close

Вход

Забыли?

вход по аккаунту

?

PL182786B1

код для вставкиСкачать
RZE C Z PO SPO L IT A
PO LSK A
(12) OPIS PATENTOWY (19)PL (11) 182786
(13) B1
( ) N um er zgłoszenia:
320565
21
(22) D ata zgłoszenia:
07.12.1995
( 8 6 ) Data 1 num er zgłoszenia m iędzynarodow ego:
U rząd Patentow y
Rzeczypospolitej Polskiej
(5 4 )
(30)
07.12.1995, PCT/GB95/02861
( 8 7 ) D ata 1 num er publikacji zgłoszenia
m iędzynarodow ego:
13.06.1996, W096/17935,
PCT Gazette nr 27/96
Pierwszeństwo:
(73)
Zgłoszenie ogłoszono:
O udzieleniu patentu ogłoszono:
28.02.2002 WUP 02/02
PL
182786
B1
(57)
Uprawniony z patentu:
GLAXO GROUP LIMITED, Greenford, GB
(72)
Twórcy wynalazku:
Timothy N.C Wells, Plan-les-Ouates, CH
Amanda E.l. Proudfoot, Plan-les-Ouates, CH
13.10.1997 BUP 21/97
(45)
C12N 15/19
C12N 15/63
C07K 14/52
A61K 38/19
A61P 35/00
Polipeptyd, sekwencja kwasu nukleinowego, wektor, komórka gospodarza,
środek farmaceutyczny, oraz sposób otrzymywania polipeptydu
08.12.1994,GB,9424835.8
16.06.1995,GB,9512319.6
(43)
(51) IntC l 7
(74)
Pełnomocnik:
Muszyński Andrzej, POLSERVICE
1 Polipeptyd posiadający przynajmniej 40% homologię z sekwencją aminokwasową białka RANTES 1 działający jako
antagonista białka RANTES lub białka MIP-1α pod względem jednej lub więcej spośród następujących aktywności
(a) chemotaksja komórek THP-1 w odpowiedzi na oddziaływanie białka RANTES lub białka MIP -1α,
(b) mobilizacja jonów wapnia w komórkach THP-1 w wyniku obecności białka RANTES lub w wyniku obecności
białka MIP-1α; oraz
(c) wiązanie białka RANTES z receptorami komórek THP-1; przy czym polipeptyd ten działa jako antagonista białka
RANTES lub białka MIP -1α w wyniku obecności jednego, lub większej ilości N-końcowych aminokwasów
9 Sekwencja kwasu nukleinowego kodująca polipeptyd będący antagonistą białka RANTES lub białka M IP-1α posiadający przynajmniej 40% homologię sekwencji aminokwasowej z białkiem RANTES, przy czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów
12 Wektor zawierający sekwencję kwasu nukleinowego kodującą polipeptyd będący antagonistą białka RANTES lub
białka MIP-1α posiadający przynajmniej 40% homologię sekwencji aminokwasowej z białkiem RANTES, przy czym ten
polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów
15 Komórka gospodarza zawierająca wektor zawierający sekwencję kwasu nukleinowego kodującą polipeptyd będący
antagonistą białka RANTES lub białka MIP -1α posiadający przynajmniej 40% homologię sekwencji aminokwasowej z
białkiem RANTES, przy czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów
18 Środek farmaceutyczny do leczenia schorzenia obejmującego stan zapalny, w którym pośredniczy białko RANTES
lub białko MIP-1α , takiego jak astma, alergiczny nieżyt nosa, atopowe zapalenie skóry, ognisko miażdżycowe/miażdżyca tętnic lub reumatoidalne zapalenie stawów, zawierający czynnik aktywny i farmaceutycznie dopuszczalny nośnik, znamienny
tym, że jako czynnik aktywny zawiera polipeptyd będący antagonistą białka RANTES lub białka MIP- 1 posiadający
α
przynajmniej 40% homologię sekwencji aminokwasowej z białkiem RANTES, przy czym ten polipeptyd zawiera jeden, lub więcej
dodatkowych N-końcowych aminokwasów
22 Sposób według zastrz 21, znamienny tym, że sekwencja kwasu nukleinowego jest sekwencją RNA albo DNA
Polipeptyd, sekwencja kwasu nukleinowego, wektor,
komórka gospodarza, środek farmaceutyczny
oraz sposób otrzymywania polipeptydu
Zastrzeżenia
patentowe
1. Polipeptyd posiadający przynajmniej 40% homologię z sekwencją aminokwasową
białka RANTES i działający jako antagonista białka RANTES lub białka MIP- 1α pod względem
jednej lub więcej spośród następujących aktywności:
(a) chemotaksja komórek THP-1 w odpowiedzi na oddziaływanie białka RANTES lub
białka M IP-1α;
(b) mobilizacja jonów wapnia w komórkach THP-1 w wyniku obecności białka RANTES
lub w wyniku obecności białka M IP-1 α
; oraz
(c) wiązanie białka RANTES z receptorami komórek THP-1; przy czym polipeptyd ten
działa jako antagonista białka RANTES lub białka MI P -1 w wyniku
α obecności jednego, lub
większej ilości N-końcowych aminokwasów.
2. Polipeptyd według zastrz. 1, znamienny tym, że jeden, lub więcej niż jeden ze wspomnianych N-końcowych aminokwasów jest N-końcowym aminokwasem dla sekwencji
SPYSSDT TPCCFAYIAR PLPRAHIKE FYTSGKCSNP AVVFVTRKNR QVCANPEKKW
VREYINSLEM S.
3. Polipeptyd według zastrz. 1 albo 2, znamienny tym, że jeden, lub więcej ze wspomnianych N-końcowych aminokwasów obejmuje lub stanowi metioninę.
4. Polipeptyd według zastrz. 1 albo 2, znamienny tym, że jeden, lub więcej ze wspomnianych N-końcowych aminokwasów obejmuje lub stanowi leucynę albo glutaminę.
5. Polipeptyd według zastrz. 3, w którym wspomniana metionina znajduje się n a N-końcu
polipeptydu.
6. Polipeptyd według zastrz. 4, w którym wspomniana leucyna albo glutamina znajduje
się na N-końcu polipeptydu.
7. Polipeptyd według zastrz. 1 albo 2, albo 3, albo 5, znamienny tym, że posiada sekwencję MetRANTES: MSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo posiada sekwencję zasadniczo homologiczną do tej sekwencji.
8. Polipeptyd według zastrz. 1 albo 2, albo 4, albo 6, znamienny tym, że posiada sekwencję:
(i) Leu-RANTES: LSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo sekwencję:
(ii) Gln-RANTES:
QSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo sekwencję zasadniczo homologiczną do dowolnej z powyższych sekwencji.
9. Sekwencja kwasu nukleinowego kodująca polipeptyd będący antagonistą białka RANTES lub białka M IP-1α posiadający przynajmniej 40% homologię sekwencji aminokwasowej z
białkiem RANTES, przy czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów.
10.
Sekwencja kwasu nukleinowego według zastrz. 9, znamienna tym, że koduje polipeptyd wybrany spośród:
(i) Met-RANTES: MSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYTNSLEM S, albo
(ii) Leu-RANTES: LSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYTNSLEM S, albo
(iii) Gln-RANTES: QSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo sekwencję, która jest zasadniczo homologiczna z dowolną z powyższych sekwencji.
182 786
3
11. Sekwencja kwasu nukleinowego według zastrz. 10, znamienna tym, że jest sekwencją
RNA albo DNA.
12. Wektor zawierający sekwencję kwasu nukleinowego kodującą polipeptyd będący antagonistą białka RANTES lub białka MIP- 1 posiadający przynajmniej
α
40% homologię sekwencji
aminokwasowej z białkiem RANTES, przy czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów.
13. Wektor według zastrz. 12, znamienny tym, że sekwencja kwasu nukleinowego koduje
polipeptyd wybrany spośród:
(i) Met-RANTES:
MSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(ii) Leu-RANTES:
LSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(iii) Gln-RANTES:
QSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo sekwencję, która jest zasadniczo homologiczna z dowolną z powyższych sekwencji.
14. Wektor według zastrz. 12, znamienny tym, że sekwencja kwasu nukleinowego jest sekwencją RNA albo DNA.
15. Komórka gospodarza zawierająca wektor zawierający sekwencję kwasu nukleinowego
kodującą polipeptyd będący antagonistą białka RANTES lub białka M IP-1α posiadający przynajmniej 40% homologię sekwencji aminokwasowej z białkiem RANTES, przy czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów.
16. Komórka gospodarza według zastrz. 15, znamienna tym, że sekwencja kwasu nukleinowego koduje polipeptyd wybrany spośród:
(i) Met-RANTES:
MSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
A W FV TR K N R QVCANPEKKW VREYINSLEM S, albo
(ii) Leu-RANTES:
LSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
A W FV TR K N R QVCANPEKKW VREYINSLEM S, albo
(iii) Gln-RANTES:
QSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo sekwencję, która jest zasadniczo homologiczna z dowolną z powyższych sekwencji.
17. Komórka gospodarza według zastrz. 16, znamienna tym, że sekwencja kwasu nukleinowego jest sekwencją RNA albo DNA.
18. Środek farmaceutyczny do leczenia schorzenia obejmującego stan zapalny, w którym
pośredniczy białko RANTES lub białko M IP-1α, takiego jak astma, alergiczny nieżyt nosa, atopowe zapalenie skóry, ognisko miażdżycowe/miażdżyca tętnic lub reumatoidalne zapalenie stawów, zawierający czynnik aktywny i farmaceutycznie dopuszczalny nośnik, znamienny tym, że
jako czynnik aktywny zawiera polipeptyd będący antagonistą białka RANTES lub białka M IP-1α
posiadający przynajmniej 40% homologię sekwencji aminokwasowej z białkiem RANTES, przy
czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów.
19. Środek farmaceutyczny według zastrz. 18, znamienny tym, że zawiera polipeptyd wybrany spośród:
(i) Met-RANTES:
MSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(ii) Leu-RANTES:
LSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(iii) Gln-RANTES:
QSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo polipeptyd, który jest zasadniczo homologiczny z dowolnym z powyższych polipeptydów.
20. Sposób otrzymywania polipeptydu działającego jako antagonista białka RANTES lub
białka MIP -1α obejmujący doprowadzanie do ekspresji wspomnianego polipeptydu przez komórkę gospodarza, znamienny tym, że do ekspresji stosuje się komórkę gospodarza transformowaną wektorem zawierającym sekwencję kwasu nukleinowego kodującą polipeptyd będący
4
182 786
antagonistą białka RANTES lub białka M IP-1α posiadający przynajmniej 40% homologię sekwencji aminokwasowej z białkiem RANTES, przy czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów.
21. Sposób według zastrz. 20, znam ienny tym, że sekwencja kwasu nukleinowego koduje
polipeptyd wybrany spośród:
(i) Met-RANTES: MSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(ii) Leu-RANTES: LSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(iii) Gln-RANTES: QSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo sekwencję, która jest zasadniczo homologiczna z dowolną z powyższych sekwencji.
22. Sposób według zastrz. 21, znamienny tym, że sekwencja kwasu nukleinowego jest sekwencją RNA albo DNA.
* * *
Przedmiotem niniejszego wynalazku są pochodne białka RANTES i ich zastosowania.
Białko znane pod nazwą RANTES zostało pierwotnie sklonowane przez T.J. Schalla i in.
[J. Immunol., 141,1018-1025 (1988)] w laboratorium Krenskyègo w Stanford University School
of Medicine. Nazwa RANTES wywodzi się ze zdania: „Raised on activation, normal T-cell derived and secreted (stosowne litery podkreślono). Jego ekspresję można indukować stymulacją
antygenową lub aktywacją mutagenową komórek T. Białko to jest członkiem nadrodziny chemokm [TJ. Schall, Cytokine, 3, 165-183 (1991); J.J. Oppenheim i in., Ann. Rev. Immunol., 9,
617-648 (1991)]. Czyste białko zidentyfikowano po raz pierwszy w 1992 w płytkach krwi [Kameyoshi i in., J. Rxp. Med., 176, 587-592 (1992)]. Stanowi ono czynnik silnie odziaływujący
„przyciągająco” (ang. attractor) na eozynofile i komórki T CD4+CD45RO+, a także monocyty.
Zawiera ono sekwencję 68 aminokwasów.
Obecnie sklonowano receptora dla białka Rantes [J.L. Gao i in., J. Exp. Med., 177,
1421-1427 (1993); K. Neote i in., Cell, 72, 415-425 (1993)] i wykazano, że wiąże on chemokiny
zgodnie z następującą kolejnością przejawianej siły wiązania: M IP-1α> RANTES.
Wynalazek niniejszy dotyczy polipeptydów będących antagonami białka RANTES i/lub
białka M IP-1α
Pomimo znacznego zainteresowania dotyczącego cytokin w ogólności, a także mimo powstania omówionych powyżej opracowań odnoszących się do białka RANTES i receptorów
RANTES w szczególności, w dotychczasowym stanie techniki, a zatem przed opracowaniem niniejszego wynalazku, nie pojawiło się żadne ujawnienie związane z powyższymi antagonami lub
ich możliwymi zastosowaniami.
Wynalazek niniejszy dotyczy polipeptydu o podstawowej sekwencji aminokwasów
homologicznej do sekwencji białka RANTES i funkcjonującego jako antagon białka RANTES
i/lub MIP -1α pod względem jednej lub więcej niż jednej z poniższych aktywności:
(a) chemotaksja komórek THP-1 w odpowiedzi na oddziaływanie białka RANTES i/lub w
odpowiedzi na oddziaływanie białka M IP-1α;
(b) mobilizacja jonów wapnia w komórkach THP-1 w wyniku obecności białka RANTES
i/lub w wyniku obecności białka M IP-1α; oraz
(c) wiązanie białka RANTES i/lub białka M IP-1 z receptorami
α
komórek THP-1.
Polipeptydy otrzymywane sposobem według niniejszego wynalazku są użyteczne, jeśli
chodzi o dalsze charakteryzowanie białka RANTES i jego działania, na przykład w badaniu spowodowanej przez białko RANTES chemotaksji komórek, mobilizacji jonów wapnia i wiązania
przez receptory. Są one użyteczne także w charakteryzowaniu wiązania białka RANTES z jego
receptorami. Są one także przydatne w badaniu pod tym samym względem białka M IP-1α.
182 786
5
Oprócz tego sądzi się, że polipeptydy według niniejszego wynalazku są użyteczne w leczeniu rozmaitych chorób, jak to zostanie omówione w dalszej części niniejszego opisu.
Korzystny polipetyd według niniejszego wynalazku działa jako antagon białka RANTES
i/lub białka M IP-1α dzięki obecności w jego cząsteczce jednego, lub większej ilości N-końcowych aminokwasów (które nie występują w odnośnych pozycjach w białku RANTES i które,
dlatego, można traktować jako N-końcowe aminokwasy dodatkowe w stosunku do już obecnych
w N-końcu białka RANTES). Korzystnie, tymi N-końcowymi aminokwasami są aminokwasy
występujące w naturze (L-) i można je włączyć z zastosowaniem metody rekombinantowego
DNA lub metodą sprzęgania peptydów. Jednakże, można także tu użyć aminokwasów nie występujących w naturze (na przykład D-aminokwasów). Włącza się je z wykorzystaniem metod syntezy chemicznej.
Takim dodatkowym aminokwasem może być tylko sam jeden aminokwas i w tym przypadku może nim być, na przykład, leucyna łub metionina. Polipeptydy takie można wytworzyć z wykorzystaniem każdej odpowiedniej metody (na przykład metody klonowania genów, syntezy
chemicznej itd.). W jednym ze sposobów wykonania niniejszego wynalazku wytwarza się je
posiłkując się wpierw większym polipeptydem zawierającym pożądaną sekwencję, z następującym później przeprowadzeniem do rozszczepienia enzymatycznego, w wyniku czego otrzymuje się polipeptyd składający się z sekwencji pożądanej.
Polipeptydy według niniejszego wynalazku m ogą zawierać więcej niż jeden dodatkowy
N-końcowy aminokwas, to znaczy, że mogą zawierać do pięciu, do dziesięciu lub do dwudziestu
dodatkowych aminokwasów. W pewnych przypadkach obecnych być może więcej niż dwadzieścia dodatkowych N-końcowych aminokwasów.
Także i w tym przypadku, w celu otrzymania tego rodzaju polipeptydów, posłużyć się można jakimkolwiek dogodnym sposobem wytwarzania.
W następującej części opisu omówione zostaną szczegółowo różne aspekty niniejszego
wynalazku.
Twórcy niniejszego wynalazku odkryli, że w wyniku użycia układu ekspresyjnego E. coli
w przeznaczeniu polegającym na spowodowaniu ekspresji białka RANTES w postaci odpowiadającej dojrzałemu ludzkiemu białku RANTES (to znaczy z usuniętą sekwencją sygnałową) dochodziło do ekspresji polipeptydu, w którym obecna była dodatkowa, N-końcowa metionina (nie
usuwana z pozostałej części sekwencji działaniem endogennych proteaz E. coli). Nieoczekiwanie stwierdzono, że obecność tego dodatkowego aminokwasu w istotny sposób zmieniała
właściwości polipeptydu w porównaniu z właściwościami białka RANTES. Stwierdzono, że
ten metionylowany polipeptyd (określany w niniejszym opisie jako metionylowane białko RANTES lub Met-RANTES) oddziaływuje, w różnych testach, jako antagon białka RANTES i białka
MIP-1α, natomiast nie zaobserwowano, aby przejawiał jakąkolwiek znaczącą aktywność agonistyczną.
Należy zaznaczyć, że w licznych przypadkach, gdy u E. coli dochodzi do metionylowania
na N-końcu, nie występuje wcale (albo zachodzi tylko w nieznacznym stopniu) zmiana właściwości polipeptydu, względnie dochodzi jedynie do obniżenia poziomu jego poprzedniej aktywności biologicznej. Toteż całkowicie niespodziewane było to, że (jak w przypadku niniejszego
wynalazku) N-końcowe metionylowanie rzeczywiście doprowadza do zaistnienia aktywności
antagonistycznej.
W celu ustalenia, czy skutek taki był, czy tez nie był, ograniczony jedynie do przypadku
obecności N-końcowej metioniny, wytworzono inny polipetyd, w którym N-końcową metioninę
zastąpiono N-końcową leucyną. Także i w tym przypadku stwierdzono antagonistyczne działanie
takiego polipetydu w stosunku do białka RANTES. To samo stwierdzono w przypadku następnego polipeptydu, w którym N-końcową metioninę zastąpiono N-końcową glutaminą.
W korzystnej postaci, polipeptyd według niniejszego wynalazku ma sekwencję następującą:
(i) MSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AVVFVTRKNR
QVCANPEKKW VREYINSLEM S (niekiedy określany jest on jako „Met-RANTES”)
6
182 786
(ii) LSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AVVFVTRKNR
QVCANPEKKW VREYINSLEM S (niekiedy określany jest on jako „Leu-RANTES”) lub
(iii) QSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AVVFVTRKNR
QVCANPEKKW VREYINSLEM S (niekiedy określany jest on jako „Gln-RANTES”),
albo posiada sekwencję zasadniczo homologiczną do którejkolwiek z powyższych sekwencji.
Polipeptyd może występować w postaci glikozylowanej lub jako nie glikozylowany.
Stosowany w niniejszym opisie termin „zasadniczo homologiczna” obejmuje sekwencje
aminokwasów homologiczne co najmniej w 40%, 50%, 60%, 70%, 80%, 90%, 95% lub 99% do
danej sekwencji (w kolejności pierwszeństwa). Termin ten może obejmować (ale bez ograniczania
się tylko do nich) sekwencje aminokwasów zawierające od 1 do 20, od 1 do 10 lub od 1 do 5 pojedynczych aminokwasowych delecji, insercji lub podstawień w porównaniu z daną sekwencją, z
tym, że utworzony tak polipeptyd działa jako antagon białka RANTES lub białka M IP-1α.
Polipeptyd może występować w postaci zasadniczo czystej. Można go wyodrębnić spośród polipeptydów występujących w naturze.
Należy zauważyć, że w tej dziedzinie techniki bardzo dobrze znana jest możliwość
zastąpienia pewnych aminokwasów innymi aminokwasami bez powodowania zaistnienia jakiejkolwiek zasadniczej zmiany właściwości danego polipeptydu. Wynalazek niniejszy obejmuje
swym zakresem tego rodzaju możliwości.
Należy także zauważyć, ze często można dokonywać delecji lub insercji aminokwasów
bez powodowania zasadniczej zmiany właściwości polipeptydu. Wynalazek niniejszy obejmuje
swym zakresem tego rodzaju delecje lub insercje (które mogą stanowić, na przykład, do 10, 20
lub 50% długości powyżej przedstawionej sekwencji konkretnego antagona). Tak więc, wynalazek niniejszy obejmuje swym zakresem także białka sprzężone, w których polipeptydy według
niniejszego wynalazku zostały sprzężone z innym ugrupowaniem. Można to wykonać w celu, na
przykład, oznakowania lub w przeznaczeniu medycznym.
Twórcy mniejszego wynalazku wykazali, że polipetyd według niniejszego wynalazku
może wykazywać aktywność antagonistyczną w stosunku do czynności białka RANTES lub
MIP- 1α w chemotaksji, mobilizacji wapnia i wiązania z receptorem w komórkach THP-1 (linia
monocytów). Komórki te dostępne są z ATCC (American Tissue Culture Collection). Funkcjonują one jako dobry układ modelowy do badania białka RANTES, ponieważ uwidaczniają one
reakcję wapnia i odpowiedź chemotaktyczną na oddziaływanie białka RANTES i MIP-1α, jak
również innych chemokin, takich jak M CP-1. Omawiany polipeptyd może także być czynny jako
antagon białka RANTES lub M IP-1α w chemotaksji, mobilizacji wapnia i wiązania z receptorem
w tych komórkach. M IP-1α był pierwotnie zidentyfikowany jako część frakcji makrofagalnego
polipeptydu zapalnego (który był rozszczepiany na MIP -1α i M IP-1β) [K. Obaru i in., J. Biochem., 99, 885-894 (1088); P.F. Sippel i in., J. Immunol., 142,1582-1590 (1989)]. Przejawia on
aktywność chemotaktyczną wobec komórek T i monocytów. Wykazano również, że jest on silnym inhibitorem proliferacji komórek macierzystych układu krwiotwórczego.
W oparciu o te obserwacje sądzi się, że polipeptydy według niniejszego wynalazku mogą
być przydatne pod względem blokowania czynności białka RANTES i/lub M IP-1α, dlatego też
mogą znaleźć zastosowanie w lecznictwie. Korzystne zastosowanie polipeptydów według niniejszego wynalazku polega na blokowaniu działania białka RANTES i/lub M IP-1α w rekrutacji
i/lub aktywacji komórek prozapalnych. Wynalazek niniejszy może więc być użyteczny w leczeniu chorób takich jak astma, nieżyt nosa alergiczny, zapalenie skóry atopowe, ogniska miażdżycowe/miażdżyca tętnic i zapalenie stawów reumatoidalne.
Oprócz omówionych powyżej polipeptydów, wynalazek niniejszy obejmuje swym zakresem również sekwencje DNA kodujące te polipeptydy (które to sekwencje mogą być otrzymane
na drodze izolacji lub rekombinacji), wektory włączające takie sekwencje oraz komórki-gospodarze z takimi wektorami, zdolne do doprowadzenia do ekspresji polipeptydów według niniejszego wynalazku.
182 786
7
Polipeptydy w edług niniejszego w ynalazku m ożna w ytw orzyć na drodze ekspresji
z udziałem prokariotycznych lub eukariotycznych komórek-gospodarzy, wykorzystując odpowiednią sekwencję kodującą DNA. Stosowane sposoby postępowania ujawnione s ą w: Sambrook i in., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, Laboratory Press, USA
(1989). Alternatywnie, polipeptydy te wytworzyć można na drodze kowalentnego modyfikowania białka RANTES. Można to przeprowadzić, na przykład, za pomocą metionylowania białka
RANTES na jego N-końcu.
W związku z powyższym, przedmiotem wynalazku jest polipeptyd posiadający przynajmniej 40% homologię z sekwencją aminokwasową białka RANTES i działający jako antagonista
białka RANTES lub białka MIP- 1α pod względem jednej lub więcej spośród następujących aktywności:
(a) chemotaksja komórek THP-1 w odpowiedzi na oddziaływanie białka RANTES lub
białka M IP-1α;
(b) mobilizacja jonów wapnia w komórkach THP-1 w wyniku obecności białka RANTES
lub w wyniku obecności białka M IP-1α; oraz
(c) wiązanie białka RANTES z receptorami komórek THP-1; przy czym polipeptyd ten
działa jako antagonista białka RANTES lub białka MIP -1α w wyniku obecności jednego, lub
większej ilości N-końcowych aminokwasów.
Korzystnie, polipeptyd ten charakteryzuje się tym, że jeden, lub więcej niż jeden ze wspomnianych N-końcowych aminokwasów jest N-końcowym aminokwasem dla sekwencji SPYSSDT
TPCCFAYIAR PLPRAHIKE FYTSGKCSNP AVVFVTRKNR QVCANPEKKW VREYINSL E M S.
Korzystnie, polipeptyd według wynalazku charakteryzuje się tym, że jeden, lub więcej ze
wspomnianych N-końcowych aminokwasów obejmuje lub stanowi metioninę. Również korzystnie, polipeptyd ten charakteryzuje się tym, że jeden, lub więcej ze wspomnianych N-końcowych aminokwasów obejmuje lub stanowi leucynę albo glutaminę.
Korzystnie, wspomniana metionina znajduje się na N-końcu polipeptydu.
Korzystnie, wspomniana leucyna albo glutamina znajduje się na N-końcu polipeptydu.
Również korzystnie, polipeptyd ten charakteryzuje się tym, że posiada sekwencję Met-RANTES: MSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP AVVFVTRKNR
QVCANPEKKW VREYINSLEM S, albo posiada sekwencję zasadniczo homologiczną do tej
sekwencji.
Również korzystnie, polipeptyd ten charakteryzuje się tym, że posiada sekwencję:
(i) Leu-RANTES: LSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo sekwencję:
(ii) Gln-RANTES: QSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo sekwencję zasadniczo homologiczną do dowolnej z powyższych sekwencji.
Przedmiotem wynalazku jest także sekwencja kwasu nukleinowego kodująca polipeptyd
będący antagonistą białka RANTES lub białka M IP-1α, posiadający przynajmniej 40% homologię sekwencji aminokwasowej z białkiem RANTES, przy czym ten polipeptyd zawiera jeden,
lub więcej dodatkowych N-końcowych aminokwasów.
Korzystnie sekwencja kwasu nukleinowego według wynalazku charakteryzuje się tym, że
koduje polipeptyd wybrany spośród:
(i) Met-RANTES: MSPYSSDT
TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(ii) Leu-RANTES: LSPYSSDT
TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(iii) Gln-RANTES: QSPYSSDT
TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo sekwencję, która jest zasadniczo homologiczna z dowolną z powyższych sekwencji.
8
DNA:
182 786
Korzystnie sekwencja kwasu nukleinowego według wynalazku jest sekwencją RNA albo
Przedmiotem wynalazku jest także wektor zawierający sekwencję kwasu nukleinowego
kodującą polipeptyd będący antagonistą białka RANTES lub białka M IP-1α posiadający przynajmniej 40% homologię sekwencji aminokwasowej z białkiem RANTES, przy czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów.
Wektor według wynalazku charakteryzuje się tym, że sekwencja kwasu nukleinowego koduje polipeptyd wybrany spośród:
(i) Met-RANTES: MSPYSSDT TPCCFAYIAR
PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(ii) Leu-RANTES:
LSPYSSDT TPCCFAYIAR
PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(iii) Gln-RANTES:
QSPYSSDT TPCCFAYIAR
PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo sekwencję, która jest zasadniczo homologiczna z dowolną z powyższych sekwencji.
Korzystnie, w wektorze według wynalazku sekwencja kwasu nukleinowego jest sekwencją RNA albo DNA.
Przedmiotem wynalazku jest także komórka gospodarza zawierająca wektor zawierający
sekwencję kwasu nukleinowego kodującą polipeptyd będący antagonistą białka RANTES lub
białka M IP-1α posiadający przynajmniej 40% homologię sekwencji aminokwasowej z białkiem
RANTES, przy czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów.
Korzystnie komórka gospodarza według wynalazku charakteryzuje się tym, że sekwencja
kwasu nukleinowego koduje polipeptyd wybrany spośród:
(i) Met-RANTES:
MSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(ii) Leu-RANTES:
LSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(iii) Gln-RANTES:
QSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYTNSLEM S,
albo sekwencję, która jest zasadniczo homologiczna z dowolną z powyższych sekwencji. Korzystnie sekwencja kwasu nukleinowego jest sekwencją RNA albo DNA.
Przedmiotem wynalazku jest także środek farmaceutyczny do leczenia schorzenia obejmującego stan zapalny, w którym pośredniczy białko RANTES lub białko M IP-1α, takiego jak
astma, alergiczny nieżyt nosa, atopowe zapalenie skóry, ognisko miażdżycowe/miażdżyca tętnic
lub reumatoidalne zapalenie stawów, zawierający czynnik aktywny i farmaceutycznie dopuszczalny nośnik, charakteryzujący się tym, że jako czynnik aktywny zawiera polipeptyd będący antagonistą białka RANTES lub białko MIP- 1α posiadający przynajmniej 40% homologię sekwencji
aminokwasowej z białkiem RANTES, przy czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów.
Korzystnie środek farmaceutyczny według wynalazku charakteryzuje się tym, że zawiera
polipeptyd wybrany spośród:
(i) Met-RANTES: MSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(ii) Leu-RANTES: LSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(iii) Gln-RANTES: QSPYSSDT TPCCFAYIAR PLPRAHIKEY FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo polipeptyd, który jest zasadniczo homologiczny z dowolnym z powyższych polipeptydów.
Przedmiotem wynalazku jest także sposób otrzymywania polipeptydu działającego jako
antagonista białka RANTES lub białka M IP-1α obejmujący doprowadzanie do ekspresji wspomnianego polipeptydu przez komórkę gospodarza, charakteryzujący się tym, że do ekspresji sto-
182 786
9
suje się komórkę gospodarza transformowaną wektorem zawierającym sekwencję kwasu
nukleinowego kodującąpolipeptyd będący antagostą białka RANTES lub białka M IP-1α posiadający przynajmniej 40% homologię sekwencji aminokwasowej z białkiem RANTES, przy
czym ten polipeptyd zawiera jeden, lub więcej dodatkowych N-końcowych aminokwasów.
Korzystnie, w sposobie tym, sekwencja kwasu nukleinowego koduje polipeptyd wybrany
spośród:
(i) Met-RANTES:
MSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(ii) Leu-RANTES:
LSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S, albo
(iii) Gln-RANTES:
QSPYSSDT TPCCFAYIAR PLPRAHIKEY
FYTSGKCSNP
AVVFVTRKNR QVCANPEKKW VREYINSLEM S,
albo sekwencję, która jest zasadniczo homologiczna z dowolną z powyższych sekwencji.
Korzystnie, sekwencja kwasu nukleinowego jest sekwencją RNA albo DNA.
Wynalazek zostanie opisany jedynie przez przykład, z odniesieniem się do towarzyszących
mu rysunków, przedstawiających co następuje.
Figura 1 pokazuje sekwencję nukleotydów sekwencji kodującej białko RANTES, klonowanej w E. coli, razem z sekwencją aminokwasów kodow aną przez wspomnianą sekwencję nukleotydów.
Figura 2 pokazuje mapę plazmidu pCBA-M.
Figura 3 pokazuje mapę plazmidu pT7-7.
Figura 4 pokazuje, że różne chemokiny mogą indukować chemotaksję komórek THP-1.
Figura 5 pokazuje, że białko Met-RANTES może hamować indukowaną przez M IP -1α
białko RANTES chemotaksję komórek THP-1.
Figura 6 pokazuje, że różne chemokiny mogą indukować przepływ wapnia w komórkach
THP-1.
Figura 7 pokazuje, że białko Met-RANTES może hamować reakcję wapnia indukowaną
przez białko RANTES w komórkach THP-1.
Figura 8 pokazuje wiązanie się białka Met-RANTES z receptorami CCKR1, konkurencyjne w stosunku do wiązania się białka RANTES.
Figura 9 pokazuje, że białko Leu-RANTES może działać antagonistycznie w stosunku do
chemotaksji indukowanej białkiem RANTES.
Figura 10 pokazuje, że białko Gln-RANTES może działać antogonistycznie w stosunku
chemotaksji indukowanej białkiem RANTES.
P r z y k ł a d .
(a) Klonowanie sekwencji kodującej ludzkie białko RANTES metodą PCR.
Ludzkie białko RANTES klonowano metodą PCR z wykorzystaniem biblioteki cDNA ludzkiego szpiku kostnego λGT1 1 (Clontech). Mówiąc krótko, wpierw całość insertu cDNA w bibliotece szpiku kostnego powielano przy użyciu starterów λ GT11, które flankowały miejsce
klonowania EcoRI, w mieszaninie reakcyjnej o objętości 100 μI, zawierającej 2 μl podstawowej
hodowli faga [106jednostek łysinkowych (pfus)], 10 mM Tris-HCl pH 8,3,50 mM KCl, 1,5 mM
MgCl2, 0,2 mM dNTP-ów, 2,5 jednostki AM-PLITAQ™ (Perkin Elmer-Cetus) i 1 μM każdego
ze starterów [λGT11 PCR-1 (starter „do przodu”) 5'GATTGGTGGCGACGACTCCT i
λ T
λG11PCR-2 (starter „w przeciwnym kierunku”) 5'CAACTGGTAATGGTAGCGAC], w 30 cyklach (95°C, 2 min; 55°C, 2 min i 72°C, 5 min) w termobloku Techne PHC-2. Następnie, jedną
dziesiątą mieszaniny reakcyjnej poddano w dwu rundach PCR, w 100 μ1 mieszaniny reakcyjnej
zawierającej w tym przypadku 1 μM każdego z określonych starterów (RANTES-1 5'CCATGAAGGTCTCCGCGGCAC sensowny i RANTES-2 5'CCTAGCTCATCTCCAAAGAG antysensowny) w oparciu o opublikowaną sekwencję RANTES [T.J. Schall i in., J. Immunol., 141
1018-1025 (1988)], w 30 cyklach 95°C, 2 min; 55°C, 2 min i 72°C, 2 mm. Produkty PCR wizualizowano na żelach agarozowych 3% Nu-Sieve (FMC) (wybarwianie przy użyciu 0,5 (ag/ml bromku etidium) i pasma migrujące w przewidywanym rozmiarze cDNA RANTES (278 pz) poddano
10
182 786
oczyszczaniu na żelu z wykorzystaniem metod typowych [J. Sambrook i in., Molecular Cloning - A
Laboratory Manual, Cold Spring Harbor, Laboratory Press, USA (1989)]. Następnie końce oczyszczonego na żelu DNA stężono za pomocą sekwencyjnego działania kinazą polinukleotydową
T4 (New England Biolabs) zgodnie z instrukcją wytwórcy, w ogólnej objętości 50 μl (1 godzina,
37°C). Po upływie tego czasu, dodano 2,5 μl 2,5 mM dNTP-ów i 1 μl fragmentu Klenowa polimerazy DNA i E. coli (New England Biolabs) i inkubację kontynuowano w ciągu dalszych 30 min,
w temperaturze 37°C. Następnie, mieszaninę reakcyjną podano inaktywacji cieplnej w temperaturze 70°C w ciągu 30 minut, po czym poddano jednorazowo ekstrakcji mieszaniną układu
fenol/chloroform (1:1, obj/obj) nasyconej Tris-HCl (1:1, obj/obj). DNA wytrącono za pomocą
dodania 10 μl 3 M octanu sodowego pH 5,5,1 μl glikogenu (20 mg/ml) (Boehringer) i 250 μl etanolu, w temperaturze -20°C. DNA odzyskano za pomocą odwirowania przy 10000 x g w ciągu 20 minut, w temperaturze 4°C, po czym przemyto 70% etanolu. Końcowy osad zawieszono w jałowej
wodzie w stężeniu 10 ng/ μl.
10 ng produktu o końcach stępionych metodą PCR ligowano do 50 ng trawionego EcoRV,
potraktowanego fosfatazą alkaliczną plazmidu pBluescript IISK (Stratagene), w objętości 20 μl,
przy użyciu 2 μl ligazy DNA T4 (400000 jednostek/ml) (New England Biolabs), w ciągu co najmniej 16 godzin, w temperaturze 15°C. Produkty ligacji rozcieńczono do objętości 100 μl 1 x TE
(10 mM Tris-HCl pH 8,0/1 mM EDTA) i poddano ekstrakcji mieszaniną fenolu/chloroformu, jak
to poprzednio opisano. Produkty ligowania wytrącano za pom ocą dodania 10 μl 3 M octanu sodowego pH 5,5, 1 μl glikogenu (20 mg/ml) i 250 μl etanolu, w ciągu 15 minut, w temperaturze
-70°C. Następnie, wyodrębniono DNA za pomocą odwirowania sposobem powyżej opisanym i
zawieszono w 10 μl jałowej wody, po czym 5 μl zawiesiny produktów ligowania poddano elektroporacji do elektrokompetentnych komórek E. coli szczep X L-1 blue (40 μl), przy użyciu pulsatora Bio Rad Gene zgodnie z instrukcjami wytwórcy. Po przeprowadzeniu elektroporacji,
dodano 1 ml podłoża LB i komórki hodowano w ciągu godziny, w temperaturze 37°C. Po
upływie tego czasu, 100 pl porcje podłoża hodowlanego umieszczono na płytkach LB zawierających 100 μg/ml ampicyliny i hodowlę prowadzono w ciągu 16 godzin, w temperutzre 37°C.
Następnie pobrano pojedyncze kolonie bakterii i wysiano na 5 ml podłoża LB zawierającego
100 pg/ml ampicyliny. Hodowlę prowadzono przez noc, w tem p erau trze 37°C. Następnie
sporządzono w małej skali preparaty plazmidowego DNA (minipreparaty) wykorzystując do
tego po 3 ml każdej hodowli, przy użyciu urządzenia „mini-prep DNA purification system WIZARD™ ” (Promega), zgodnie z instrukcjami wytwórcy.
Następnie, 3 μl porcje mini-prep DNA poddano trawieniu z udziałem enzymów restrykcyjnych HindIII i EcoRI (oba z New England Biolabs), zgodnie z instrukcjami wytwórcy, przy objętości mieszaniny reakcyjnej 15 μl. Produkty reakcji analizowano na 1% żelach agarozowych
zawierających 0,5 μg/ml bromku etidium. Następnie, mini-prep DNA, które dostarczały insert o
wielkości około 280 pz poddano analizie sekwencji DNA przy użyciu starterów T3 i T7 oraz preparatu Seąuenase (USB), zgodnie z instrukcjami wytwórcy.
Wektor klonujący pBluescript II SK- otrzymano w sposób następujący.
20 μg plazmidu oczyszczonego w gradiencie CsCl trawiono, przy objętości mieszaniny reakcyjnej 100 μl, w ciągu 2 godzin, w temperaturze 37°C, przy użyciu 200 jednostek EcoRV (New
England Biolabs), zgodnie z instrukcjami wytwórcy. Po upływie 2 godzin, strawiony wektor
poddano, w ciągu dalszych 30 minut, w temperaturze 37°C, działaniu 10 μl fosfatazy alkalicznej
z jelit cielęcych, użytej w ilości 20 jednostek/ml (Boehringer). Mieszaninę reakcyjną zmaktywowano z pomocą ogrzewania w temperaturze 68°C w ciągu 15 minut, po czym poddano jednorazowo ekstrakcji mieszaniną fenolu i chloroformu (1:1, obj/obj), nasyconej Tris-HCl pH 8,0.
Plazmidowy DNA wytrącono za pom ocą dodania 10 μl 3 M octanu sodowego pH 5,5 1 250 μl etanolu, w tem peraturze -20°C. DNA wyodrębniono za pom ocą odw irow ania przy 10000 x g,
w ciągu 20 minut, w temperaturze 4°C i przemyto 70% etanolem. Końcowy osad zawieszono
w wodzie jałowej w stężeniu wynoszącym 50 ng/ml.
Sekwencjonowanie dowiodło, że wszystkie tak wytworzone klony były identyczne z sekwencją opublikowaną, z wyjątkiem pojedynczej zmiany zasady przy nukleotydzie 22 w sekwen-
182 786
11
Cji otrzymanej metodą PCR, prowadzącej do zmiany Arg na Pro w proponowanej sekwencji
sygnałowej propeptydu RANTES.
Objaśniono to na fig. 1, na której pokazano sekwencję kodującą DNA razem z odpowiednią sekwencją aminokwasów.
(b) Otrzymywanie wektora ekspresyjnego dla metionylowanego białka RANTES (antagona białku RANTES).
Produkt konstrukcji zawierający gen dla białka RANTES poddano obróbce m etodą PCR z
zastosowaniem następujących starterów:
5TTAATTAATTAAATCGATTCATATG.TCC.CCA.TAT.TCC.TCG.GAC AC-3' w którym dwa podkreślone odcinki są to miejsca restrykcyjne Cla 1 i N de1 (miejsce N de11 obejmuje
część kodonu inicjacji metioniny), oraz
5'-TACTGATATAAATCTAGACTAGCTCATCTCCAAAGAGTTG-3'.
Następnie fragment ten rozszczepiono, przy użyciu C ka1 na końcu 5' i przy użyciu X ba1 na
końcu 3'. Potem, przy użyciu X ba1(Sal1, rozszczepiono plazmid pCba-M pokazany na fig. 2, po
czym duży fragment rozszczepiono przy użyciu Sal1 i C la1. Następnie przeprowadzono ligowanie na trzech drogach, przy użyciu małego fragmentu Sal1/Xba1 z pierwszego trawienia, fragmentu Sal1/C la1 z drugiego trawienia i fragmentu PCR, w celu utworzenia produktu konstrukcji
podobnego do pCba-M, z zastąpieniem genu mTNF genem dla wydzielanej postaci ludzkiego
białka RANTES, rozpoczynającym się od inicjującej metioniny. (Wydzielana postać ludzkiego
białka RANTES nie zawiera dwudziestu trzech pierwszych aminokwasów sekwencji aminokwasów pokazanej na fig. 1. Obejmuje ona pozostałe aminokwasy uwidocznione na fig. 1 i rozpoczyna się od aminokwasów SPY...).
Następnie wspomniany fragment N de1/Sal1 usunięto z omawianego wektora i wstawiono
do t7 plazmidu ekspresyjnego pT7-7, pokazanego na fig. 3. Fragment ten zawiera gen będący
przedmiotem zainteresowania oraz 600 pz innej substancji. Jednakże późniejsze eksperymenty
(których opisu nie włączono do niniejszego tekstu) wykazały, że usunięcie innej substancji (sekwencji wektora) nie wywierało żadnego wpływu na poziom ekspresji.
Wektor ekspresji typu pT7 został omówiony przez F.W. Studiera, J. Rosenberga i in. w
Meth. Enzymol., 185, 60-89 (1990). Następnie, produkt konstrukcji został transformowany do
komórek E coli szczep B L21 (DE3) (F-ompT, hsd sB (rB, mB") zawierających gen LyzS na plazmidzie pACYCl 84 [Chang i Cohen, J. Bact. 134, 1141 (1978)]. Wektor ekspresji wymaga zaindukowania polimerazy T7, aby mogło dojść do ekspresji białka. Polimerazę T7 indukuje się w
komórkach za pomocą dodania do podłoża IPTG (izopropylotiogalaktozydu).
(c) Zademonstrowanie, że Met-RANTES rzeczywiście wykazuje aktywność antagonistyczną.
(i) Test chemotaksji.
In vitro chemotaksję przeprowadzono przy użyciu komór 96-studzienkowych (Neuro Probe MB Senes, Cabin John, MD 20818, USA) zgodnie z instrukcjami wytwórcy. Chemotaksję
wywoływaną przez chemokiny CC, RANTES, M IP-1α i MCP-1 badano z zastosowaniem linii
ludzkich monocytów THP-1. 4 x 105 komórek THP-1 w 200 μl podłoża RPMI 1640 (Gibco) zawierającego 2% inaktywowanej płodowej surowicy cielęcej inkubowano w każdej ze studzienek
komory górnej. W dolnej komorze umieszczono 370 μl podłoża RPMI 1640 (bez FCS) zawierającego chemoatraktant (to jest chemokinę) w stosowanym rozcieńczeniu. W celu zahamowania chemotaksji, chemoatraktant utrzymywano w stałym stężeniu wynoszącym 5 x EC50, którą to
wartość ustalono uprzednio dla każdej chemokiny. Met-RANTES dodawano w stężeniu zmiennym. Komory inkubowano w ciągu godziny, w temperaturze 37°C, w atmosferze 5% CO2. Następnie usunięto podłoże z komory górnej i zastąpiono je PBS zawierającym 20 mM EDTA, po
czym komory inkubowano w ciągu 30 minut w temperaturze 4°C. PBS usunięto z górnych
dołków, które następnie wytarto do sucha. Zestaw wirowano w ciągu 10 minut przy 1800 obr/min
w celu zebrania komórek w komorze dolnej i supernatant usunięto za pomocą odessania. Komórki w komorach dolnych policzono z zastosowaniem testu „Cell Titer 96™ Non-Radioactive Cell
Proliferation Assay” (Promega, Madison, USA), przy śledzeniu i kontrolowaniu przekształcenia
12
182 786
błękitu tetrazoliowego w jego pochodną formazanową. Do każdej studzienki wprowadzono 100 μl
10% roztworu barwnika w podłożu RPMI 1640 i komorę inkubowano w temperaturze 3 7°C w atmosferze 5% CO2. Następnie do każdej studzienki dodano 100 μl roztworu do solubilizacji i odczytano wartość absorbancji przy 590 nM po upływie 4 godzin przy użyciu czytnika
„Thermomax Microtitre Plate Reader” (Molecular Devices, Palo Alto, CA).
Otrzymane wyniki przedstawiono na fig. fig. 4 i 5.
(ii) Przepływ wapnia
Przepływ wapnia spowodowany oddziaływaniem chemokin RANTES i M IP-l α mierzono
zgodnie z doniesieniem literaturowym: R.Y. Tsien, T. Pozzan i T.J. Rink, „Calcium homeostasis
in intact lymphocytes: cytoplasmic free calcium monitored with a new, intracellularly trapped
fluorescent indicator”, J. Cell Biology 94 (1984), z tą różnicą, że zamiast Quin2 jako wskaźnika
fluorescencyjnego, używano preparatu Fura-2/AM (Fluka). Komórki THP-1 zebrano przy stężeniu poniżej 106/ml po to, aby być pewnym, że znajdują się one w logarytmicznej fazie wzrostu.
Następnie, komórki zawieszono w roztworze Krebsa-Ringera zawierającym 0,2% Fura-2/AM
i 1 mg/ml BSA, w stężeniu 106/ml, po czym inkubowano w temperaturze 37°C w ciągu 30 minut,
bez dostępu światła. Komórki zebrano za pomocą odwirowania i ponownie zawieszono w roztworze Krebsa-Ringera, po czym przetrzymywano na lodzie. Przed użyciem, 1 ml porcje inkubowano w temperaturze 37°C w ciągu 2 minut. Chemokiny dodawano do zawiesiny przy mieszaniu.
W celu zbadania rozmiarów hamowania przez Met-RANTES, do komórek, w trakcie 2 minut inkubacji, w temperaturze 37°C, porcje antagona wprowadzano przy różnych jego stężeniach.
Otrzymane wyniki pokazano na fig. fig. 6 i 7.
(iii) Test wiązania z receptorem
Badanie współzawodnictwa przeprowadzono w 96-studzienkowych płytkach „Multiscreen Filter-plates” (Millipore, MADV N6500), uprzednio poddanych w ciągu 2 godzin działaniu
50 mM buforu HEPES, pH 7,2, zawierającego 1 mM CaCl2, 5 mM MgCl2 i 0,5% BSA (bufor do
wiązania). Test przeprowadzono przy użyciu albo komórek THP-1, albo komórek COS, w przypadku których dochodzi do ekspresji rekombinantowego receptora CC-CKR1 [K. Neote, D. DiGregorio, J.Y. Mak, R. Horuk i T.J. Schall: „Molecular cloning, functional expression and
signalling characteristics ofC-C chemokine receptor”, Cell, 72,415-425 (1993); J.L.Gao i in., J.
Exp. Med., 177,1421-1427 (1993)]. Każda studzienka zawierała 105kom órek w 150 μl buforu do
wiązania, zawierającego 0,4 nM [125J]M IP-l α lub 0,4 nM [125J]RANTES (New England Nuclear,
NEX 277) oraz konkurencyjne białko Met-RANTES w różnych stężeniach. Próby wykonywano
w trzech powtórzeniach. Po upływie 90 minut inkubacji w temperaturze 4°C, komórki przemyto
4 razy 200 μl lodowato zimnego buforu do wiązania zawierającego 0,5 M NaCl, który usuwano
za pomocą odessania. Sączki wysuszono, po czym dodano 3,5 ml płynu scyntylacyjnego Ultima
Gold Scintillation Fluid (Packard) i dokonano zliczenia przy użyciu licznika Beckman LS5000.
Otrzymane wyniki przedstawiono na fig. 8.
(d) Otrzymywanie Leu-RANTES (określanego w niniejszym opisie także jako L-RANTES) i
zademonstrowanie antagonizmu.
Wektor ekspresyjny L-RANTES wytworzono w dwóch etapach. Wpierw, zastosowano
metodę PCR do skrócenia genu dla ludzkiego białka RANTES w obrębie kodonu pierwszej cysteiny i wprowadzenia unikalnych miejsc restrykcyjnych na obu końcach genu. Tak utworzony
produkt PCR sklonowano do opartego na T7 wektora ekspresyjnego E. coli pET23d (Novagen)
przy wykorzystaniu miejsca SAcI wprowadzonego na końcu 5' genu oraz miejsca BsmAI (przeznaczonego do dostarczania zgodnego z HindIII wystającego „zwisu”) przy końcu 3' genu. Następnie tworzono geny kodujące N-końcowe warianty ludzkiego białka RANTES, przez wstawianie oligonukleotydów kodujących warianty bezpośrednio 5' do sekwencji kodującej RANTES.
W tym celu, klon skróconego białka RANTES w pET23d poddano trawieniu przy użyciu SacI, a
następnie polimerazy DNA T4 (w celu usunięcia wystającego „zwisu” 3' pozostawionego po podziałaniu SacI), a następnie drugiemu trawieniu, przy użyciu NcoI. Następnie, do poddanego traw ieniu w ektora sklonowano Oligonukleotydy kodujące sekw encję peptydow ą
182 786
13
MKKKWPRLSPYSSDTTP. Ekspresję produktu konstrukcji pET23d/L-RANTES przeprowadzono sposobem opisanym odnośnie do konstruktu pT7-7.
pET23d/RANTES NcoI
pER23d/RANTES Sacl/T4
5'C
C TGC TTT 3'
3' GGTAC
G ACG AAA 5'
Oligonukleotydy L-RANTES
3' CATGAAAAAAAAATGGCCAAGGCTGTCCCCGTACTCCTCCGACACCACCCCGTG
3'
TTTTTTTTTACCGGTTCCGACAGGGGCATGAGGAGGCTGTGGTGGGGCAC
Konstrukt pET23d/L-RANTES jest jednym z szeregu wektorów ekspresyjnych, których
można użyć do tworzenia białka RANTES o różnych aminokwasach w pozycji 1. Te wektory
ekspresyjne T7 kodują białka zawierające sekwencje końcowe białka MKKKWPR-X-RANTES, przy czym X może oznaczać, na przykład, albo L, I, Q, E, albo G. Rozszczepienie przy użyciu endo-Arg-C prowadzi do uzyskania odmiennych białek X-RANTES.
14
182 786
Oczyszczanie Leu-RANTES przeprowadzono w sposób następujący.
W 15 ml 50 mM buforu Tris-HCl, pH 7,6, zawierającego 1 mM ditiotreitolu, 5 mM chlorowodorku benzamidyny, 0,1 mM fluorku fenylometylosulfonylu i 0,02 mg/ml DNazy zawieszono
4 g pasty komórek E. coli. Komórki rozbito w trzech przejściach przez prasę „French Pressure
celi”, z 1-minutowym nadźwiękawianiem po każdym przejściu. Otrzymany tak roztwór wirowano w ciągu 60 minut przy 10000 x g, po czym osad rozpuszczono w 2 ml 1000 mM buforu
Tris-HCl, pH 8,0, zawierającego 6 M chlorowodorku guanidyny i 1 mM ditiotreitolu. Utworzony
roztwór ogrzewano w ciągu 60 minut w temperaturze 60°C w celu osiągnięcia monomeryzacji,
po czym oziębiono do temperatury pokojowej i poddano filtracji żelowej na kolumnie Superdex-200 16/60 zrównoważonej tym samym buforem. Frakcje zawierające konstrukt rekombinantowego białka RANTES (o objętości 16 ml) poddano renaturacji za pomocą wkroplenia do
384 ml 100 mM buforu Tris-HCl, pH 8,0, zawierającego 1 mM utlenionego glutationu i 0,0,1 mM
zredukowanego glutationu, po czym całość mieszano przez noc. Następnie roztwór ten poddano
dializie wobec 50 mM buforu z octanem sodowym, pH 4,5, a potem naniesiono na kolumnę
H lLoad SP26/10 zrównoważoną tym samym buforem. Białka wyeluowano liniowym gradientem 0-2 M NaCl w tym samym buforze. Frakcje zawierające zrenaturowane białko dializowano
wobec 3 x 5 litrów 1% kwasu octowego, a następnie zliofilizowano.
W celu usunięcia ze sprzężonego białka heksapeptydu KKKWPR, liofilizat w postaci proszku rozpuszczono w wodzie i doprowadzono do stężenia 1 mg/ml przy użyciu 50 mM buforu
Tris-HCl, pH 8,0. Do 2 ml otrzymanego tak roztworu wprowadzono 20 μg preparatu Endoproteinase Arg C (Boehringer Mannheim) i otrzymany roztwór inkubowano w ciągu 2 godzin w temperaturze 37°C. Strawione białko oddzielono od reszty surowca metodą HPLC z odwróconymi
fazami z zastosowaniem kolumny Nucleosil-C8 (10 x 250 mm) zrównoważonej 0,1% kwasem
tnfluorooctowym. Białka wyeluowano gradientem 22,5-45% acetonitrylu w 0,1% kwasie tnfluorooctowym, po czym zliofilizowano i przechowywano w temperaturze -80°C.
Aktywność antagonistyczną w stosunku do spowodowanej oddziaływaniem białka RANTES chemotaksji komórek THP-1 zbadano sposobem opisanym odnośnie do białka Met-RANTES. Otrzymane wyniki przedstawiono na fig. 9.
(e) Otrzymywanie Gln-RANTES (niekiedy określanego jako Q-RANTES) i zademonstrowanie antagonizmu.
Powtórzono sposób postępowania opisany w pkt. (d) z potrzebnymi zmianami w celu wytworzenia Gln-RANTES.
Aktywność antagonistyczną białka Gln-RANTES w stosunku do spowodowanej oddziaływaniem białka RANTES chemotaksji komórek THP-1 zbadano sposobem opisanym odnośnie do Met-RANTES. Otrzymane wyniki przedstawiono na fig. 10.
182 786
Fig.
1
182 786
FIG.
2
182 786
FIG.
3
182 786
FIG.
4
182 786
Fig.
5
182 786
FIG,
6
182 786
Fig.
7
182 786
Fig,
8
182 786
FIG.
9
182 786
FIG.
10
D epartam ent W ydaw nictw U P RP. N akład 60 egz.
C ena 4,00 zł.
Документ
Категория
Без категории
Просмотров
2
Размер файла
1 119 Кб
Теги
pl182786b1
1/--страниц
Пожаловаться на содержимое документа