCh, 6 mM P-merkaptoetanol) inku-
179 166
11
bowano przy dodatku po 100 μM dATP, dGTP, dCTP i dTTP. Następnie wykonano drugie
cięcie przy użyciu AatII. W ten sposób, przy użyciu promotora tac, można było wyodrębnić
fragment DNA o długości 0,55 kb.
Fragment 3,2 kb z genami bioB, bioF. bioC oraz końcem 5' genu bioD wyodrębniono
zp B O 1. Ponadto poddano cięciu 8 μg pBO1 za pomocą NcoI. a następnie dla wypełnienia
recesywnych końców 3' poddano jak wyżej działaniu polimerazy Klenowa. Następnie wykonano drugie cięcie przy pomocy PstI, po czym nastąpiło wyodrębnienie żądanego fragmentu
o 3,2 kb. Na koniec, 4 μg wektora pHE3 poddano cięciu przy użyciu PstI oraz AatII i wyodrębniono z pHE3 replikon P15A (Hannecke i in., 1982, ibid.).
Te trzy fragmenty poddano w równomolowych ilościach ligacji wystających i gładkich
końców przy użyciu ligazy T4-DNA (Boehringer Mannheim, RFN), przy czym każdorazowo
ligowano wystające końce Pstl przy pomocy PstI, AatII - przy pomocy AatII z gładkimi końcami BamHI i NcoI. Przy ligacji końca BamHI uzupełnionego za pomocą polimerazy Klenowa z poddanym również obróbce NcoI regeneruje się miejsca cięcia BamHI i NcoI. E. coli
RR28 poddano transformacji przy użyciu uzyskanego tworu ligacyjnego i selekcjonowano na
CmR. DNA plazmidu transformowane przez CmR zbadano za pomocą analizy restrykcyjnej.
W ten sposób otrzymano plazmid pB021 (fig. 2), w którym promotor tac znajduje się przed
genem bioB. Wskutek delecji fragmentu HindIII o 1,5 kb z pBO21, charakteryzującego się
niezasadniczymi sekwencjami z wektorów plazmidów pHE3 i pUC18, otrzymano ostatecznie
pBO22 (fig. 2).
I.4.2. Konstrukcja pBO27 i pBO28.
5 μg pBO22 poddano cięciu za pomocą PstI, a wystający koniec PstI skrócono przez
działanie nukleazą z Phaseolus aureus do gładkiego końca. Następnie poddano cięciu za pomocą SnoI i wyodrębniono otrzymany fragment DNA o 6,8 kb. Wyodrębniono fragment
DNA o 0,76 kb z końcem 3' genu bioD z 5 μg pBO3 po restrykcji za pomocą ClaI, dopełniono wystające końce ClaI za pomocą polimerazy Klenowa i cięto przy użyciu SnoI. Obydwa
fragmenty DNA ligowano za pomocą ligazy T4-DNA, a następnie E. coli transformowano za
pomocą tego tworu ligacyjnego. Po selekcji na chloramfenikolu otrzymano z transformantu
CmR po analizie restrykcyjnej plazmid pBO27. Plazmid ten zawiera promotor tac wraz z genami bioB, bioF, bioC i kompletnym genem bioD w jednostce transkrypcyjnej (fig. 2).
W celu delecji miejsca cięcia BamHI w pBO27, poddano cięciu 5 μg pB 027 za pomocą
BamHI, inkubowano za pomocą polimerazy Klenowa i nukleotydu dGTP jak opisano wyżej,
a następnie poddano działaniu nukleazy z Phaseolus aureus. Po powtórnej ligacji tego DNA
ligazą T4-DNA i transformacji E. coli DH5 (Hanahan, J. Mol. Biol. 166: 557-580; 1983)
otrzymano plazmid pB 028, w którym miejsce cięcia BamHI uległo delecji, podczas gdy
miejsce ciecia NcoI zostało zachowane (fig. 2).
I.4.3. Konstrukcja M 13biol8 oraz M13bio18/13.
W celu usunięcia niepożądanego promotora dzikiego typu przed genem bioA najpierw
wyodrębniono przez cięcie 5 μg pBO3 za pomocą BgIII oraz KpnI fragment o 4,4 kb z genami bioB, bioF, bioA i ORFI. 0,5 μg tego fragmentu poddano ligacji z 0,5 fig wektora fagu
M13mp18 ciętego za pomocą BamHI oraz KpnI (Yanisch-Perron i in., 1985, ibid.). Po transformacji E. coli JM109 (Yanisch-Perron i in., 1985, ibid.) tym tworem ligacyjnym zidentyfikowano (według Messinga, 1983, ibid.) rekombinowane klony fagowe, które posiadały insert.
Wyodrębniono dwuniciowe fagi DNA z takich klonów i zbadano za pomocą analizy restrykcyjnej. W ten sposób otrzymano fag M13bio18 z żądanym fragmentem o 4,4 kb (fig. 2).
25 μg dwuniciowego DNA fagu M13bi1 8 zlinearyzowano przez cięcie za pomocą
NcoI. wprowadzono do 160 μl buforu Bal31 i następnie dodano Bal31 w celu usunięcia promotora bioA. Po 20, 40, 60, 80, 100 i 120 sekundach inkubacji w temperaturze pokojowej
pobierano próbki po 25 μl i zatrzymywano reakcję Bal31 przez dodanie 2 μl 0,5 M EGTA, pH
7,5 oraz ekstrakcję fenolem. Każde 3 próbki łączono i poddano cięciu za pomocą XbaI, aby
usunąć geny bioB i bioF. Następnie poddano DNA działaniu polimerazy Klenowa jak wyżej,
aby wystające końce 5' dopełnić do gładkich końców. Po takie obróbce DNA poddano powtórnej ligacji, a E. coli JM109 poddano transformacji ligowanym DNA. Z 24 klonów fagowych wyodrębniono jednoniciowy DNA (Messing, 1983, ibid.), a sekwencję DNA na końcu
12
179 166
5' genu bioA zanalizowano według Sangera i in., (1977; ibid.). W ten sposób otrzymano klon
fagu M13bk)18/13, w którym promotor dzikiego typu przed genem bioA uległ delecji
i w którym równocześnie występuje miejsce cięcia SalI 26 bp w górę sekwencji od genu bioA
(fig. 2).
I.4.4. Konstrukcja M13bioDA.
Aby umieścić geny bioD oraz bioA w jednostce transkrypcyjnej poddano cięciu 5 μg
plazmidu pBO6 za pomocą SphI i SalI. Wyodrębniono otrzymany fragment DNA o długości
0,97 kb, zawierający gen bioD i 72 bp DNA w dół sekwencji od genu bioD az do końca SalI.
2 μg M13bio18/13 również poddano cięciu za pomocą SphI i SalI. Fragmenty DNA poddano
ligacji ligazą T4-DNA i za pomocą otrzymanego produktu transformowano JM109 E. coli.
Z 24 rekombinowanych klonów wyodrębniono dwuniciowe DNA fagu i scharakteryzowano
za pomocą analizy restrykcyjnej. W ten sposób otrzymano klon M13bioDA. w którym geny
bioD oraz bioA są oddalone o 98 bp (fig. 2).
I.4.5. Konstrukcja pBO30.
Dla skonstruowania jednostki transkrypcyjnej z promotorem tac przed genami bio poddano cięciu 5 ng DNA M13bioDA za pomocą EcoRI. dla dopełnienia wystających końców
EcoRI poddano działaniu polimerazy Klenowa, a następnie cięciu za pomocą SnoI. Wyodrębniono otrzymany fragment DNA o długości 2,6 kb z genami bioD, bioA i ORFI. 5 μg plazmidu pBO28 (fig. 2) poddano cięciu za pomocą Sali, podziałano nukleazą z Phaseolus aureus dla odłączenia wystających końców SalI, a następnie poddano cięciu za pomocą SnoI.
Wyodrębniono fragment DNA o długości 6,7 kb z wektorem DNA, promotorem tac i genami
bioBFC. Wyodrębnione fragmenty DNA poddano ligacji za pomocą ligazy T4-DNA i transformowano za pomocą tego tworu ligacyjnego biotyno-auksotropowy szczep E. coli SA291
(Campbell, J. Bacteriol. 112: 830-839; 1972). Przez przełożenie na płytkach NA za pomocą
20 μg/ml Cm i 8 μg/ml awidyny wyselekcjonowano klony o kompletnym operonie biotyny
w plazmidzie. Plazmidy z takich klonów zbadano za pomocą analizy restrykcyjnej. W ten
sposób otrzymano plazmid pB 030, zawierający geny bioB, bioF, bioC, bioD i bioA oraz gen
ORFI wraz z promotorem tac w jednostce transkrypcyjnej (fig. 2).
I.5. Konstrukcja plazmidów o ulepszonej ekspresji genów bio.
I.5.1. Konstrukcja pBO30A-9 i pBO30A-15.
W minikomórkach E. coli DS410 (Dougan i Sheratt, Mol. Gen. Genet. 151: 151-160;
1977) z plazmidem pBO30 aminotransferaza DAPA kodowana przez gen bioA jest znacznie
słabiej eksprymowana niż inne enzymy dla syntezy biotyny. Przy próbie polepszenia ekspresji
genu bioA skrócono odległość między genem bioD i genem bioA za pomocą egzonukleazy
Bal3 1. aby usunąć możliwe zakłócające sekwencje, takie jak „stem-loop”. Następnie 25 μg
BO30 poddano cięciu za pomocą SalI i podziałano egzonukleazą Bal31 i polimerazą Klenowa, jak opisano wyżej. Przez ligację z syntetycznym oligonukleotydem o sekwencji 5'-CGT
CGACG-3', linkerem SalI, zregenerowano miejsce cięcia SalI. Następnie DNA poddano cięciu za pomocą SalI i SnoI i wyodrębniono fragmenty bioD o długości ok. 640 bp skróconych
na końcu 3'. Fragmenty te poddano ligacji z fragmentem z pB 030 o 8,25 kb, wyodrębnionym
po cięciu tego plazmidu za pomocą SalI i SnoI i zawierającym niezmieniony gen bioA.
Biotyno-auksotropowy szczep E. coli SA291 transformowano powyższym tworem liga
cyjnym, aby następnie za pomocą 60 μg/ml Cm i 5 μg/ml awidyny wyselekcjonować na płytkach NA klony z nienaruszonym genem bioD. Otrzymano 26 takich klonów, które zbadano
za pomocą analizy restrykcyjnej. 8 spośród tych klonów o widocznym skróceniu obszaru
w górę sekwencji od miejsca Sali scharakteryzowano dokładniej za pomocą analizy sekwencyjnej DNA. W pięciu z tych klonów były, jak tego oczekiwano, deletowane odcinki od 20 do
45 bp DNA między genem bioD i bioA. W minikomórkach E. coli klony te wywołały faktycznie zwiększoną ekspresję genu bioA o czynnik 2 w stosunku do pBO30. Przykładem plazmidu o ulepszonej ekspresji tego rodzaju jest otrzymany w ten sposób plazmid pB030A-9
(fig. 3).
Nieoczekiwanie wyodrębniono trzy dalsze plazmidy, w których były deletowane odcinki od 70 do 90 bp DNA między genem bioD i genem bioA. Delecje sięgały także do genu
struktury bioD. Z tego wynikły: (i) każdorazowo zróżnicowany koniec COOH syntetazy DTB
179166
13
bez dużej zmiany aktywności enzymu i (ii) nakładanie zmienionych genów bioD i rastru odczytu bioA. W ten sposób otrzymano np. plazmid pBO30A-15 z mutantem genu bioD-bioD15
(fig. 3, 5 i 6). W minikomórkach E. coli z BO30A-15 ekspresja bioA jest w porównaniu do
B 030 zwiększona o czynnik 4. Sekwencje DNA obszaru bioDA i wyprowadzone stąd sekwencje aminokwasów plazmidów pBO30, pBO30A-9 i pBO30A-15 przedstawiono na fig. 3
(Seq. ID nr 9-16).
I.5.2. Konstrukcja plazmidów o ulepszonym miejscu wiązania rybosomów przed genem
bioB.
W celu polepszenia translacji genu bioB, którego ekspresja w pB 030 jest wyraźnie
słabsza niż np. genu bioD, zmodyfikowano sekwencję w górę sekwencji od genu bioB
w pBO30, który obejmuje promotor tac i miejsce wiązania rybosomów, zawarte w klonowanym fragmencie promotora tac. Wstawiono tu syntetyczne, tzw. mieszane („mixed”) oligonukleotydy ze zmiennymi sekwencjami przed genem bioB. W celu prostego wyboru korzystnych miejsc wiązania rybosomów zastosowano próbny plazmid o translacyjnej fuzji genów:
bioB: :lacZ, pbioB: :lacZ-2. pbioB: :lacZ-2 jest w części wektora, w promotorze tac z miejscem wiązania rybosomów i w końcu 5' genu bioB identyczny z plazmidem pBO22 (fig. 2).
W miejscu cięcia NruI o nukleotydzie 326 genu struktury bioB uległy delecji koniec 3' genu
bioB oraz pozostałe geny bio i wbudowano gen lacZ E. coli (Casadaban i in., Methods Enzymol. 100: 293-308; 1983) w taki sposób, że bioB i lacZ poddano fuzji w poprawnym rastrze
odczytu dla ekspresji proteiny fuzji bioB: :lacZ oraz, że zregenerowano miejsce cięcia NruI.
W plazmidzie pbioB: :lacZ-2 wstawiono w szeregu etapach oligonukleotyd 985E o sekwencji 5'-CATGGAATCCTCCACTGATCAGTAC-3' przed genem bioB (fig. 4). Następnie rozdzielono pbioB: :lacZ za pomocą BamHI. a wystające końce BamHI dopełniono, jak
opisano, za pomocą polimerazy Klenowa. W trakcie tych etapów widocznie niespecyficznie
deletowano resztę guaninową (G), czego następstwem była utrata miejsca cięcia BamHI
w późniejszych plazmidach. Po wstawieniu linkera KpnI transformowano XL 1-Blue E. coli
(Bullock i in., Biotechniques 5: 376-379; 1987) za pomocą tworu ligacyjnego i wyodrębniono
plazmid bioB: :lacZ/KpnI. Plazmid ten poddano częściowo cięciu za pomocą N co I a następnie cięciu za pomocą KpnI. Po ligacji z oligonukleotydem 985E dopełniono drugą nić DNA
za pomocą polimerazy Klenowa. Po transformacji XL 1-Blue E. coli i selekcji na płytkach NA
za pomocą 20 μg/ml Cm, 30 μg/ml X-Gal i 0,5 mM IPTG (izopropylotiogalaktozyd) wyodrębniono plazmid pbioB: :lacZ/985E (fig. 4). Plazmid pbioB: :lacZ/985E poddano dalszej
modyfikacji, wycinając miejsce wiązania rybosomów przez restrykcję za pomocą KpnI oraz
SpeI i zamieniając przez trzy różne oligonukleotydy, SD17, SD19 oraz SD21 (fig. 4). Po ligacji tymi oligonukleotydami zamknięto lukę w drugiej nici przez inkubację polimerazą Klenowa. Komórki bakterii XL 1-Blue E. coli transformowano za pomocą tego DNA i jak wyżej
przełożono na płytkach N A za pomocą 20 μg/ml Cm, 30 μg/ml X-Gal i 0,5 mM IPTG. Wybrano 20 klonów o dobrej ekspresji proteiny fuzji bioB: :lacZ. które na tej pożywce utworzyły
ciemnobiałe kolonie i zmierzono aktywność β-galaktozydazy tych klonów za pomocą próby
enzymu według Millera (Experiments in Molecular Genetics, Cold Springs Harbor Laboratory, Cold Springs Harbor, N.Y., str. 352-355; 1972). Ponadto uprzednio wyhodowano szczepy
E. coli z plazmidami bio: :lacZ w pożywce płynnej aż do gęstości optycznej przy 600 nm
( O D 600) około 0,5.
Najwyższą aktywność β-galaktozydazy wykazały plazmidy pbioB: :lacZ/985, pbioB:
:lacZ/16 i pbioB: :lacZ/9 (fig. 4), dla których aktywność β-galaktozydazy w porównaniu
z pbioB: :lacZ-2 wzrosła o czynnik 2,1 3,4, względnie 5,9. Sekwencję DNA zoptymalizowanych miejsc wiązania rybosomów dla genów bioB w tych plazmidach określono według Sangera i in., (1997, ibid.).
W celu wbudowania zoptymalizowanych miejsc wiązania rybosomów w jednostkę transkrypcyjną z genami bio poddano cięciu każdorazowo 5 μ g plazmidów pbioB: :lacZ/985E,
pbioB: :lacZ/16 lub pbioB: :lacZ/9 za pomocą ClAI i NruI i wyodrębniono fragment DNA
o
długości 550 bp z promotorem tac, każdorazowym miejscem cięcia rybosomów i końcem 5'
genu bioB. Równocześnie poddano cięciu 5 μg plazmidu pBO30 A (fig. 5) za pomocą ClAI
i NruI i wyodrębniono fragment DNA o długości 7,7 kb. W pBO30 A, wyprowadzonym
14
179 166
z pBO30, uległ delecji fragment SalI/BamHI ze znaczną częścią genu bioA i zakłócającym
miejscem cięcia NruI (fig. 5). Obydwa fragmenty poddano ligacji i wyodrębniono klony
z rekombinowanymi plazmidami. W ten sposób otrzymano plazmidy pBO30 A/9, pBO30
A/16 oraz pBO30 A/985. Fig. 5 przedstawia taką konstrukcję na przykładzie pBO30 A/9
z miejscem wiązania rybosomów z pbioB: :lacZ/9.
Po 2 μg plazmidów pBO30 A/9, pBO30 A/16 oraz pBO30 A/985E poddano cięciu za
pomocą SnoI i KpnI. przy czym KpnI użyto w małej ilości, aby ciąć jedynie częściowo. Następnie wyodrębniono każdorazowo fragmenty DNA o długości 6,6 kb, zawierające wektor
DNA, promotor tac, gen bioB z ulepszonym miejscem wiązania rybosomów i geny bioFC.
Plazmid pBO30A-15 (4 μg) również poddano cięciu za pomocą SnoI i NcoI i wyodrębniono
fragment 2,8 kb z genami bioDA-ORFI. Wyodrębnione fragmenty poddano ligacji i RR28
E. coli poddano transformacji tą mieszanką ligacyjną. Rekombinowane plazmidy z kompletnym operonem biotyny zidentyfikowano przez analizę restrykcyjną. W ten sposób otrzymano
plazmidy pBO30-15/9, pBO30A-15/16 oraz pBO30A-15/985E. Zawierały one wszystkie
zoptymalizowany obszar bioDA z pBO30A-15 z odpowiadającymi zoptymalizowanymi miejscami wiązania rybosomów z plazmidów pbioB: :lacZ/9. pbioB: :lacZ/16. względnie pbioB:
:lacZ/985E. Genetyczne elementy kontrolne tych plazmidów, mianowicie kombinacja z promotora tac i zoptymalizowanego miejsca wiązania rybosomów, które są bezpośrednio powiązane z genem bioB i oddziałują na jego skuteczną ekspresję, wykazują następujące sekwencje:
5'—AAGCTTACTC CCCATCCCCC TGTTGACAAT TAATCATCGGCTCGTATAAT GTGTGGAATT
GTGAGCGGAT AACAATTTCA CACAGGAAAC AGGATCGGTACCTTAGGAGG TGACTAGTC—3'
pBO30A—1 5 / 1 6
( S e q ID N r :
18)
5'-AAGCTTACTC CCCATCCCCC TGTTGACAAT TAATCATCGG CTCGTATAAT GTGTGGAATT
GTGAGCGGAT AACAATTTCA CACAGGAAAC AGGATCGGTACCTAAGGAGG TTTACTAGTC-3'
pBO30A—1 5 / 9
( S e q ID N r :
19)
5 '—AAGCTTACTC CCCATCCCCC TGTTGACAAT TAATCATCGGCTCGTATAAT GTGTGGAATT
GTGAGCGGAT AACAATTTCA CACAGGAAAC AGGATCGGTACCTAAGGAGA CTAGTC— 3'
Figura 5 przedstawia konstrukcję plazmidów zawierających geny bioB, bioF, bioC,
bioD i bioA wraz ze zoptymalizowanym miejscem wiązania rybosomu, na przykładzie konstrukcji pBO30A-15/9.
Zsekwencjonowano całą jednostkę transkrypcyjną genów bio w BO30A-15/9. Sekwencję i wyprowadzone z niej produkty genowe przedstawiono na fig. 6 (Seq. ID nr: 1-8).
I.6. Konstrukcja pBO30A- 15/9DorfI.
2 μg plazmidu pBO30 A/9 poddano cięciu jak wyżej za pomocą SnoI i KpnI i wyodrębniono fragment DNA o długości 6,6 kb. 4 μg plazmidu pBO30A-15 poddano cięciu
za pomocą Sspi . Przez ligację otrzymanego liniowego DNA z linkerem KpnI o sekwencji 5'CGGTACCG-3' dodano w dół sekwencji od genu bioA nowe miejsce KpnI. Po cięciu za pomocą SnoI wyodrębniono fragment o 2,1 kb z genami bioDA. Wyodrębnione fragmenty DNA
poddano ligacji i RR28 E. coli transformowano otrzymaną mieszanką ligacyjną. Rekombinowane plazmidy z genami bioBFCDA zidentyfikowano przez analizę restrykcyjną. W ten sposób otrzymano BO30A-15/9 orfI z delecją genu ORFI (fig. 5).
179 166
15
I.7. Konstrukcja plazmidu pBO47.
5 μg plazmidu pBO30A-15/9 poddano cięciu enzymami restrykcyjnymi XbaI i EcoRI.
Otrzymany fragment restrykcyjny o 5,8 kb z promotorem tac i operonem biotyny wyodrębniono, a następnie poddano z ligacji z plazmidem pRK290X o „szerokim spektrum gospodarzy” (Alvarez-Morales i in., Nuci. Acid. Res. 14: 4207-4227, 1986; zmodyfikowany przez
delecję miejsca restrykcyjnego XhoI i dodanie miejsca XbaI w tej samej pozycji), który również poddano cięciu XbaI i EcoRI. S 17-1 (Simon i in., Biotechnology 1: 784-791; 1983)
E. coli transformowano tworem ligacyjnym. Rekombinowane plazmidy scharakteryzowano
przez analizę restrykcyjną. W ten sposób otrzymano plazmid pBO47, zawierający operon
biotyny wcielony w pRK290X.
Przez koniugację ze szczepem E. coli S17-1/pB047 plazmid pBO47 przeniesiono do
szczepów bakteryjnych Rhizobium/Agrobacterium sp. HK4, Pseudomonas mendocina, Pseudomonas aeruginosa PA01 (Holloway, J. Gen. Microbiol. 13: 572-581; 1955) i Acinetobacter
calcoaceticus DSM 588.
I.8. Konstrukcja pBO74 B.
Konstrukcji plazmidu pBO74 B z delecją genu bioB dokonano wychodząc z plazmidu
pBO74-13 (fig. 7). Plazmid pBO74-13 składa się z równych elementów DNA, jak pBO30
(fig. 2). Następstwo w szeregu genów bio w obrębie plazmidu pBO74-13 jest jednak różne.
5 μg plazmidu pBO74-13 poddano cięciu za pomocą SmaI. Po ekstrakcji fenolem/chloroformem DNA plazmidu poddano cięciu za pomocą SphI i wyodrębniono fragment
0 6 kb zawierający DNA wektora, promotor tac, geny bioA-ORFI oraz bioCD. 18 μg plazmidu pBO3 (fig. 2) poddano cięciu za pomocą SspI i SphI i wyodrębniono fragment 1,66 kb
z genem bioF i częścią genu bioC. Wyodrębnione fragmenty poddano wzajemnej ligacji
i RR28 E. coli transformowano za pomocą otrzymanej mieszanki ligacyjnej. Rekombinowane
plazmidy zanalizowano za pomocą analizy restrykcyjnej. W ten sposób otrzymano plazmid
pBO74B, różniący się od plazmidu pBO74-13 delecją genu bioB (fig. 7).
P r z y k ł a d II. Wytwarzanie biotyny z detiobiotyny (mierzenie reakcji syntazy biotynowej in vitro).
II. 1. Wytwarzanie ekstraktów komórkowych E. coli.
Wytworzono po jednym ekstrakcie komórkowym z E. coli XL1-Blue (DSM 7246)
z plazmidem pBO30A-15/9 (ekstrakt Z) i jednym ekstrakcie komórkowym z E. coli XL1Blue z plazmidem pBO74 B (DSM 7245; ekstrakt W). Ponadto komórki mikroorganizmu
w 37°C hodowano w objętości 800 l o OD600 w pożywce zawierającej 20 g/l Nutrient Broth,
5 g/l ekstraktu drożdży i 20 mg/l Cm. Komórki zebrano przez sączenie, a następnie w 5000 x g
wirowano przez 15 min.
W celu wytworzenia bezkomórkowego ekstraktu komórki przemyto 100 mM buforem
HEPES (pH 7,5), a następnie w takim buforze powtórnie przeprowadzono w stan zawiesiny,
aby doprowadzić OD600 do około 1000 i podziałano DNAzą. Potem komórki rozrywano
w ciągłym homogenizatorze komórkowym przy 100000 Pa. Produkt homogenizacji wirowano
przez 30 min. przy 20000 x g, a uzyskaną pozostałość przechowywano w -80°C. Ekstrakt Z
mógł być zastosowany do mierzenia (badania) reakcji syntazy biotynowej bezpośrednio lub
też dopiero po oczyszczeniu przez filtrację żelową na kolumnie załadowanej przez Sephadex
G25M PD-10 (Pharmacia, objętość kolumny: 9,1 ml). Ekstrakt W zastosowano bezpośrednio
do badania reakcji syntazy biotynowej lub poddano frakcjonowaniu według przykładu II.3.
II.2. Próba in vitro reakcji syntazy biotynowej (próba standardowa).
W próbie in vitro badano przemianę detiobiotyny znaczonej 14C (0,1 μCi; 1,95 nmoli)
do biotyny znaczonej 14C albo przemianę nie znaczonej detiobiotyny z cysteiną znaczoną 35S
(20 μCi; 1 32 nmoli) do biotyny 35S przy użyciu enzymu (syntaza biotynowa). Utworzoną
przy tym 14C-biotynę lub 35S-biotynę można było po ekstrakcji łatwo oznaczyć przez ilościowe HPLC na detektorze radiochemicznym „on-line” lub półilościowo za pomocą chromatografii cienkowarstwowej, a następnie nałożenie błony rentgenowskiej i autoradiografię.
Typowa próba standardowa składała się z ekstraktu bezkomórkowego Z lub W, ze znaczonej lub nie znaczonej detiobiotyny, w zależności od reakcji lub oczyszczonych z nich
frakcji protein (przykłady II.7-II.9) pojedynczo lub w połączeniu między sobą i/lub ze zwy-
16
179 166
kłych kofaktorów, takich jak SAM (92 (J.M), glukonian Fe2+(200 μM), NADH (100 μM), TPP
(100 μM), DTT (1 mM) i/lub z kombinacji aminokwasów. Frakcje protein, kofaktory lub
aminokwasy podlegające badaniu dodano do końcowej objętości 250 μL. Inkubacja następuje
w temperaturze między 4 a 50°C. Po jednogodzinnej inkubacji w 37°C reakcję zatrzymano
przez dodanie 12% wag. kwasu trój chlorooctowego (TCA) w wodzie. Wytrąconą proteinę
odwirowano, a pozostałość naniesiono na stało-fazową kolumnę ekstrakcyjną C18
(MACHERE-Y-NAGEL, 100 mg), którą kondycjonowano metanolem (1 ml), wodą (1 ml)
i kwasem octowym (1% obj.) w wodzie. Następnie tę kolumnę przemyto 1 ml 1% kwasu
octowego i 1 ml wody, aby wymyć biotynę i detiobiotynę za pomocą 0,5 ml metanolu. Uzyskane próbki osuszono pod próżnią, powtórnie utworzono zawiesinę w 30 μl buforu A HPLC
(25 mM KH2PO4, 5 mM chlorku tetrabutyloamoniowego, pH 3,4), aby następnie 25 μl
wstrzyknąć w HPLC dla celów analizy ilościowej. Warunki HPLC były następujące: kolumna
Shandon-Hypersil-BDS-C18 (wielkość cząstek: 5 mm, wielkość kolumny 10 mm x 2,0 mm),
szybkość przepływu 0,35 ml/min., temperatura 40°C, eluent: bufor HPLC A zaw. 10% obj.
acetonitrylu.
Po zmieszaniu strumienia eluatu z roztworem do pomiaru scyntylacji (Zinsser Quickszint Flow 303; szybkość przepływu: 1,25 ml/min.) wykryto i oznaczono ilościowo nie
przetworzoną 14C-detiobiotynę oraz utworzoną 14C-biotynę bądź utworzoną 35S-biotynę (detektor radioaktywności „on-line”: Berthold).
Alternatywnie zanalizowano próbki półilościowo za pomocą chromatografii cienkowarstwowej i autoradiografii. Ponadto przeprowadzono próbki powtórnie w stan zawiesiny
w 20 μ1 mieszaniny składającej się z 10% kwasu octowego, 65% metanolu i 25% wody
i naniesiono 2,5 jj .1 na płytkę silikażelową „high performance” do chromatografii cienkowarstwowej (E. Merck, Darmstadt). Płytkę rozwinięto za pomocą fazy rozwijającej, składającej
się z chloroformu (17 ml), metanolu (3 ml) i kwasu mrówkowego (0,2 ml). Po tym płytkę
osuszono i na noc nałożono film rentgenowski.
II.3. Reakcja syntazy biotynowej w obecności aminokwasów.
Gdy poddano inkubacji demineralizowany bezkomórkowy ekstrakt Z z detiobiotyną
według przykładu II.2 i kofaktorami SAM, TP, NADPH i glukonianem Fe2+, nie zaobserwowano żadnej przemiany detiobiotyny w biotynę. Gdy dodano cysteinę (332 μM) i asparaginę
(15 mM) lub cysteinę i asparaginian (15 mM) lub cysteinę i glutaminę (15 mM) lub cysteinę
i serynę (15 mM) z kofaktorami według przykładu II.4 do tego bezkomórkowego ekstraktu,
można było stwierdzić produkcję biotyny.
Tabela 1
Skład prób
-„-
Pmole wytworzonej biotyny
Ekstrakt Z1
-„-
0
+ kofaktory2
0
+ aminokwasy3
0
+ kofaktory2+ aminokwasy3
780
1) demineralizowany;
2) kofaktory: SAM, Fe2+, TPP, NADPH;
3) Cys + Asn lub Cys + Asp, lub Cys + Gin, lub Cys + Ser.
II.4. Reakcja syntazy biotynowej w obecności jednego lub więcej typowych kofaktorów.
Gdy poddano inkubacji ekstrakt roślinny, taki sam jak opisany w przykładzie II.3, zL cysteiną, asparaginą, detiobiotyną SAM, TPP, NADPH i glukonianem Fe2+, detiobiotyną
uległa przemianie w biotynę. Aby zbadać wpływ tych kofaktorów na reakcję syntazy biotynowej, zastosowano ją pojedynczo lub w kombinacji między sobą. Jedynie przy użyciu
wszystkich tych kofaktorów stwierdzono aktywność syntazy biotynowej. W przypadku braku
kofaktora, nie można było zmierzyć aktywności syntazy biotynowej. Oznacza to, że wszystkie kofaktory są niezbędne dla aktywności syntazy biotynowej (przykład II.3, tabela 2).
179 166
17
II.5. Oczyszczanie syntazy biotynowej.
Aby wykazać, że oprócz syntazy biotynowej za przemianę detiobiotyny w biotynę odpowiedzialnych jest szereg protein, bezkomórkowy ekstrakt Z poddano najpierw frakcjonowaniu siarczanem amonowym. Przeprowadzono to przez nasycanie ekstraktu 25% siarczanem
amonowym mieszając przez 30 min. w 4°C. Następnie odwirowywano przy 10000 x g przez
30 min. i otrzymany osad odrzucono. Uzyskaną pozostałość nasycono 70% siarczanem amonowym, przy czym wytrącono syntazę biotynową. Osad ponownie przeprowadzono w zawiesinę w małej objętości 100 mM buforu HEPES (pH 7,5), demineralizowano (Sephadex G25M
PD-10), następnie oczyszczono za pomocą chromatografii anionowymiennej (Q-Sepharose
Fast-Flow, Pharmacia), z ciągłym gradientem 100 mM - 1 M buforu HEPES (pH 7,5). Frakcje
o aktywności syntazy biotynowej poddano zatężeniu (komora ultrafiltracyjna Amicon, membrana YM-10), demineralizowano jak opisano wyżej, a następnie poddano powtórnie chromatografii na kolumnie chromatografii anionowymiennej „Hi-Load” Q-Sepharose (Pharmacia; 20 mM bufor Tris (pH 7,5) zawierający 1 mM DTT i gradient 0-1 M NaCl).
Frakcje o wysokiej aktywności syntazy biotynowej połączono, zatężono i demineralizowano. W tych frakcjach syntaza biotynową nie była już zanieczyszczona innymi proteinami, niezbędnymi dla aktywności syntazy biotynowej.
Aby zmierzyć aktywność syntazy biotynowej podczas operacji oczyszczania, niezbędne
było dodanie do mieszaniny badanej (przykład II.2) ekstraktu B. Wskutek tego za przemianę
detiobiotyny w biotynę są obok syntazy biotynowej odpowiedzialne jeszcze inne proteiny.
II.6. Frakcjonowanie protein z ekstraktu W.
Ekstrakt został wytrącony kolejno przy 45% i 55% nasycenia siarczanem amonowym.
Po dodaniu siarczanu amonowego całość mieszano w 4°C przez 30 min., a następnie odwirowywano przez 30 min. przy 10000 x g. Osad otrzymany przy 45% nasyceniu siarczanem
amonowym przeprowadzono powtórnie w stan zawiesiny w 100 mM buforu HEPES (pH 7,5).
Następnie pobrano i demineralizowano próbki osadu 45%, osadu 55% oraz pozostałości 55%
(kolumna Sephadex G25M PD-10). Oddzielne frakcje zbadano jak i w kombinacji frakcji
między sobą, zgodnie z przykładem II.2.
Otrzymano 2 frakcje niezbędne do syntazy biotynowej. Tymi frakcjami były:
- osad z nasycenia 45% siarczanem amonowym,
- pozostałość z 55% nasycenia siarczanem amonowym.
II.7. Oczyszczanie i identyfikacja flawodoksyny.
Pozostałość otrzymana z ekstraktu W po 55% nasyceniu siarczanem amonowym (przykład II.6), demineralizowano (kolumna Sephadex G25M PD-10), a następnie naniesiono
na kolumnę chromatograficzną anionowymienną (Q-Sepharose Fast-Flow (Pharmacia)). Kolumnę tą przedtem kondycjonowano 20 mM buforem Tris (pH 7,5) zawierającym 1 mM
DTT. Materiał nie związany usunięto przez wymycie tym buforem. Proteiny związane na tej
kolumnie wymyto ciągłym gradientem NaCl (0-1 M). Wymyte frakcje protein połączono,
zatężono (komora ultrafiltracyjna Amicon, membrana YM-10), demineralizowano (Sephadex
G25M PD -10), a następnie oczyszczono na kolumnie chromatograficznej mono Q-anionowymiennej, kondycjonowanej 20 mM buforem Tris (pH 7,0, zawierającym 1 mM DTT). Następnie zbadano oczyszczone frakcje za pomocą SDS-PAGE.
Aby podczas etapów oczyszczania zidentyfikować frakcje zawierające szukaną proteinę
wykonano zestaw prób syntazy biotynowej (przykład II.2) z oczyszczoną syntazą biotynową,
proteiną względnie proteinami z osadu z wytrącania 45% siarczanem amonowym, z aminokwasami (przykład II.3) i z niskocząsteczkowymi kofaktorami (przykład II.4). Aktywność
syntazy biotynowej można było zmierzyć jedynie we frakcjach, zawierających szukaną proteinę.
Następnie wyznaczono następująco sekwencję aminokwasową. Proteinę redukowano
przez 4 godz. DTT w 6 M buforze chlorowodorku guanidyny. Otrzymane próbki karboksymetylowano za pomocą kwasu jodooctowego, a następnie przez 48 godz. dializowano wobec
0,1% wodorowęglanu amonowego. Po suszeniu próbek strawiono je trypsyną świni w 7 M
buforze mocznikowym, a peptydy rozdzielono za pomocą HPLC z odwróconymi fazami. Zi-
18
179 166
dentyfikowano 2 peptydy z sekwencjami DNA odpowiednimi dla flawodoksyny z E. coli. Po
tych operacjach oczyszczania uzyskano homogenną flawodoksynę.
II.8. Oczyszczanie i identyfikacja reduktazy ferredoksyno(flawodoksyno)-NADP+.
Ekstrakt W wprowadzono na kolumnę chromatografii anionowymiennej (Q-Sepharose
Fast-Flow (Pharmacia)). Kolumnę tę kondycjonowano za pomocą 20 mM bufora Tris
(pH 7,5) zawierającego 1 mM TPP. Proteiny zatrzymane na kolumnie wymyto ciągłym gradientem NaCl (0-1 M). Wymyte frakcje proteinowe połączono i zatężono według przykładu II.7, demineralizowano i wprowadzono na kolumnę chromatografii anionowymiennej mo
no-Q. Proteiny zatrzymane na tej kolumnie wymyto ciągłym gradientem NaCl (0-0,4 M w 20 mM
buforze Tris). Następnie połączone wymyte frakcje proteinowe (jak wyżej opisano) zatężono
i demineralizowano na preparatywnej kolumnie chromatograficznej z filtracją żelową Superose 12 (Pharmacia; kondycjonowano 20 mM buforem Tris), a następnie wprowadzono na kolumnę z filtracją żelową Sephacryl HR100 (Pharmacia; kondycjonowano 20 mM buforem
Tris). Po wymyciu 20 mM buforem Tris otrzymano dalszą homogenną proteinę (badaną za
pomocą SDS-PAGE). Frakcje zawierające tę proteinę zidentyfikowano analogicznie do układu próbnego według przykładu II.7. Aktywność syntazy biotynowej zmierzono dopiero po
dodaniu tych frakcji.
Aby określić z tej proteiny N-końcową sekwencję aminokwasową, oczyszczoną proteinę bezpośrednio sekwencjonowano. Proteina miała N-końcową sekwencję aminokwasową
odpowiadającą reduktazie ferredoksyno(flawodoksyno)-NADP+. Wskutek tych operacji
oczyszczania otrzymano homogenną reduktazę ferredoksyny(flawodoksyny)-NADP+.
II.9. Wzbogacanie jednej lub większej liczby protein odpowiedzialnych za reakcję syntazy biotynowej.
Oczyszczona syntaza biotynowa (przykład II.2) nie wykazywała z oczyszczoną flawodoksynąi reduktazą ferredoksyny(flawodoksyny)-NADP+ oraz niezbędnymi kofaktorami, jak
również z aminokwasami żadnej aktywności. Aby osiągnąć aktywność szukano dalszej proteiny lub protein we frakcji 45% siarczanu amonowego.
Tę proteinę lub te proteiny otrzymano z bezkomórkowego ekstraktu W przez wytrącanie za pomocą siarczanu amonowego przy nasyceniu 45%. Otrzymany osad proteiny przeprowadzono ponownie w stan zawiesiny w 20 mM buforze Tris, pH 7,5, zawierającym 1 mM
DTT oraz TPP (1 g/l), a następnie demineralizowano na kolumnie PD-10 (Pharmacia).
Odsolony materiał wprowadzono następnie na chromatograficzną kolumnę anionowymienną
(Q-Sepharose HP Hi-Load), którą uprzednio kondycjonowano 20 mM buforem Tris, pH 7,5,
zawierającym 1 mM DTT oraz TPP (1 g/l). Frakcje proteinowe o żądanej aktywności wymyto
ciągłym gradientem NaCl (0 mM - 600 mM NaCl). Następnie te frakcje proteinowe dalej
oczyszczano za pomocą chromatografii z filtracją żelową (kolumna Sephacryl HR-100,
Pharmacia). Uzyskany osad proteiny przeprowadzono powtórnie w stan zawiesiny w 100 mM
buforze HEPES (pH 7,5), a następnie demineralizowano, jak opisano powyżej. Uzyskano
w wyniku tego roztwór proteiny, który zastosowano w próbie in vitro według przykładu II.2.
II.10. Reakcja syntazy biotynowej w obecności flawodoksyny, reduktazy ferredoksy
ny(flawodoksyny)-NADP+, jednej lub więcej protein odpowiedzialnych za reakcję syntazy
biotynowej, jednego lub więcej aminokwasów i typowych kofaktorów.
Do bezkomórkowego ekstraktu Z dodano flawodoksynę, reduktazę ferredoksyno(flawodoksyno)-NADP+ oraz jedną lub więcej protein odpowiedzialnych za reakcję syntazy
biotynowej. Dodanie protein, kofaktorów i aminokwasów wpłynęło na zwiększoną akty wność
syntazy biotynowej (tabela 2).
19
179 166
Ta b e l a 2
Pmole wytworzonej biotyny
Skład prób
390
Ekstrakt Z + kofaktory i aminokwasy
Ekstrakt Z + kofaktory + aminokwasy + flawodoksyna + reduktaza ferredoksy
no(flawodoksyno)-NADP+ + jedna lub więcej protein odpowiedzialnych za
reakcję syntazy biotynowej
1560
II.11. Reakcja oczyszczonej syntazy biotynowej w obecności kombinacji flawodoksyny,
reduktazy ferredoksyno(flawodoksyno)-NADP+, jednej lub więcej protein odpowiedzialnych
za reakcję syntazy biotynowej, jednego lub więcej aminokwasów i typowych kofaktorów.
Aby zbadać wpływ tych składników na reakcję oczyszczonej syntazy biotynowej,
składniki te użyto pojedynczo albo w kombinacji. Kofaktory użyto w identycznej ilości jak
w przykładzie II.4, a aminokwasy - jak w przykładzie II.3. Gdy wszystkie z tych składników
występowały, detiobiotyna przy użyciu oczyszczonej syntazy biotynowej przekształcała się
w pełni w biotynę. Gdy jednego z tych składników brakowało, nie stwierdzano aktywności.
Zatem do przekształcenia detiobiotyny w biotynę niezbędne są wszystkie te składniki (tabela 3).
Tabela 3
Skład prób
Pmole wytworzonej biotyny
0
Oczyszczona syntaza biotynowa
Oczyszczona syntaza biotynowa + flawodoksyna + reduktaza ferredoksyno(flawodoksyno)-NADP+ + jedna lub więcej protein odpowiedzialnych za reakcję
syntazy biotynowej + kofaktory + aminokwasy
800
ZESTAWIENIE SEKWENCJI
(1) INFORMACJA OGÓLNA:
(i) ZGŁASZAJĄCY:
(A) NAZWA: LONZA AG
(B) ULICA: Muenchensteinerstrasse 38
(C) MIEJSCOWOŚĆ: Basel
(E) KRAJ : Szwajcaria
(F) KOD POCZTOWY: 4002
(ii) TYTUŁ ZGŁOSZENIA: Sposób wytwarzania biotyny
(iii) LICZBA SEKWENCJI: 19
(iv) POSTAĆ CZYTANA PRZEZ KOMPUTER:
(A) NOŚNIK: Floppy disk
(B) KOMPUTER: kompatybilny z IBM PC
(C) SYSTEM OPERACYJNY: PC-DoS/MS-DOS
20
179166
(D) OPROGRAMOWANIE: Patentln Release 1.0, Version 1.25
(EPA)
(vi) POPRZEDNIE DATY ZGŁOSZENIA:
(A) NUMER ZGŁOSZENIA: CH 3124/92
(B) DATA ZGŁOSZENIA: 02-10- 1992
(v i ) POPRZEDNIE DATY ZGŁOSZENIA:
(A) NUMER ZGŁOSZENIA: CH 2134/93
(B) DATA ZGŁOSZENIA: 15-07-1993
(2) INFORMACJA O SEQ ID Nr: 1:
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 5872 par zasad
(B) RODZAJ: Kwas nukleinowy
(C) POSTAĆ NICI: Podwójna
(D) TOPOLOGIA: liniowa
(ii) RODZAJ CZĄSTECZKI: DNS (genomowa)
(iii) HIPOTETYCZNOŚĆ: NIE
(iii) ANTYSENSOWNOŚĆ: NIE
(v i ) PIERWOTNE POCHODZENIE:
(A) ORGANIZM: Escherichia coli
(B) SZCZEP: D5T1498
(vii) BEZPOŚREDNIE POCHODZENIE:
(B) KLON: p8030 A-15/9
(ix) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 117..1157
(C) RODZAJ OZNACZENIA: eksperymentalne
(D) POZOSTAŁE DANE: /codon_start= 117
179 166
/product= "biotin synthase"
/evidence= EXPERIMENTAL
/gene= "bioB"
/number= 1
(ix) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 2295. . 3050
(D) POZOSTAŁE DANE: /codon_start= 2295
/function= "involved in pimeloyl—CoA synthesis”
/product= "protein"
/gene= "bioC"
/number= 3
(ix) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 3750..5039
(C) RODZAJ OZNACZENIA: eksperymentalne
(D) POZOSTAŁE DANE: /codon_start= 3750
/EC number= 2.6.1.62
/product= "DAPA synthase"
/evidence= EXPERIMENTAL
/gene= "bioA"
/number= 5
/standard_name=
"S—Adenosyl— L—methionine:8—amino— 7— oxononaoate ami-
notransf."
(ix) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 5098..5574
(C) RODZAJ OZNACZENIA: eksperymentalne
(D) POZOSTAŁE DANE: /codon_start= 5098
/function= "unknown, involved in biotin synthesis"
/product= "protein"
/evidence= EXPERIMENTAL
/gene= "ORFI"
/number= 6
21
179 166
22
(ix) CECHY
(A) NAZWA/KLUCZ: -10_signal
(B) POŁOŻENIE: 45..49
(C) RODZAJ OZNACZENIA: eksperymentalne
(D) POZOSTAŁE DANE:
/evidence= EXPERIMENTAL
/standard_name= "promoter ptac"
(ix) CECHY
(A) NAZWA/KLUCZ: -35_signal
(B) POŁOŻENIE: 23..28
(D) POZOSTAŁE DANE:
/standard name= "promoter ptac"
(ix) CECHY
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 105..119
(C) RODZAJ OZNACZENIA: eksperymentalne
(D) POZOSTAŁE DANE:
/evidence= EXPERIMENTAL
/standard name= "bioB RBS no.9”
(ix) CECHY
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 2284..2297
(D) POZOSTAŁE DANE:
/standard name= "bio C RBS" i
(ix) CECHY
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 3742.. 3752
(D) POZOSTAŁE DANE: /standard name= "bio A RBS"
(ix) CECHY
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 5088..5100
(D) POZOSTAŁE DANE: /standard name= "ORFI RBS"
23
179 166
(ix) CECHY
(A) NAZWA/KLUCZ: terminator
(B) POŁOŻENIE: 5583..5644
(D) POZOSTAŁE DANE: /standard name= "rho— independent
transcriptional terminator"
(ix) CECHY
(A) NAZWA/KLUCZ: stem_loop
(B) POŁOŻENIE: 5583..5605
(ix) CECHY:
(A) NAZWA/KLUCZ: promotor
(B) POŁOŻENIE: 1..96
(C) RODZAJ OZNACZENIA: eksperymentalne
(D) POZOSTAŁE DANE: /function= "promoter ptac”
/evidence= EXPERIMENTAL
(x) INFORMACJA DOT. OPUBLIKOWANIA:
(H) NUMER DOKUMENTU: WO 87/01391 B 1
(I) DATA ZGŁOSZENIA: 26-08-1986
(J) DZIEŃ OPUBLIKOWANIA: 07-04-1993
(xi) OPIS SEKWENCJI SEQ ID Nr: 1:
AAGCTTACTC CCCATCCCCC TGTTGACAAT TAATCATCGG CTCGTATAAT GTGTGGAATT
60
GTGAGCGGAT AACAATTTCA CACAGGAAAC AGGATCGGTA CCTAAGGAGA CTAGTC
116
ATG GCT CAC CGC CCA CGC TGG ACA TTG TCG
164
Met Ala His Arg Pro Arg Trp Thr Leu Ser
1
5
10
CAA GTC ACA GAA TTA TTT
Gln Val Thr Glu Leu Phe
15
GAA AAA CCG TTG CTG GAT CTG CTG TTT GAA GCG CAG CAG GTG CAT CGC
Glu Lys Pro Leu Leu Asp Leu Leu Phe Glu Ala Gln Gln Val His Arg
20
25
CAG CAT TTC GAT CCT CGT CAG GTG CAG GTC
212
30
AGC ACG TTG CTG TCG ATT
26 0
24
1 7 9 166
Gln His Phe Asp Pro Arg Gln Val Gln Val Ser Thr Leu Leu Ser Ile
35
AAG ACC
40
45
GGA GCT TGT CCG GAA GAT TGC AAA TAC TGC CCG CAA AGC TCG
Lys Thr Gly Ala Cys Pro Glu Asp Cys Lys Tyr Cys Pro Gln Ser Ser
50
CGC TAC
55
60
AAA ACC GGG CTG GAA GCC GAG
CGG TTG ATG GAA GTT GAA CAG
Arg Tyr Lys Thr Gly Leu Glu Ala Glu Arg Leu Met Glu Val Glu Gin
65
70
GTG CTG
75
GAG TCG GCG CGC AAA GCG AAA GCG GCA GGA TCG ACG CGC TTC
85
90
GGC GCG GCG TGG AAG AAT CCC
CTG GAA
CAC GAA CGC GAT ATG CCG TAC
105
CAA ATG GTG CAG
Leu Glu Gln Met Val Gln Gly Val Lys Ala Met Gly Leu Glu Ala Cys
ATG ACG
120
CAG GCG CAG CGC CTC GCG AAC
Met Thr Leu Gly Thr Leu Ser Glu Ser Gln Ala Gln Arg Leu Ala Asn
135
CTG GAT TAC TAC AAC CAC AAC
Ala Gly
Leu Asp Tyr Tyr Asn His Asn Leu Asp Thr Ser Pro Glu Phe
TAC GGC
AAT ATC ATC ACC ACA CGC ACT
CTG GAC ACC TCG CCG GAG TTT
150
155
TAT CAG GAA CGC CTC GAT ACG
Asn Ile Ile Thr Thr Arg Thr
CTG GAA
AAA GTG CGC GAT GCC GGG ATC AAA GTC TGT TCT GGC GGC
165
Lys Val Arg Asp Ala Gly Ile
180
185
596
160
Tyr Gly
Leu Glu
548
140
GCC GGG
145
500
125
CTG GGC ACG TTG AGT GAA TCT
130
452
110
GGG GTA AAA GCG ATG Gf G CTG GAG GCG TGT
115
404
95
Cys Met Gly Ala Ala Trp Lys Asn Pro His Glu Arg Asp Met Pro Tyr
100
356
80
Val Leu Glu Ser Ala Arg Lys Ala Lys Ala Ala Gly Ser Thr Arg Phe
TGT ATG
308
Tyr Gln Glu Arg Leu Asp Thr
170
644
175
Lys Val Cys Ser Gly Gly
190
ATT
Ile
692
1 7 9 166
GTG GGC
Val Gly
CTG GCA
25
TTA GGC G AA ACG 6TA AAA GAT CGC GCC GGA TTA TTG CTG CAA
Leu Gly Glu Thr Val Lys Asp Arg Ala Gly Leu Leu Leu Gln
195
200
205
AAC CTG CCG ACG CCG CCG GAA AGC GTG CCA ATC AAC ATG CTG
Leu Ala
Asn Leu Pro Thr Pro Pro Glu Ser Val Pro
GTG AAG
GTG AAA GGC ACG CCG CTT GCC GAT AAC GAT GAT GTC GAT GCC
210
Val Lys
225
TTT GAT
Phe Asp
TCT TAC
215
220
Ile Asn Met Leu
Val Lys Gly Thr Pro Leu Ala Asp Asn Asp Asp Val Asp Ala
230
235
245
Ile Ala Val Ala Arg Ile Met Met
250
Pro Thr
Ser Tyr
Val Arg Leu Ser Ala Gly Arg Glu Gln Met Asn Glu Gln Thr
CAG GCG
ATG TGC TTT ATG GCA GGC GCA AAC TCG ATT TTC TAC GGT TGC
Gln Ala
AAA CTG
Lys Leu
290
TTC CGC
Phe Arg
Asp Asn
280
Phe Tyr Gly Cys
932
Leu Thr Thr Pro Asn Pro Glu Glu Asp Lys Asp Leu Gln Leu
295
990
285
CTG ACC ACG CCG AAT CCG GAA GAA GAT AAA GAC CTG CAA CTG
1028
300
AAA CTG GGG CTA AAT CCG CAG CAA ACT GCC GTG CTG GCA GGG
Lys Leu Gly Leu Asn Pru Gln Gln Thr Ala
310
Val Leu Ala Gly
315
Glu Gln Gln Gln Arg Leu Glu Gln Ala Leu
330
1076
320
GAA CAA CAG CAA CGT CTT GAA CAG GCG CTG ATG ACC
325
884
270
Met Cys Phe Met Ala Gly Ala Asn Ser Ile
305
GAT AAC
265
275
836
255
GTG CGC CTT TCT GCC GGA CGC GAG CAG ATG AAC GAA CAG ACT
260
799
240
TTT ATT CGC ACC ATT GCG GTC GCG CGG ATC ATG ATG CCA ACC
Phe Ile Arg Thr
740
Met Thr
CCG GAC
Pro Asp
1124
335
ACC GAC GAA TAT TAC AAC GCG GCA GCA TTA TGAGCTGGCA GGAGAAAATC
1174
16
179 166
Thr Asp Glu Tyr Tyr Asn Ala Ala Ala Leu
340
345
AACGCGGCGC TCGATGCGCG GCGTGCTGCC GATGCCCTGC GTCGCCGTTA
TCCGGTGGCG
1234
CAAGGAGCCG GACGCTGGCT GGTGGCGGAT GATCGCCAGT ATCTGAACTT
TTCCAGTAAC
1294
GATTATTTAG GTTTAAGCCA TCATCCGCAA ATTATCCGTG CCTGGCAGCA
GGGGGCGGAG
1354
CAATTTGGCA TCGGTAGCGG
CGGCTCCGGT CACGTCAGCG GTTATAGCGT GGTGCATCAG
1414
GCACTGGAAG AAGAGCTGGC
CGAGTGGCTT GGCTATTCGC GGGCACTGCT GTTTATCTCT
1474
GGTTTCGCCG CTAATCAGGC
AGTTATTGCC GCGATGATGG CGAAAGAGGA CCGTATTGCT
1534
GCCGACCGGC TTAGCCATGC
CTCATTGCTG GAAGCTGCCA GTTTAAGCCC GTCGCAGCTT
1594
CGCCGTTTTG CTCATAACGA
TGTCACTCAT TTGGCGCGAT TGCTTGCTTC CCCCTGTCCG
1654
GGGCAGCAAA TGGTGGTGAC
AGAAGGCGTG TTCAGCATGG ACGGCGATAG TGCGCCACTG
1714
GCGGAAATCC AGCAGGTAAC
GCAACAGCAC AATGGCTGGT TGATGGTCGA TGATGCCCAC
1774
GGCACGGGCG TTATCGGGGA
GCAGGGGCGC GGCAGCTGCT GGCTGCAAAA GGTAAAACCA
1834
GAATTGCTGG TAGTGACTTT
TGGCAAAGGA TTTGGCGTCA GCGGGGCAGC GGTGCTTTGC
1894
TCCAGTACGG TGGCGGATTA
TCTGCTGCAA TTCGCCCGCC ACCTTATCTA CAGCACCAGT
1954
ATGCCGCCCG CTCAGGCGCA
GGCATTACGT GCGTCGCTGG CGGTCATTCG CAGTGATGAG
2014
GGTGATGCAC GGCGCGAAAA
ACTGGCGGCA CTCATTACGC GTTTTCGTGC CGGAGTACAG
2074
GATTTGCCGT TTACGCTTGC
TGATTCATGC AGCGCCATCC AGCCATTGAT TGTCGGTGAT
2134
AACAGCCGTG CGTTACAACT
GGCAGAAAAA CTGCGTCAGC AAGGCTGCTG GGTCACGGCG
2194
ATTCGCCCGC CAACCGTACC
CGCTGGTACT GCGCGACTGC GCTTAACGCT AACCGCTGCG
2254
1 7 9 166
27
CATGAAATGC AGGATATCGA CCGTCTGCTG GAGGTGCTGC ATG GCA ACG GTT AAT
2309
M et A la T h r V a l A sn
1
AAA CAA
5
GCC ATT GCA GCG GCA TTT GGT CGG GCA GCC GCA CAC TAT GAG
Lys Gln
Ala Ile Ala Ala Ala Phe Gly Arg Ala Ala Ala His Tyr Glu
CAA CAT
GCA GAT CTA CAG CGC CAG AGT GCT GAC GCC TTA CTG GCA ATG
G ln H is
A l a A s p L e u G ln A rg G ln S e r A la A sp A l a L e u L e u A l a M e t
10
15
25
20
30
CAG CGT AAA TAC ACC CAC GTA CTG GAC GCG GGT TGT GGA CCT
L eu P ro
G l n A r g L y s T y r T h r H i s V a l L e u A sp A l a G l y C y s G l y P r o
45
ATG AGC CGC CAC TGG CGG GAA CGT CAC GCG CAG GTG ACG GCC
G ly T r p
M et S e r A rg H is T rp A rg G lu A rg
65
TTA GAT
CTC TCG CCG CCA ATG CTT GTT CAG GCA CGC CAG AAG GAT GCC
L eu A sp
L eu S e r P ro
70
75
80
85
CAT TAT CTG GCG GGA GAT ATC GAA TCC CTG CCG TTA GCG ACT
A la A sp
H is T y r L e u A la G ly A sp I l e
90
95
100
TTC GAT CTT GCA TGG AGC AAT CTC GCA GTG CAG TGG TGC GGT
A la T h r
P h e A sp L e u A l a T r p S e r A sn L eu A la V a l G ln T r p C y s G ly
105
GGC GTG
110
Ser Thr Ala Leu Arg Glu Leu Tyr Arg Val Val Arg Pro Lys
125
2645
115
TCC ACG GCA CTC CGC GAG CTG TAT CGG GTG GTG CGC CCC AAA
120
2597
G lu S e r L e u P r o L e u A l a T h r
GCG ACG
Asn Leu
2549
M e t L e u C a l G ln A l a A r g G ln L y s A s p A l a
GCA GAC
AAT TTA
2501
H i s A l a G ln V a l T h r A l a
60
P ro
2453
50
GGC TGG
55
24 05
35
CTT CCA
40
2357
2693
130
GTC GCG TTT ACC ACG CTG GTG CAG GGA TCG TTA CCC GAA CTG
2741
28
1 7 9 166
Gly Val
135
CAT CAG
Val Ala Phe
Thr Thr Leu Val Gln Gly Ser Leu Pro
140
GCG TGG CAG GCG GTG
Glu Leu
145
GAC GAG CGT CCG CAT
GCT AAT CGC
His Gln
Ala Trp Gln Ala Val
Asp Glu Arg Pro His Ala Asn Arg
TTA CCG
CCA GAT GAA ATC GAA
CAG TCG CTG AAC GGC
150
Leu Pro
CAT CAT
His His
ATG CGT
Met Arg
GAC CCG
155
Pro Asp Glu Ile Glu
Gln Ser Leu Asn Gly
ATT CAG CCC ATC ACG
CTG TGG TTT GAT GAT
170
Ile Gln Pro Ile Thr
185
TCG CTG AAA GGC ATC
Ser Leu Lys Gly Ile
200
CGA ATA TTA ACG CGT
Asp Pro
Arg Ile Leu Thr Arg
TGG CCG
CAA CAG CAG GGG CGA
215
Trp Pro
230
160
220
Gln Gln Gln Gly Arg
235
175
Leu Trp
190
Phe
27 89
165
GTG CAT TAT CAA
Val His Tyr Gln
2837
180
GCG CTC AGT GCC
Phe Asp Asp Ala Leu Ser Ala
2885
195
GGT GCC ACG CAT CTT
Gly Ala Thr His Leu
205
TCG CAG TTG CAG CGA
CAT GAA GGG
CGC
2933
GCC
2981
CAT CTT TTT TTG
3029
His Glu Gly Arg
210
TTG CAA CTG
Ser Gln Leu Gln Arg Leu Gln Leu Ala
225
TAT CCT CTG ACG TAT
Tyr Pro Leu Thr Tyr
240
His Leu Phe
GGA GTG ATT GCT CGT
GAG TAAACGTTAT TTTGTCACCG GAACGGATAC
Gly Val
Glu
Ile Ala Arg
TTT
Leu
245
3077
250
CGAAGTGGGG AAAACTGTCG
CCAGTTGTGC ACTTTTACAA GCCGCAAAGG CAGCAGGCTA
3137
CCGGACGGCA GGTTATAAAC
CGGTCGCCTC TGGCAGCGAA AAGACCCCGG AAGGTTTACG
3197
CAATAGCGAC GCGCTGGCGT
TACAGCGCAA CAGCAGCCTG CAGCTGGATT ACGCAACAGT
3257
AAATCCTTAC ACCTTCGCAG
AACCCACTTC GCCGCACATC ATCAGCGCGC AAGAGGGCAG
3317
1 7 9 166
29
ACCGATAGAA TCATTGGTAA TGAGCGCCGG
ATTACGCGCGCTTGAACAAC AGGCTGACTG
3377
GGTGTTAGTG GAAGGTGCTG GCGGCTGGTT
TACGCCGCTTTCTGACACTT TCACTTTTGC
3437
AGATTGGGTA ACACAGGAAC AACTGCCGGT
GATACTGGTAGTTGGTGTGA AACTCGGCTG
3497
TATTAATCAC GCGATGTTGA
CTGCACAGGT AATACAACAC GCCGGACTGA CTCTGGCGGG
3557
TTGGGTGGCG AACGATGTTA
CGCCTCCGGG AAAACGTCAO GCTGAATATA TGACCACGCT
3617
CACCCGCATG ATTCCCGCGC CGCTGCTGGG
AGAGATCCCCTGGCTTGCAG AAAATCCAGA
3677
AAATGCGGCA ACCGGAAAGT ACATAAACCT
TGCCTTCGTCGACGCGTCGA CTCTAGGGTT
3737
TACAAGTCGA TT ATG ACA
Met Thr
ACG GAC GAT CTT GCC TTT GAC CAA CGC CAT
Thr Asp Asp Leu Ala Phe Asp Gln Arg His
1
ATC TGG
5
3785
10
CCG
3833
Ser Ala Glu Gly Cys
CGC
Glu Leu Ile Leu Ser Asp Gly Arg Arg
3881
CTG GTT
GAC GGT ATG TCG TCC
TGG TGG GCG GCG ATC CAC GGC TAC AAT
3929
Leu Val
Asp Gly Met Ser Ser
Trp Trp Ala Ala Ile His Gly Tyr
Ile Trp
GTG GTG
Val Val
30
CAC CCA TAC ACA TCC ATG ACC TCC CCT CTG CCG GTT TAT
His Pro Tyr Thr Ser
15
20
25
AGC GCC GAA GGT TGC GAG CTG ATT TTG TCT GAC GGC AGA
35
45
CAC CCG
Met Thr Ser Pro Leu Pro Val Tyr
Pro
40
50
55
Asn
60
CAG CTT AAT GCG GCG ATG AAG TCG CAA ATT GAT GCC ATG TCG
His Pro
Gln Leu Asn Ala Ala Met Lys Ser Gln Ile Asp Ala Met
Ser
CAT GTG
ATG TTT GGC GGT ATC
TGC
His Val
65
Met Phe Gly Gly Ile
80
70
75
ACC CAT GCG CCA GCC ATT GAG CTG
Thr His Ala Pro Ala Ile Glu Leu
85
90
Cys
3977
4025
30
179 166
CGC AAA CTG GTG GCG ATG ACG CCG CAA CCG CTG GAG TGC GTT TTT CTC
Arg Lys Leu Val Ala Met Thr Pro Gln Pro Leu Glu Cys Val Phe Leu
95
100
105
GCG GAC TCC GGT TCC GTA GCG GTG GAA GTG GCG ATG AAA ATG GCG TTG
Ala Asp Ser Gly Ser Val Ala Val Glu Val Ala Met Lys Met Ala Leu
110
4073
115
4121
120
CAG TAC TGG CAA GCC AAA GGC GAA GCG CGC CAG CGT TTT CTG ACC TTC
4169
Gln Tyr Trp Gln Ala Lys Gly Glu Ala Arg Gln Arg Phe Leu Thr Phe
125
130
135
140
CGC AAT GGT TAT CAT GGC GAT ACC TTT GGC GCG ATG TCG GTG TGC GAT
Arg Asn Gly Tyr His Gly Asp Thr Phe Gly Ala Met Ser Val Cys Asp
145
150
155
CCG GAT AAC TCA ATG CAC AGT CTG TGG AAA GGC TAC CTG CCA GAA AAC
Pro Asp Asn Ser Met His Ser Leu Trp Lys Gly Tyr Leu Pro Glu Asn
160
165
Leu Phe Ala Pro Ala Pro Gln Ser Arg Met Asp Gly Glu Trp Asp Glu
180
Arg Asp Met Val Gly Phe Ala Arg Leu Met Ala Ala His Arg His Glu
195
Ile Ala Ala Val Ile Ile Glu Pro Ile Val Gln Gly Ala Gly Gly Met
210
215
Arg Met Tyr His Pro Glu Trp Leu Lys Arg Ile Arg Lys Ile Cys Asp
230
4409
220
CGC ATG TAC CAT CCG GAA TGG TTA AAA CGA ATC CGC AAA ATA TGC GAT
225
4361
200
ATC GCG GCG GTG ATC ATT GAG CCG ATT GTC CAG GGC GCA GGC GGG ATG
205
4313
185
CGC GAT ATG GTG GGC TTT GCC CGC CTG ATG GCG GCG CAT CGT CAT GAA
190
4265
170
CTG TTT GCT CCC GCC CCG CAA AGC CGC ATG GAT GGC GAA TGG GAT GAG
175
4217
4457
235
CGC GAA GGT ATC TTG CTG ATT GCC GAC GAG ATC GCC ACT GGA TTT GGT
4505
179 166
A rg G lu G ly
I l e L eu L eu
Ile
A la
240
31
A sp G lu I l e
A la T h r G ly P h e G ly
245
250
CGT ACC
GGG AAA CTG TTT GCC TGT GAA CAT GCA GAA ATC GCG CCG GAC
A rg T h r
G ly L y s L e u P h e A l a
255
C y s G lu H i s A l a G l u
Ile
260
265
A la P r o
A sp
ATT TTG
TGC CTC GGT AAA GCC TTA ACC GGC GGC ACA ATG ACC CTT TCC
Ile
C y s L e u G l y L y s A l a L e u T h r G l y G ly T h r M e t T h r L e u S e r
L eu
270
275
CTC ACC ACG CGC GAG GTT GCA GAA ACC ATC AGT AAC GGT GAA
A la T h r
L e u T h r T h r A rg G lu
V a l A la G lu
290
GCC GGT
Ala Gly
Thr I le
295
300
TGC TTT ATG CAT GGG CCA ACT TTT ATG GGC AAT CCG CTG GCC
Cys Phe Met His Gly Pro Thr Phe Met Gly Asn Pro Leu Ala
305
310
C ys A la
A la A la A sn A la S e r L eu A la I l e
Gln Gln
330
CAG GTG GCG GAT ATT GAA GTA CAG CTG CGC GAG CAA CTT GCC
Gln Val Ala Asp Ile Glu Val Gln Leu Arg Glu Gln Leu Ala
340
CGT GAT GCC GAA ATG GTT GCC GAT GTG CGC GTA CTG GGG GCC
Pro Ala
Arg Asp Ala Glu Met Val Ala Asp Val Arg Val Leu Gly Ala
ATT GGC
GTG GTC GAA ACC ACT CAT CCG GTG AAT ATG GCG GCG CTG CAA
Ile Gly
Val Val Glu Thr Thr His Pro Val Asn Met Ala Ala Leu Gln
AAA TTC
TTT GTC GAA CAG GGT GTC TGG ATC CGG CCT TTT GGC AAA CTG
Lys Phe
P h e V a l G lu G ln G ly V a l T rp I l e
365
355
4841
360
370
385
4793
345
CCC GCC
350
4745
L eu G lu S e r G ly A sp T rp
325
335
4697
315
GCA GCA AAC GCC AGC CTG GCG ATT CTC GAA TCT GGC GAC TGG
320
4649
S e r A sn G ly G lu
TGC GCG
CAG CAA
4601
280
GCC ACA
285
4553
375
390
A rg P r o
4889
380
P h e G ly L y s L e u
395
4937
32
179 166
ATT TAC
CTGATG CCG CCC TAT ATT ATT CTC CCG
CAA CAG TTG CAG CGT
Ile Tyr
Leu Met Pro Pro Tyr Ile Ile Leu Pro
Gln Gln Leu Gln Arg
CTG ACC
GCA GCG GTT AAC CGC GCG GTA CAG GAT
GAA ACA TTT TTT TGC
Leu Thr
400
405
Ala Ala Val Asn Arg Ala Val Gln Asp
415
420
410
Glu Thr Phe Phe Cys
5033
425
CAA TAACGAGAAG TCCGCGTGAG GGTTTCTGGC TACACTTTCT GCAAACAAGA
Gln
4985
5086
430
AAGGAGGGTT C ATG AAA CTC ATC AGT AAC GAT CTG CGC GAT GGC GAT AAA
Met Lys Leu Ile Ser Asn Asp Leu Arg Asp Gly Asp Lys
1
TTG CCG
Leu Pro
15
ATT TCA
5
10
CAT CGT CAT GTC TTT AAC GGC ATG GGT
HisArg His Val Phe Asn Gly Met Gly
20
CCG CAT CTG GCG TGG GAT GAT GTT CCT
Ile Ser
Pro His Leu Ala Trp Asp Asp Val Pro
TTT GTT
GTCACC TGC TAC GAC CCG GAT GCG CCA
30
Phe Val
35
40
Val Thr Cys Tyr Asp Pro Asp Ala Pro
50
TGG CAC
TGG GTA GTT GTT AAC TTA CCC GCT GAT
Trp Val Val Val Asn Leu Pro Ala Asp
CAA GGG
TTT GGC TCT GGT CTG GTA GCA ATG CCA
ACG CGT
TAC GAT GGC GAT AAT
Tyr Asp Gly Asp Asn
65
70
GCG GGA ACG AAA AGT
Ala Gly Thr Lys Ser
ACC GGC TCC GGC TGG
Thr Gly Ser Gly Trp
5280
60
ACC CGC GTA TTA CCG
Thr Arg Val Leu Pro
5328
75
GAC GGC GTT TTG CAG
Asp Gly Val Leu Gln
ACC GAC TTT GGT AAA ACC GGG TAC GAT
GGC GCA GCA CCG CCG
85
5232
45
Phe Gly Ser Gly Leu Val Ala Met Pro
80
5184
25
55
Trp His
Gln Gly
5136
5376
90
5424
179166
33
Thr Arg Thr Asp Phe Gly Lys Thr Gly Tyr Asp Gly Ala Ala Pro Pro
95
100
AAA GGC GAA ACT CAT CGC TAC
Lys Gly Glu Thr
110
His Arg Tyr
115
GAA CGT ATT GAT GTC GAT GAA
Glu Arg Ile Asp Val Asp Glu
130
AAC GTT CAT TTC
Asn Val His Phe
145
CAC TCT CTG
His Ser Leu
105
ATT TTT ACC
Ile Phe Thr
GTT CAC GCG
Val His Ala
Leu Asp Ile
GGC GCG ATG
GTC GGG TTT
120
GGT GCC AGC
Gly Ala Ser
135
GCA AGC GCC
Ala Ser Ala
150
CTG GAT ATA
Gly Ala Met
TCG ATT ACT
Ser Ile Thr
5472
125
Val Gly Phe
5520
140
GCG ATG TTT
Ala Met Phe
5568
155
AGT TAATCACTCT GCCAGATGGC GCAATGCCAT CTGGTATCAC TTAAAGGTAT
5621
Ser
TAAAAACAAC TTTTTGTCTT
TTTACCTTCC CGTTTCGCTC AAGTTAGTAT AAAAAAGCAG
56 81
GCTTCAACGG ATTCATTTTT
CTATTTCATA GCCCGGAGCA ACCTGTGAAC ACATTTTCAG
5741
TTTCCCGTCT GGCGCTGGCA
TTGGCTTTTG GCGTGACGCT GACCGCCTGT AGCTCAACCC
5801
CGCCCGATCA ACGTCCTTCT
GATCAAACCG CGCCTGGTAC CGAGCTCGAA TTCCTGCAGG
5861
CATGCAAGCT T
(2 )
INFORMACJA O SEQ ID N r: 2 :
(i)
CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 3 4 6 A m inokw asów
(B) TYP: A m inokw asow y
(D) TOPOLOGIA: l i n i o w a
(ii)
RODZAJ CZĄSTECZKI: P r o t e i n a
5872
179 166
34
(xi)
M et A la
1
OPIS SEKWENCJI: SEQ ID N r: 2:
H is A rg
P r o A rg
T rp T h r L eu
5
G lu L y s
L eu Phe
10
P ro L eu
L e u A sp L e u L e u P h e
20
G ln H is
S e r G ln V a l T h r G lu
15
G lu A la G ln G ln V a l
25
P h e A sp
P ro
A rg
35
H is A rg
30
G ln V a lG ln V a lS e r T h r L e u
40
L eu S e r
Ile
45
L y s T h r G ly A l a C y s P r o G lu A sp C y s L y s T y r C ys P r o G ln S e r S e r
50
A rg T y r
55
L y s T h r G ly
60
L eu G lu A l a G lu A rg
65
70
V al L eu
G lu S e r
A l a A rg
75
L ys A la L y s
85
C ys M et
G ly A l a
A la
T rp
A la A la G ly
S er Thr
A rg P he
95
L y s A sn P r o H is G lu A rg A sp
105
G ln M e t
V al
G ln
115
G ln
80
90
100
L e u G lu
L e u M et G lu V a l G lu
M e t P r o —T y r
110
G l y V a l L y s A l a M e tG ly L e u
120
G lu A l a
C ys
125
M e t T h r L e u G ly T h r L eu S e r G lu S e r G ln A la G ln A rg L e u A l a A sn
130
A la G ly
135
L eu A sp T y r
T y r A sn H is
145
T y r G ly
A sn I l e
Ile
140
A sn L eu
Lys V al
180
G lu
Phe
150
155
160
T h r T h r A rg T h r T y r
G ln G lu A rg L e u A sp
Thr
165
L e u G lu
A sp T h r S e r P r o
A rg
170
A sp
A la G ly I l e L y s V a lC ys S e r
185
175
G ly G ly
190
Ile
179166
V a l G ly
L e u G ly G lu
T hr V al
195
L eu A la
A sn L e u P ro
T h r P ro
P r o G lu
S e r V al P ro
V al Lys
Phe I l e
G ly T h r P r o L e u A la
A sp
A rg T h r I l e A la V a l A la
245
Ser Tyr
V a l A rg L eu
A sn A sp A sp C a l A sp
A la
235
240
M et A la
275
Lys L eu
L eu T h r T h r
P ro A sn
Lys L eu
G ly A la
270
A sn S e r I l e
P r o G lu
G ly L e u A sn P r o G ln
G l n G l n A r g L e u G lu
G lu T y r T y r
G lu A sp L y s
G ln
A la A la
340
G ln
L eu
G ly
315
320
G ln
A la
L eu
345
INFORMACJA O SEQ ID N r: 3 :
(i)
A sp L eu
T h r A la V a l L eu A la
330
A sn A la
C ys
300
325
T h r A sp
P h e T y r G ly
285
310
G lu G ln
Thr
255
295
305
A sp A sn
I l e M et M et P ro
280
290
P h e A rg
A rg
265
M et C ys P he
A sn M et L eu
G ly A rg G lu G ln M et A sn G lu G ln T h r
260
G ln A la
Ile
250
S e r A la
G ln
220
230
P h e A sp
L eu L eu L eu
205
215
225
(2 )
A rg A la G ly
200
210
V al Lys
L y s A sp
35
CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 251 A m inokw asów
( B ) TYP: A m inokw asow y
(D) TOPOLOGIA: l i n i o w a
L eu M et T h r P ro
A sp
335
36
179 166
(ii)
TYP CZĄSTECZKI: P r o t e i n a
(xi)
OPIS SEKWENCJI: SEQ ID N r: 3:
M et A la
1
T h r V a l A sn L ys
G ln A l a
Ile
5
A la A la
A la A la
A la P h e G ly
10
H is T y r G lu G ln
15
H is A la A sp L e u G ln
20
A rg A la
A rg G ln S e r
25
A la A sp
30
A la L e u L e u A la M e t L e u P r o G ln A rg L y s T y r T h r H is C a l L e u A sp
35
A la G ly
40
C y s G ly
P r o G ly
T rp M et S e r A rg H is
50
A la G ln
45
55
V a l T h r A la L eu
65
A sp L e u
S e r P ro P ro
M et L eu V a l
G ln A la
75
L y s A sp A la A la A sp H is
T y r L eu
85
L eu P ro
A rg H is
60
70
A rg G ln
T rp A rg G lu
80
A la G ly A sp
I l e G lu
90
S er
95
L e u A la T h r A la T h r P h e A sp L eu A la T rp S e r A sn L eu A la
100
V a l G ln T rp
105
110
C y s G ly A sn L e u S e r T h r A l a L e u A rg G lu L e u T y r A rg
115
120
125
V a l V a l A r g P r o L y s G l y V a l V a l A l a P h e T h r T h r L e u V a l G l n G ly
130
S e r L eu
135
P r o G lu L e u
145
H is A la
H is G ln A l a T r p G ln
A la V a l A sp
150
155
A sn A rg P h e L e u P ro P r o
165
140
A sp G lu
170
I l e G lu G ln
G lu A rg
P ro
160
S e r L eu
175
A sn
179166
G ly C a l
H is T y r G ln H is H i s
Ile
G ln P r o I l e T h r
180
A sp A la
S er
195
200
L e u H is
G lu G ly A rg A sp P r o
A rg
210
215
A rg L eu
G ln L e u A l a T r p P r o
225
Phe
A sp
A la T h r
H is
G ln L e u
G ln
190
L e u L y s G ly I l e
G ly
205
I l e L eu T h r A rg
Ser
220
G ln
G l n G ln G l y A r g
230
T y r H is
L eu T rp
185
L eu S e r A la M et A rg
T y r P ro
L eu
235
L eu P h e L e u G ly V a l I l e
Thr
240
A la A rg G lu
245
(2 )
37
250
INFORMACJA O SEQ ID N r : 4 :
(i)
CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 4 2 9 am inokw asów
(B) TYP: am in o k w a so w y
(D) TOPOLOGIA: l i n i o w a
(ii)
TYP CZĄSTECZKI: P r o t e i n a
( x i ) OPIS SEKWENCJI: SEQ ID N r: 4 :
M et T h r
1
T h r A sp A sp L eu A la P h e
5
T yr Thr
S e r M et T h r S e r P ro
L eu
C ys G lu L e u I l e L e u S e r
P ro C a l T y r P ro
55
Ile
P ro
V al V al
Ser
A la
L eu V a l A sp
G ly
30
A s p G ly A r g A r g
40
M et S e r S e r T rp T rp A la A la
H is
15
25
35
50
I l e T rp
10
20
G lu G ly
A s p G ln A r g H i s
45
H i s G ly T y r A s n H i s P r o G l n L e u
60
38
179 166
A sn A la
A la M et
L y sS e r G ln
65
Ile
A sp A la M e t S e r H is V a l M e t P h e
70
G ly G ly
I ie Thr
75
H is A la P r o
A la
I ie
G lu L e u C y s A rg L y s L e u V a l
85
A la M et
90
T h r P r o G ln P r o L e u
A la V a l G lu V a l A l a
Lys
110
M et L y s M et A la
G ly
G lu
A la
125
A rg G ln
A sp T h r
140
P h e G ly A l a M e t S e r V a l C y s A sp P r o A sp A sn S e r
150
S e r L eu
155
T rp L y s G ly
A la P r o
170
G ln S e r A rg M et A s p
A la A rg L e u M et A l a
G lu
P ro
A la H is A rg H is
Ile
V a lG ln
T rp L eu
L y sA rg I l e
G ly A la
A rg L y s I l e
230
I l e A la
A sp G lu I l e
A la C ys G lu
260
Ile
A la A la V a l
G l y G ly M e tA r g M e tT y r H i s
220
C y s A sp A rg G lu G ly
Ile
235
240
A l a T h r G ly P h e G ly A rg T h r G ly L y s
245
L eu P h e
G lu
205
215
225
L eu L eu
190
200
210
P r o G lu
G lu A rg A sp M e t V a l
185
195
Ile
175
G ly G lu T r p A sp
180
G ly P h e
160
T y r L e u P r o G lu A sn L e u P h e A la P r o
165
Ile
A rg P h e L e u T h r P h e A rg A sn G ly T y r
135
145
M et H is
L e u G ln T y r T rp G ln
120
130
H is G ly
L e u A l a A sp S e r G ly
105
115
A la
95
G lu C ys V a l P h e
100
S er V al
80
250
H is A l a
G lu I l e
265
A la P ro
255
A sp I l e
L eu
270
C ys L eu
179 166
39
Gly Lys Ala Leu Thr Gly Gly Thr Met Thr Leu Ser
275
Thr Arg
290
280
Glu Val Ala Glu
Thr Ile Ser Asn Gly
295
Ala Thr Leu Thr
285
Glu Ala Gly Cys Phe
300
Met His
GlyPro Thr
Phe Met Gly Asn Pro
Leu Ala Cys Ala Ala
Ala
Asn Ala
SerLeu Ala
Ile Leu Glu Ser Gly
Asp Trp Gln Gln Gln
Val
305
Ala Asp
325
310
330
Ile Glu Val Gln Leu Arg Glu
340
345
315
Glu Thr
350
370
360
Thr His Pro Val
335
Gln Leu Ala Pro Ala Arg Asp
Ala Glu Met Val Ala Asp Val Arg Val Leu Gly Ala
355
320
Asn Met Ala Ala Leu
375
Ile Gly Val Val
365
Gln Lys Phe Phe Val
380
Glu Gln
Gly Val Trp
Ile Arg Pro Phe Gly
Lys Leu Ile Tyr Leu
Met
Pro Pro
Tyr Ile Ile
Leu Pro Gln Gln Leu
Gln Arg Leu Thr Ala
Ala
385
Val Asn
405
390
410
Arg Ala Val Gln Asp Glu Thr
420
395
Phe Phe Cys Gin
425
(2) INFORMACJA O SEQ ID Nr: 5
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 158 aminokwasów
(B) TYP: aminokwasowy
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: Proteina
400
415
40
179 166
(x i ) OPIS SEKWENCJI: SEQ ID Nr: 5:
Met Lys
Leu Ile
Ser Asn Asp Leu Arg
Asp Gly Asp Lys Leu
Pro His
Arg His
Val Phe Asn Gly Met Gly Tyr
Asp Gly Asp Asn Ile
Ser Pro
1
5
20
25
10
30
15
His Leu Ala Trp Asp Asp Val Pro Ala Gly Thr Lys Ser Phe Val Val
35
40
45
Thr Cys Tyr Asp Pro Asp Ala Pro Thr Gly Ser Gly Trp Trp His Trp
50
Val Val
55
60
Val Asn Leu
Pro Ala Asp Thr Arg
Val Leu Pro Gln Gly
Gly Ser Gly Leu Val
Ala Met Pro Asp Gly
Val Leu Gln Thr Arg Thr
65
85
Asp Phe
70
90
Gly Lys Thr Gly Tyr Asp Gly
100
105
75
Phe
80
95
Ala Ala Pro Pro Lys
110
Gly Glu
Thr His Arg Tyr Ile Phe Thr Val His Ala Leu Asp Ile Glu Arg Ile
115
120
125
Asp Val Asp Glu Gly Ala Ser Gly Ala Met Val Gly Phe Asn Val His
130
135
Phe His Ser Leu Ala
145
Ser Ala Ser Ile Thr
150
(2) INFORMACJA O SEQ ID Nr: 6:
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 5872 par zasad
(B) TYP: kwas nukleinowy
140
Ala Met Phe Ser
155
179 166
(C) POSTAĆ NICI: podwójna
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: DNS (genomowe)
(iii) HIPOTETYCZNOŚĆ: NIE
(vi) POCHODZENIE PIERWOTNE:
(A) ORGANIZM: Escherichia coli
(B) SZCZEP: DSM498
(vii) BEZPOŚREDNIE POCHODZENIE:
(B) KLON: pB030A15— 9
(ix) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 1154..2308
(C) RODZAJ OZNACZENIA: eksperymentalne
(D) POZOSTAŁE DANE: /codon_start= 1154
/EC nmnber= 2.3.1.47
/product= "KAPA synthase"
/evidence= EXPERIMENTAL
/gene= "bioF"
/number= 2
/standard name= "8—Amino— 7— oxononanoate synthase"
(ix) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 3043..3753
(C) RODZAJ OZNACZENIA: eksperymentalne
(D) POZOSTAŁE DANE: /codon_start= 3043
/EC number= 6.3.3.3
/product= "DTB Synthase" /evidence= EXPERIMENTAL
/gene= "bioD"
/number= 4
/standard name= "Dethiobiotin Synthase"
41
42
179 166
(ix) cechy:
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 1141..1156
(D) POZOSTAŁE DANE: /standard name= "bio F RBS"
(ix)
CECHY:
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 3030..3045
(D) POZOSTAŁE DANE: /standard name= "bio D RBS"
(x) INFORMACJA DOT. OPUBLIKOWANIA:
(H) NUMER DOKUMENTU: WO 87/01391 B1
(I) DATA ZGŁOSZENIA: 26-08-1986
(J) DZIEŃ OPUBLIKOWANIA: 07-04-1993
(xi) OPIS SEKWENCJI: SEQ ID Nr: 6:
AAGCTTACTC CCCATCCCCC
TGTTGACAAT TAATCATCGG CTCGTATAAT GTGTGGAATT
60
GTGAGCGGAT AACAATTTCA
CACAGGAAAC AGGATCGGTA CCTAAGGAGA CTAGTCATGG
120
CTCACCGCCC ACGCTGGACA
TTGTCGCAAG TCACAGAATT ATTTGAAAAA CCGTTGCTGG
180
ATCTGCTGTT TGAAGCGCAG
CAGGTGCATC GCCAGCATTT CGATCCTCGT CAGGTGCAGG
240
TCAGCACGTT GCTGTCGATT
AAGACCGGAG CTTGTCCGGA AGATTGCAAA TACTGCCCGC
300
AAAGCTCGCG CTACAAAACC
GGGCTGGAAG CCGAGCGG7T GATGGAAGTT GAACAGGTGC
360
TGGAGTCGGC GCGCAAAGCG
AAAGCGGCAG GATCGACGCG CTTCTGTATG GGCGCGGCGT
420
GGAAGAATCC CCACGAACGC
GATATGCCGT ACCTGGAACA AATGGTGCAG GGGGTAAAAG
480
CGATGGGGCT GGAGGCGTGT
ATGACGCTGG GCACGTTGAG TGAATCTCAG GCGCAGCGCC
540
TCGCGAACGC CGGGCTGGAT
TACTACAACC ACAACCTGGA CACCTCGCCG GAGTTTTACG
600
GCAATATCAT CACCACACGC
ACTTATCAGG AACGCCTCGA TACGCTGGAA AAAGTGCGCG
660
1 7 9 166
43
ATGCCGGGAT CAAAGTCTGT TCTGGCGGCA
TTGTGGGCTTAGGCGAAACG GTAAAAGATC
720
GCGCCGGATT ATTGCTGCAA CTGGCAAACC
TGCCGACGCC GCCGGAAAGC GTGCCAATCA
780
ACATGCTGGT GAAGGTGAAA GGCACGCCGC
TTGCCGATAA CGATGATGTC GATGCCTTTG
840
ATTTTATTCG CACCATTGCG GTCGCGCGGA TCATGATGCC AACCTCTTAC GTGCGCCTTT
900
CTGCCGGACG CGAGCAGATG AACGAACAGA CTCAGGCGAT GTGCTTTATG GCAGGCGCAA
960
ACTCGATTTT CTACGGTTGC AAACTGCTGA
CCACGCCGAA TCCGGAAGAA GATAAAGACC
1020
TGCAACTGTT CCGCAAACTG GGGCTAAATC
CGCAGCAAAC TGCCGTGCTG GCAGGGGATA
1080
ACGAACAACA GCAACGTCTT GAACAGGCGC
TGATGACCCC GGACACCGAC GAATATTACA
1140
ACGCGGCAGC ATT ATG AGC TGG CAG GAG AAA ATC AAC GCG GCG CTC GAT
Met Ser Trp Gln Glu Lys Ile Asn Ala Ala Leu Asp
1
GCG CGG
Ala Arg
CGT GCT GCC
5
10
GAT GCC CTG CGT CGC CGT TAT CCG GTG GCG CAA
Arg Ala Ala Asp Ala Leu Arg Arg Arg Tyr Pro Val Ala Gln
15
20
GGA CGC TGG
Gly Ala
Gly Arg Trp Leu Val Ala Asp Asp Arg Gln Tyr Leu Asn Phe
CTG GTG GCG GAT GAT CGC CAG TAT CTG AAC TTT
35
AAC GAT TAT TTA GGT TTA AGC CAT CAT CCG CAA ATT ATC CGT
Ser Ser
Asn Asp Tyr Leu Gly Leu Ser His His Pro Gln Ile Ile Arg
GCC TGG
CAG CAG GGG
Ala Trp
50
GLG
55
AG CAA TTT GGC ATC GGT AGC GGC GGC TCC
70
1333
60
Gln Gln Gly Ala Glu Gln Phe Gly Ile Gly Ser Gly Gly Ser
65
1285
40
TCC AGT
45
1237
25
GGA GCC
30
1189
1381
75
GGT CAC GTC AGC GGT TAT AGC GTG GTG CAT CAG GCA CTG GAA GAA GAG
1429
44
1 7 9 166
G l y H i s V a l S e r G l y T y r S e r V a l V a l H i s G l n A l a L e u G l u G l u G lu
80
CTG GCC
Leu Ala
85
90
GAG TGG CTT GGC TAT TCG CGG GCA CTG CTG TTT ATC TCT GGT
Glu Trp Leu Gly Tyr Ser A r g Ala Leu Leu Phe Ile Ser Gly
95
100
105
TTC GCC
GCT AAT CAG GCA GTT ATT GCC GCG ATG ATG GCG AAA GAG GAC
P h e A la
A l a A sn G ln A l a V a l I l e
110
CGT ATT
115
120
GCT GCC GAC CGG CTT AGC CAT GCC TCA TTG CTG GAA GCT GCC
Ala Ala Asp Arg Leu Ser His Ala Ser Leu Leu Glu Ala Ala
AGT TTA
AGCCCG TCG CAG CTT CGC CGT TTT GCT CAT AAC GAT GTC ACT
S e r L eu
S e rP ro
CAT TTG
His Leu
GTG ACA
Val Thr
130
135
S e r G ln L eu A rg A rg
P he A la
145
150
155
165
GluGly Cal Phe Ser Met Asp Gly Asp Ser Ala Pro Leu Ala
180
CAGCAG GTA ACG CAA CAG CAC AAT GGC TGG TTG ATG GTC GAT
G lu I l e
G ln G ln V a l T h r G ln G ln
195
200
CACGGC ACG GGC GTT ATC GGG GAG CAG GGG CGC GGC AGC TGC
Asp Ala
HisGly Thr Gly Val Ile Gly Glu Gln Gly Arg Gly Ser Cys
TGG CTG
CAA AAG GTA AAA CCA GAA TTG CTG GTA GTG ACT TTT GGC AAA
210
215
230
1813
220
Gln Lys Val Lys Pro Glu Leu Leu Val Val Thr Phe Gly Lys
225
1765
H is A sn G ly T r p L e u M et V a l A sp
GAT GCC
Trp Leu
1717
185
GAA ATC
205
1669
170
GAA GGC GTG TTC AGC ATG GAC GGC GAT AGT GCG CCA CTG GCG
190
1621
H is A sn A sp V a l T h r
Ala Arg Leu Leu Ala Ser Pro Cys Pro Gly Gln Gln Met Val
160
1573
140
GCG CGA TTG CTT GCT TCC CCC TGT CCG GGG CAG CAA ATG GTG
175
1525
A la A la M et M et A la L y s G lu A sp
Arg Ile
125
1477
235
1861
1 7 9 166
45
GGA T T T
GGCGTC AGC GGG GCA GCG GTG
CTT TGC TCC AGT ACG GTG GCG
G ly P h e
G ly V a l S e r G ly
L eu Cys S e r S e r
A la A la V a l
240
245
T h r V a l A la
250
GAT TAT
CTG CTG CAA TTC
GCC CGC CAC
CTT ATC TAC AGC
ACC AGT ATG
A sp T y r
L eu L eu G ln P h e
A la A rg H is
L eu I l e
T h r S e r M et
255
Tyr S er
260
GCT CAG GCG CAG GCA TTA CGT
GCG TCG CTG GCG GTC ATT CGC
Pro Pro
Ala Gln Ala Gln Ala Leu Arg
Ala Ser Leu Ala Val Ile Arg
AGT GAT
GAGGGT GAT GCA
CGG CGC GAA
AAA CTG GCG GCA
CTC ATT ACG
S e r A sp
G lu G ly A sp A l a
A r g A r g G lu
L y s L eu A la A la
L eu
275
285
Ile
295
CGTGCC GGA GTA CAG GAT TTG
300
CCG TTT ACG CTT GCT GAT TCA
Arg Ala Gly Val Gln Asp Leu
TGC AGC
GCCATC CAG CCA
TTG ATT GTC
GGT GAT AAC AGC
CGT GCG TTA
Cys S e r
A la I l e G ln P r o
L eu I l e
G ly A sp A s n S e r
A rg A la L eu
320
V al
Pro Phe Thr Leu Ala Asp Ser
310
GCA GAA AAA CTG
CGT CAG CAA
GGC TGC TGG GTC ACG GCG ATT
G ln L e u
A la G lu L y s L e u
A rg G ln G ln
G ly C y s T r p V a l
340
T h r A la
345
CCAACC GTA CCC
GCT GGT ACT
GCG CGA CTG CGC TTA ACG CTA
A rg P r o
P ro T h r V al P ro
A la G ly T h r
A l a A rg L e u A r g
355
2245
L eu T h r L eu
360
ACC GCT
GCG CAT GAA ATG
CAG GAT ATC
GAC CGT CTG CTG
GAG GTG CTG
T h r A la
A la H is G lu M e t
G ln A sp I l e
A sp A r g L e u L e u
G lu V a l L eu
370
2197
Ile
CGC CCG
365
2149
330
CAA CTG
350
2101
315
325
335
2053
Thr
Arg Phe
305
2005
280
290
CGT TTT
1957
265
CCG CCC
270
1909
375
CAT GGC AAC GGT TAATAAACAA GCCATTGCAG CGGCATTTGG
2293
380
TCGGGCAGCC
2345
46
1 7 9 166
H i s G ly A s n G l y
385
GCACACTATG AGCAACATGC AGATCTACAG CGCCAGAGTG
CTGACGCCTT ACTGGCAATG
2405
CTTCCACAGC GTAAATACAC CCACGTACTG GACGCGGGTT
GTGGACCTGG CTGGATGAGC
2465
CGCCACTGGC GGGAACGTCA CGCGCAGGTG ACGGCCTTAG
ATCTCTCGCC GCCAATGCTT
2525
GTTCAGGCAC GCCAGAAGGA TGCCGCAGAC CATTATCTGG
CGGGAGATAT CGAATCCCTG
2585
CCGTTAGCGA CTGCGACGTT CGATCTTGCA TGGAGCAATC
TCGCAGTGCA GTGGTGCGGT
2645
CGAGCTGTAT CGGGTGGTGC GCCCCAAAGG CGTGGTCGCG
2705
AATTTATCCA CGGCACTCCG
TTTACCACGC TGGTGCAGGG ATCGTTACCC GAACTGCATC
GAGCGTCCGC ATGCTAATCG
AGGCGTGGCA GGCGGTGGAC
2765
CTTTTTACCG CCAGATGAAA TCGAACAGTC GCTGAACGGC
2825
GTGCATTATC AACATCATAT TCAGCCCATC ACGCTGTGGT
TTGATGATGC GCTCAGTGCC
2885
ATGCGTTCGC TGAAAGGCAT
CGGTGCCACG CATCTTCATG AAGGGCGCGA CCCGCGAATA
2945
TTAACGCGTT CGCAGTTGCA
GCGATTGCAA CTGGCCTGGC CGCAACAGCA GGGGCGATAT
3005
CCTCTGACGT ATCATCTTTT TTTGGGAGTG ATTGCTC GTG AGT AAA CGT TAT TTT
3060
V a l S e r L y s A rg T y r P h e
1
GTC ACCGGA ACG
5
GAT ACC GAA GTG GGG AAA ACT
GTC GCC AGT TGT GCA
Val Thr
Gly Thr Asp Thr Glu Val Gly Lys Thr
Val Ala Ser Cys Ala
CTT TTA
CAA GCC GCA AAG GCA GCA GGC TAC CGG
ACG GCA GGT TAT AAA
Leu Leu
CCG GTC
10
15
Gln Ala Ala Lys Ala Ala Gly Tyr Arg
25
30
GCC TCT GGC AGC GAA AAG ACC CCG GAA
3108
20
Thr Ala Gly Tyr
35
Lys
GGT TTA CGC AAT AGC
3156
3204
1 7 9 166
47
Pro Val Ala Ser Gly Ser Glu Lys Thr Pro Glu Gly Leu Arg Asn Ser
40
GAC GCG
Asp Ala
55
ACA GTA
45
50
CTG GCG TTA CAG CGC AAC AGC AGC CTG CAG CTG GAT TAC GCA
Leu Ala Leu Gln Arg Asn Ser Ser Leu Gln Leu Asp Tyr Ala
60
65
AAT CCT TAC ACC TTC GCA GAA CCC ACT TCG CCG CAC ATC ATC
Thr Val
Asn Pro Tyr Thr Phe Ala Glu Pro Thr Ser Pro His Ile Ile
AGC GCG
CAA GAG GGC AGA CCG ATA GAA TCA TTG GTA ATG AGC GCC GGA
Ser Ala
TTA CGC
Leu Arg
GGC GGC
Gly Gly
120
GTA ACA
Val Thr
75
80
95
Ala Leu Glu Gln Gln Ala Asp Trp Val Leu Val Glu Gly Ala
110
Trp Phe Thr Pro Leu Ser Asp Thr Phe Thr Phe Ala Asp Trp
125
Gln Glu Gln Leu Pro Val Ile Leu Val Val Gly Val Lys Leu
140
145
ATT AAT CAC
GCG ATG TTG ACT GCA
CAG GTA ATA CAA CAC
Gly Cys
Ile Asn His
Ala Met
Gln Val Ile Gln His
GGA CTG
ACT CTG GCG GGT TGG GTG GCG AAC GAT GTT ACG CCT CCG GGA
AAA CGT
Lys Arg
Leu Thr Ala
160
GCC
165
Thr Leu Ala Gly Trp Val Ala Asn Asp Val Thr Pro Pro Gly
170
175
HisAla Glu Tyr Met Thr Thr Leu Thr Arg Met Ile Pro Ala
190
3492
3540
Ala
3588
180
CAC GCT GAA TAT ATG ACC ACG CTC ACC CGC ATG ATT CCC GCG
185
3444
150
GGC TGT
Gly Leu
3396
130
CAG GAA CAA CTG CCG GTG ATA CTG GTA GTT GGT GTG AAA CTC
155
3348
115
TGG TTT ACG CCG CTT TCT GAC ACT TTC ACT TTT GCA GAT TGG
135
3300
100
GCG CTT GAA CAA CAG GCT GAC TGG GTG TTA GTG GAA GGT GCT
105
70
85
Gln Glu Gly Arg Pro Ile Glu Ser Leu Val Met Ser Ala Gly
90
3252
195
3636
48
179 166
CCG CTG
CTG GGA GAG ATC CCC
Pro Leu
Leu Gly Glu
GCA ACC
GGA AAG TAC ATA AAC
200
Ala Thr
215
Gly Lys Tyr
Ile Pro
205
TGG CTT GCA GAA AAT CCA GAA AAT GCG
Trp Leu Ala Glu Asn Pro Glu Asn Ala
210
CTT GCC TTC GTC GAC GCG TCG ACT CTA
Ile Asn Leu Ala Phe Val Asp Ala Ser Thr Leu
220
3684
225
3732
230
GGG TTT ACA AGT CGA TTA TGACAACGGA CGATCTTGCC TTTGACCAAC
Gly Phe Thr Ser Arg Leu
3780
235
GCCATATCTG GCACCCATAC
ACATCCATGA CCTCCCCTCT GCCGGTTTAT CCGGTGGTGA
3840
GCGCCGAAGG TTGCGAGCTG
ATTT7GTCTG ACGGCAGACG CCTGGTTGAC GGTATGTCGT
3900
CCTGGTGGGC GGCGATCCAC
GGCTACAATCACCCGCAGCT TAATGCGGCG ATGAAGTCGC
3960
AAATTGATGC CATGTCGCAT
GTGATGTTTGGCGGTATCAC CCATGCGCCA GCCATTGAGC
4020
TGTGCCGCAA ACTGGTGGCG
ATGACGCCGCAACCGCTGGA GTGCGTTTTT CTCGCGGACT
4080
CCGGTTCCGT AGCGGTGGAA
GTGGCGATGA AAATGGCGTT GCAGTACTGG CAAGCCAAAG
4140
GCGAAGCGCG CCAGCGTTTT
CTGACCTTCCGCAATGGTTA TCATGGCGAT ACCTTTGGCG
42 00
CGATGTCGGT GTGCGATCCG
GATAACTCAATGCACAGTCT GTGGAAAGGC TACCTGCCAG
4260
AAAACCTGTT TGCTCCCGCC
CCGCAAAGCCGCATGGATGG CGAATGGGAT GAGCGCGATA
4320
TGGTGGGCTT'TGCCCGCCTG ATGGCGGCGC ATCGTCATGA AATCGCGGCG GTGATCATTG
4380
AGCCGATTGT CCAGGGCGCA
GGCGGGATGCGCATGTACCA TCCGGAATGG TTAAAACGAA
4440
TCCGCAAAAT ATGCGATCGC
GAAGGTATCTTGCTGATTGC CGACGAGATC GCCACTGGAT
4500
TTGGTCGTAC CGGGAAACTG
TTTGCCTGTGAACATGCAGA AATCGCGCCG GACATTTTGT
4560
179166
49
GCCTCGGTAA AGCCTTAACC
GGCGGCACAA TGACCCTTTCCGCCACACTC ACCACGCGCG
4620
AGGTTGCAGA AACCATCAGT
AACGGTGAAG CCGGTTGCTTTATGCATGGG CCAACTTTTA
4680
TGGGCAATCC GCTGGCCTGC
GCGGCAGCAA ACGCCAGCCTGGCGATTCTC GAATCTGGCG
4740
ACTGGCAGCA ACAGGTGGCG
GATATTGAAG TACAGCTGCGCGAGCAACTT GCCCCCGCCC
4800
GTGATGCCGA AATGGTTGCC
GATGTGCGCG TACTGGGGGCCATTGGCGTG GTCGAAACCA
4860
CTCATCCGGT GAATATGGCG
GCGCTGCAAA AATTCTTTGTCGAACAGGGT GTCTGGATCC
492 0
GGCCTTTTGG CAAACTGATT
TACCTGATGC CGCCCTATATTATTCTCCCG CAACAGTTGC
49 80
AGCGTCTGAC CGCAGCGGTT
AACCGCGCGG TACAGGATGAAACATTTTTT TGCCAATAAC 5040
GAGAAGTCCG CGTGAGGGTT
TCTGGCTACA CTTTCTGCAAACAAGAAAGG AGGGTTCATG
AAACTCATCA GTAACGATCT
GCGCGATGGC GATAAATTGCCGCATCGTCA TGTCTTTAAC 5160
GGCATGGGTT ACGATGGCGA
TAATATTTCA CCGCATCTGGCGTGGGATGA TGTTCCTGCG 5220
GGAACGAAAA GTTTTGTTGT
CACCTGCTAC GACCCGGATGCGCCAACCGG CTCCGGCTGG
5280
TGGCACTGGG TAGTTGTTAA
CTTACCCGCT GATACCCGCGTATTACCGCA AGGGTTTGGC
5340
TCTGGTCTGG TAGCAATGCC
AGACGGCGTT TTGCAGACGCGTACCGACTT TGGTAAAACC 5400
GGGTACGATG GCGCAGCACC
GCCGAAAGGC GAAACTCATCGCTACATTTT TACCGTTCAC 5460
GCGCTGGATA TAGAACGTAT
TGATGTCGAT GAAGGTGCCAGCGGCGCGAT GGTCGGGTTT 5520
AACGTTCATT TCCACTCTCT
GGCAAGCGCC TCGATTACTGCGATGTTTAG TTAATCACTC
TGCCAGATGG CGCAATGCCA
TCTGGTATCA CTTAAAGGTATTAAAAACAA CTTTTTGTCT 56 40
TTTTACCTTC CCGTTTCGCT
CAAGTTAGTA TAAAAAAGCAGGCTTCAACG GATTCATTTT 57 00
5100
55 80
50
1 7 9 166
TCTATTTCAT AGCCCGGAGC AACCTGTGAA CACATTTTCA GTTTCCCGTC TGGCGCTGGC
5760
ATTGGCTTTT GGCGTGACGC TGACCGCCTG TAGCTCAACC CCGCCCGATC AACGTCCTTC
582 0
TGATCAAACC GCGCCTGGTA CCGAGCTCGA ATTCCTGCAG GCATGCAAGC TT
5872
(2) INFORMACJA O SEQ ID Nr: 7:
(i) CHARAKTERYSTYKA:
(A) DŁUGOŚĆ: 384 aminokwasy
(B) TYP: aminokwasowy
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: proteina
(x i ) OPIS SEKWENCJI: SEQ ID Nr: 7:
Met Ser Trp
Gln Glu Lys Ile Asn
Ala Ala Leu Asp Ala Arg
Arg Ala
Ala Asp Ala
Leu Arg Arg Arg Tyr
Pro Val Ala Gln Gly Ala
Gly Arg
1
5
20
10
25
30
15
Trp Leu
Val Ala Asp Asp
Arg Gln Tyr Leu Asn Phe
Ser Ser Asn Asp
Tyr Leu
Gly Leu Ser His
His Pro Gln
Ala Trp Gln Gln
35
50
40
Ile Ile Arg
55
45
60
Gly Ala Glu Gln Phe Gly Ile Gly Ser Gly Gly Ser Gly His Val Ser
65
70
75
80
Gly Tyr Ser Val Val His Gln Ala Leu Glu Glu Glu Leu Ala Glu Trp
85
Leu Gly Tyr
Ser Arg Ala Leu Leu
100
90
95
Phe Ile Ser Gly Phe Ala
105
110
Ala Asn
51
179 166
G ln A la
V alI l e
A la A la
M et M et A la L ys
115
A sp A rg
L eu S e r H is A la
L eu A rg A rg
A la S e r P r o
S e r L e u L e u G lu
A rg
150
155
160
C y s P r o G ly G ln G ln
M et V a l V a l T h r G lu
G ly
170
S e r M et A s p G ly
G ln G ln H i s A sn
A sp S e r A la P ro L e u A la G lu
V alI l e
G ly G lu
G ly T rp L eu M et V a l A sp A sp
A la A la V a l
G l n G l y A r g G ly
305
C y s T r p L e u G ln L y s
V al
230
235
240
L eu C ys S e r S e r T hr
V a l A la A sp T y r L eu
L eu
250
A la A rg H is L e u
Ile
A la L eu A rg A la
T y r S e r T h r S e r M et P ro
P ro
S e r L eu A la V a l I l e
A rg
310
S e r A sp G lu G ly
285
L eu A la A la L eu I l e
T h r A rg
295
300
P h e T h r L eu A la
P r o A la G ln
270
280
A rg A rg G lu L y s
G ln A sp L e u
255
265
290
G ly V a l
S er
G ly L y s G ly P h e G ly
275
A sp A la
H is G ly
L eu V al V al T hr Phe
260
A la G ln
A la
220
245
G ln P h e
G ln G ln
205
215
P r o G lu L e u
Ile
190
200
225
S e r G ly
175
185
210
V al Lys
A la S e r L eu S e r P ro
V a l T h r H is L eu A la
195
T h r G ly
A la
P h e A l a H is A sn A sp
180
V al T hr
A la A la
140
165
V al Phe
Ile
125
135
145
L eu L eu
A rg
120
130
S e r G ln
G lu A sp
P h e A rg A la
A sp S e r C ys S e r A la
Ile
315
320
52
179 166
Gln Pro
Leu Ile Val Gly Asp Asn Ser Arg Ala
Leu Gln Leu Ala Glu
Lys Leu
Arg Gln Gln Gly Cys Trp Val Thr Ala
Ile Arg Pro Pro Thr
Val Pro
Ala Gly Thr Ala Arg Leu Arg Leu Thr
Leu Thr Ala Ala His
Gln Asp Ile Asp Arq Leu Leu Glu Val
Leu His Gly Asn Gly
Glu Met
370
325
330
340
345
355
360
375
335
350
365
380
(2) INFORMACJA O SEQ ID Nr: 8:
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 236 aminokwasów
(B) T Y P : aminokwasowy
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: proteina
(xi) OPIS SEKWENCJI: SEQ ID Nr: 8:
Val Ser Lys Arg Tyr Phe
Val
Thr
GlyThr Asp
Thr
GluVal Gly Lys
Thr Val Ala Ser Cys Ala
Leu
Leu
GlnAla
Ala
Lys
1
5
20
Arg Thr
Glu Gly
50
10
25
15
30
AlaAla Gly Tyr
Ala Gly
Tyr
LysProVal
Ala
Ser
Gly SerGluLysThr Pro
Leu Arg
Asn
SerAsp Ala
Leu
Ala
Leu GlnArg Asn SerSer
35
40
55
45
60
Leu Gln Leu Asp Tyr Ala Thr Val Asn Pro Tyr Thr Phe Ala Glu Pro
65
70
75
80
179 166
53
Thr Ser Pro His Ile Ile Ser Ala Gln Glu Gly Ar9 Pro Ile Glu Ser
85
90
95
Leu Val Met Ser Ala Gly Leu Arg Ala Leu Glu Gln Gln Ala Asp Trp
100
105
Val Leu Val Glu Gly Ala Gly Gly Trp
115
120
110
Phe Thr Pro
Phe Thr Phe Ala Asp Trp Val Thr Gln Glu Gln
130
135
Leu Ser Asp Thr
125
Leu Pro Val Ile Leu
140
Val Val Gly Val Lys Leu Gly Cys Ile Asn His Ala Met Leu Thr Ala
145
150
155
160
Gln Val Ile Gln His Ala Gly Leu Thr Leu Ala Gly Trp Val Ala Asn
165
170
175
Asp Val Thr Pro Pro Gly Lys Arg His Ala Glu Tyr Met Thr Thr Leu
180
185
Thr Arg Met Ile Pro Ala Pro Leu Leu
195
200
190
Gly Glu Ile
Glu Asn Pro Glu Asn Ala Ala Thr Gly Lys Tyr
210
215
(2)
230
INFORMACJA O SEQ ID N r: 9 :
(i)
CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 143 p a r y z a s a d
(B ) TYP: kw as n u k l e i n o w y
(C) TYP N IC I: p o d w ó jn a
(D) TOPOLOGIA: l i n i o w a
235
205
Ile Asn Leu Ala Phe
220
Val Asp Ala Ser Thr Leu Gly Phe Thr Ser Arg Leu
225
Pro Trp Leu Ala
54
179166
(ii) TYP CZĄSTECZKI: DNS (genomowe)
(iii) HIPOTETYCZNOŚĆ: NIE
(iii) ANTYSENSOWNOŚĆ: NIE
(v i ) PIERWOTNE POCHODZENIE:
(A) ORGANIZM: Escherichia coli
(vii) BEZPOŚREDNIE POCHODZENIE:
(B) KLON: pB030
(ix) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 1..24
(D) POZOSTAŁE DANE: /partial
/EC number= 6.3.3.3
/product= "Dethiobiotin Synthase" /9ene= ” b i oD"
/gene="bioD"
(ix) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 120..143
(D) POZOSTAŁE DANE: /partial
/codon start= 120
/EC number= 2.6.1.62
/product= "DAPA Synthase"
/gene= "bioA"
/pseudo
(ix) CECHY:
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 111..122
(D) POZOSTAŁE DANE: /standard name= "bioA RBS"
(ix) CECHY:
(A) NAZWA/KLUCZ: stem_loop
(B) POŁOŻENIE: 38..85
179166
55
(X) INFORMACJA DOT. OPUBLIKOWANIA:
(H) NUMER DOKUMENTU: WO 87/01391 B 1
(I) DATA ZGŁOSZENIA: 26-08-1986
(J) DZIEŃ OPUBLIKOWANIA: 07-04-1993
(xi) OPIS SEKWENCJI: SEQ ID Nr: 9:
TAC ATA AAC CTT GCC TTG TTG TAGCCATTCT GTATTTGGTT AAATTGCGAG
Tyr Ile Asn Leu Ala Leu Leu
1
5
CGAGATCGCG TCTTCGATTG ACTGCAATTT AACCCTCTAGAGTCGACTCT AGGGTTTACA
AGTCGATT ATG ACA ACG GAC GAT CTT GCC TTT
Met Thr Thr Asp Asp Leu Ala Phe
1
5
(2) INFORMACJA O SEQ ID Nr: 10
(i) CHARAKTERYSTYKA
(A) DŁUGOŚĆ: 8 am in ok w asów
(B) TYP: aminokwasowy
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: proteina
(x i ) OPIS SEKWENCJI: SEQ ID Nr: 10:
Tyr Ile Asn Leu Ala Leu Leu
1
51
5
(2) INFORMACJA O SEQ ID Nr: 11:
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 7 aminokwasów
(B) TYP: aminokwasowy
111
143
56
179166
(D) TOPOLOGIA? liniowa
(ii) TYP CZĄSTECZKI: proteina
(x i ) OPIS SEKWENCJI: SEQ ID N r : 11:
M et T h r T h r A sp A sp L e u A la P h e
1
5
(2) INFORMACJA O SEQ ID N r : 12
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 93 pary zasad
(B) TYP: kwas nukleinowy
(C) FORMA NICI: podwójna
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: DNS (genomowe)
(iii) HIPOTETYCZNOŚĆ: NIE
(iii) ANTYSENSOWNOŚĆ: NIE
(vi) PIERWOTNE POCHODZENIE:
(A) ORGANIZM: Escherichia coli
(v i i ) BEZPOŚREDNIE POCHODZENIE:
(B) KLON: pB030A-9
(ix) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 1..24
(D) POZOSTAŁE DANE: /partial
/codon start= 1
/EC number= 6.3.3.3
/product= "DTB Synthase"
/gene= "bioD"
1 7 9 166
57
(ix) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 70..93
(D) POZOSTAŁE DANE: /partial
/codon start= 70
/EC number= 2.6.1.62
/product= "DAPA Synthase"
/gene= "bioA"
(ix) CECHY:
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 61..72
(D) POZOSTAŁE DANE: /standard name= "bio A RBS”
(X ) INFORMACJA DOT. OPUBLIKOWANIA
(H) NUMER DOKUMENTU: WO 87/01391 B 1
(I) DATA ZGŁOSZENIA: 26-08-1986
(J) DZIEŃ OPUBLIKOWANIA: 07-04-1993
(xi) OPIS SEKWENCJI: SEQ ID Nr: 12:
TAC ATA AAC CTT GCC TTG TTG TAGCCATTCT GTATTTGGTT CGTCGACTCT
Tyr Ile Asn Leu Ala Leu Leu
1
51
5
AGGGTTTACA AGTCGATT ATG ACA ACG
GAC GAT CTT GCC TTT
Met Thr Thr
Asp Asp Leu Ala Phe
1
5
(2) INFORMACJA O SEQ ID Nr: 13
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 8 aminokwasów
(B) TYP: aminokwasowy
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: proteina
93
58
1 7 9 166
(xi) OPIS SEKWENCJI i SEQ ID Nr: 13:
Tyr I l e
A sn L e u A la L eu L eu
1
5
(2) INFORMACJA O SEQ ID Nr: 14:
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 7 aminokwasów
(B) T Y P : aminokwasowy
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: proteina
(x i ) OPIS SEKWENCJI: SEQ ID Nr: 14:
M et T h r T h r A s p A sp L e u A l a P h e
1
5
(2) INFORMACJA O SEQ ID Nr: 15:
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 77 par zasad
(B) TYP: kwas nukleinowy
(C) FORMA NICI: podwójna
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: DNS (genomowe)
(iii) HIPOTETYCZNOŚĆ: NIE
(iii)
ANTYSENSOWNOŚĆ: NIE
(v i ) PIERWOTNE POCHODZENIE:
(A) ORGANIZM: Escherichia coli
1 7 9 166
59
(vii) BEZPOŚREDNIE POCHODZENIE:
(B) KLON: pB030A-15
(i x ) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 1..57
(D) POZOSTAŁE DANE: /partial
/codon start= 1
/function="altered 3'—end"
/EC number= 6.3.3.3
/product= "DTB Synthase"
/gene= "bioD"
(i x ) CECHY:
(A) NAZWA/KLUCZ: CDS
(B) POŁOŻENIE: 54..77
(D) POZOSTAŁE DANE: /partial
/codon start= 54
/EC number= 2. 6 .1.62
/product= "DAPA Synthase"
/gene= "bioA"
(i x ) CECHY:
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 45..56
(D) POZOSTAŁE DANE: /standard name= "bioA RBS"
(X)
INFORMACJA DOT. OPUBLIKOWANIA
(H) NUMER DOKUMENTU: WO 87/01391 B 1
(I) DATA ZGŁOSZENIA: 26-08-1986
(J) DZIEŃ OPUBLIKOWANIA: 07-04-1993
(x i ) OPIS SEKWENCJI: SEQ ID Nr: 15:
TAC ATA AAC CTT GCC TTC GTC GAC GCG
Tyr Ile Asn L e u A l a Phe
1
5
V a l Asp A l a
TCG ACT CTA GGG TTT
Ser Thr Leu Gly Phe
10
ACA AGT
Thr Ser
15
48
60
1 7 9 166
CGA TTA TGACAACGGA CGATCTTGCC TTT
77
Arg Leu
(2) INFORMACJA O SEQ ID Nr: 16
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 18 aminokwasów
(B) TYP: aminokwasowy
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: proteina
(xi) OPIS SEKWENCJI: SEQ ID N r : 16:
Tyr Ile Asn Leu Ala Phe Val Asp Ala Ser Thr Leu Gly Phe Thr Ser
1
5
10
Arg Leu
(2) INFORMACJA O SEQ ID N r : 17:
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 125 par zasad
(B) TYP: kw as n u k le in o w y
(C) FORMA NICI: podwójna
(D) TOPOLOGIA: liniowa
(ii)
TYP CZĄSTECZKI: DNS (genom ow e)
(iii)
(iii)
HIPOTETYCZNOŚĆ: NIE
ANTYSENSOWNOŚĆ: NIE
(v i ) PIERWOTNE POCHODZENIE:
(A) ORGANIZM: E s c h e r i c h i a c o l i
15
61
179 166
(vii) BEZPOŚREDNIE POCHODZENIE:
(B) KLON: pB030A-15/985E
(ix)
CECHY:
(A) NAZWA/KLUCZ: -10_signal
(B) POŁOŻENIE: 45..49
(D) POZOSTAŁE DANE: /standard_name="promoter ptac"
(ix) CECHY:
(A) NAZWA/KLUCZ: promoter
(B) POŁOŻENIE: 1..96
(C) RODZAJ OZNACZENIA: eksperymentalny
(D) POZOSTAŁE DANE: /function= "promoter ptac"
/evidence= EXPERIMENTAL
(x) INFORMACJA DOT. OPUBLIKOWANIA
(H) NUMER DOKUMENTU: WO 87/01391 B 1
(I) DATA ZGŁOSZENIA: 26-08-1986
(J) DZIEŃ OPUBLIKOWANIA: 07-04-1993
(xi) OPIS SEKWENCJI: SEQ ID Nr: 17:
AAGCTTACTC CCCATCCCCC
TGTTGACAAT TAATCATCGG CTCGTATAAT GTGTGGAATT
60
GTGAGCGGAT AACAATTTCA CACAGGAAAC AGGATCGGTA CCTTAGGAGG TGACTAGTCA
120
TGGCT
125
(2) INFORMACJA O SEQ ID Nr: 18:
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 126 par zasad
(B) TYP: kwas nukleinowy
(C) FORMA NICI: podwójna
(D) TOPOLOGIA: liniowa
(ii) TYP CZĄSTECZKI: DNS (genomowe)
62
179 166
(iii) HIPOTETYCZNOŚĆ: NIE
(iii) ANTYSENSOWNOŚĆ: NIE
(vi) PIERWOTNE POCHODZENIE:
(A) ORGANIZM: Escherichia coli
(vii) BEZPOŚREDNIE POCHODZENIE:
(B) KLON: pB030A-15/16
(ix) CECHY:
(A) NAZWA/KLUCZ: promoter
(B) POŁOŻENIE: 1..96
(C) RODZAJ OZNACZENIA: eksperymentalny
(D) POZOSTAŁE DANE: /function="promoter ptac"
/evidence^ EXPERIMENTAL
(ix) CECHY:
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 105..123
(C) RODZAJ OZNACZENIA: eksperymentalny
(D) POZOSTAŁE DANE: /evidence= EXPERIMENTAL
/standard_name="bioB RBS no.16"
(X)
INFORMACJA DOT. OPUBLIKOWANIA
(H) NUMER DOKUMENTU: WO 87/01391 B 1
(I) DATA ZGŁOSZENIA: 26-08-1986
(J) DZIEŃ OPUBLIKOWANIA: 07-04-1993
(xi) OPIS SEKWENCJI: SEQ ID Nr: 18:
AAGCTTACTC CCCATCCCCC
TGTTGACAAT TAATCATCGG CTCGTATAAT
GTGTGGAATT 60
GTGAGCGGAT AACAATTTCA
CACAGGAAAC AGGATCGGTA CCTAAGGAGG
TTTACTAGTC120
ATGGCT
126
179166
(2) INFORMACJA O SEQ ID Nr: 19:
(i) CHARAKTERYSTYKA SEKWENCJI:
(A) DŁUGOŚĆ: 122 par zasad
(B ) TYP: kwas n u k le in o w y
(C) FORMA NICI: podwójna
(D) TOPOLOGIA: liniowa
(ii)
TYP CZĄSTECZKI: DNS (genom ow e)
(iii) HIPOTETYCZNOŚĆ: NIE
(iii) ANTYSENSOWNOŚĆ: NIE
(vi) PIERWOTNE POCHODZENIE:
(A) ORGANIZM: Escherichia coli
(v i i ) BEZPOŚREDNIE POCHODZENIE:
(B) KLON: pB030A-15/9
( i x ) CECHY:
(A) NAZWA/KLUCZ: p r o m o te r
(B) POŁOŻENIE: 1..96
(C) RODZAJ OZNACZENIA: eksperymentalny
(D) POZOSTAŁE DANE: /function=''promoter ptac”
/evidence= EXPERIMENTAL
(ix)
CECHY:
(A) NAZWA/KLUCZ: RBS
(B) POŁOŻENIE: 105..119
(C) RODZAJ OZNACZENIA: eksperymentalny
(D) POZOSTAŁE DANE: /evidence= EXPERIMENTAL
/standard__name="bioB RBS no. 9"
(X)
INFORMACJA DOT. OPUBLIKOWANIA
(H) NUMER DOKUMENTU: WO 87/01391 B 1
(I) DATA ZGŁOSZENIA: 26-08-1986
(J) DZIEŃ OPUBLIKOWANIA: 07-04-1993
63
64
179 166
(xi) OPIS SEKWENCJI: SEQ ID Nr: 19:
AAGCTTACTC CCCATCCCCC
TGTTGACAAT TAATCATCGG
CTCGTATAAT
GTGTGGAATT 6 0
GTGAGCGGAT AACAATTTCA
CACAGGAAAC AGGATCGGTA
CCTAAGGAGA
CTAGTCATGG120
CT
122
179 166
179 166
F ig . 1
Fig.
2A
179 166
F i g . 2B
179 166
Fi g.
3
179 166
179 166
F ig.
4A
179 166
Fig. 4B
179 166
F ig . 5
179 166
Fig. 6A
1 7 9 166
Fig. 6B
179 166
Fig. 6C
179 166
Fig. 6D
179 166
Fig. 6E
179 166
Fig. 6F
179 166
Fig. 6G
179 166
Fig. 7
Departament Wydawnictw UP RP. Nakład 70 egz.
Cena 6,00 zł.
Документ
Категория
Без категории
Просмотров
2
Размер файла
2 919 Кб
Теги
pl179166b1
1/--страниц
Пожаловаться на содержимое документа