close

Вход

Забыли?

вход по аккаунту

?

Oligoclonal T cell proliferation in patients with rheumatoid arthritis and their unaffected siblings.

код для вставкиСкачать
ARTHRITIS & RHEUMATISM
Vol. 39, No. 6, June 1996, pp 904-913
0 1996, American College of Rheumatology
904
OLIGOCLONAL T CELL PROLIFERATION IN PATIENTS WITH
RHEUMATOID ARTHRITIS AND THEIR UNAFFECTED SIBLINGS
INGE WAASE, CORINNA KAYSER, PAULA J. CARLSON,
JORG J. GORONZY, and CORELIA M. WEYAND
Objective. To analyze whether patients with rheumatoid arthritis (RA) have an intrinsic defect in T cell
proliferation and survival, possibly contributing to the
infiltration of the synovial membrane with CD4+ T cells.
Methotks. Fifteen patients with seropositive RA,
11 patients with psoriatic arthritis, 20 normal controls,
and 9 affected and 13 unaffected siblings from 7 multiplex families with RA were analyzed for clonal proliferation. To investigate this clonal T cell proliferation,
CD4+ T cells were purified from peripheral blood and
synovial fluid by magnetic bead separation. T cell receptor (TCR) P-chain sequences were amplified by reverse
transcriptase-polymerase chain reaction, using TCR
BV and BJ gene segment-specific primer sets. Clonally
expanded T cell specificities were identified by size
fractionation and sequencing of the amplified product.
Results. All RA patients carried clonally expanded CD4+ T cells in the peripheral blood compartment. Such expanded CD4+ T cell clonotypes were only
infrequently observed both in normal individuals (P <
0.0001) and in patients with psoriatic arthritis (P =
0.004). Lymphoproliferation of selected CD4+ T cells
was shared by affected and unaffected siblings from RA
multiplex families (P = 0.005 and P = 0.0003, respectively, compared with normal controls). Expanded
clonotypes persisted for several years and contributed to
the T cell infiltrate in the joint. Clonal T cell proliferation involved a diverse spectrum of TCR molecules.
Conclusion. RA patients have an abnormality in
Supported in part by grants from the NIH (R01-AR-41974
and AR-42527), a Clinical Science Grant (NAF no. 14) and a
Biomedical Science Grant (NAF no. 16) from the National Arthritis
Foundation, and by the Mayo Foundation.
Inge Waase, MD, Corinna Kayser. Paula J. Carlson, BS, Jorg
J. Goronzy, MD, PhD, Cornelia M. Weyand, MD, PhD: Mayo Clinic,
Rochester, MN.
Address reprint requests to Cornelia M. Weyand, MD, PhD,
Mayo Clinic, 200 First Street, SW, Rochester, MN 55905.
Submitted for publication November 6, 1995; accepted in
revised form February 8, 1996.
the homeostasis of CD4+ T cells, characterized by the
emergence of clonally proliferating populations. The
presence of clonal outgrowth of selected CD4+ T cell
specificities in unaffected siblings of RA patients suggests that oligoclonality of CD4+ T cells is inherited
and is a risk factor for, rather than a result of, synovial
inflammation.
Persistent inflammatory infiltrates in the synovial
membrane that gradually cause tissue destruction are a
distinguishing feature of rheumatoid arthritis (RA). The
prevailing model of RA postulates that the disease
evolves from a local immune response, with tissueinfiltrating cells recognizing an arthritogenic antigen (1).
Support for this model has come from the observation
that RA is an HLA-DR-associated disease (2-5), and
CD4+ lymphocytes represent a dominant population c.f
the inflammatory cells accumulated in the joint (6,7).
Limited efficacy of treatment trials employing T
cell-depleting antibodies and studies of inflammatory
mediators synthesized at the site of synovial disease have
challenged the concept that the disease is driven by T
cells that recognize an arthritogenic antigen in the joint
(8-10). We have explored the hypothesis that RAassociated changes in the global T cell repertoire, and
not locally induced events, are involved in establishing a
chronic inflammatory infiltrate in the synovium. In the
initial studies, we were able to isolate expanded CD4+
clonotypes from 5 patients with early RA (11). These
clonotypes were dominant in the peripheral blood as
well as the synovial compartment. While clonal amplification of CD4+ T cells in the joint may result from
stimulation by an arthritogenic antigen, oligoclonality of
circulating CD4+ cells has challenged the concept of
localized antigen recognition. Our findings have raised the
possibility that patients with RA have an intrinsic abnormality in controlling the proliferation of T lymphocytes.
In the present study, we examined the mecha-
905
OLIGOCLONAL T CELL PROLIFERATION IN RA
BV17
BV2
BJ
2S2 253 2S4 2S5 2S7
BJ
BV3
BV2
BJ
2S2 2S3 2S4 2S5 2S7
R4-5
2S2 2S3 2S4 2S5 2S7
BJ
2S2
2S3 2%
RA-7
BV8
2S5 2S7
BJ 2S2 2S3 2S4 2S5 2S7
RA-8
Figure 1. Clonal dominance of selected T cell receptor (TCR) specificities in the CD4-t repertoire of rheumatoid arthritis (RA) patients. TCR
sequences were amplified by reverse transcriptase-polymerase chain reaction with BV-BJ-specific primer sets. Size separation of BV-BJ
amplification products demonstrated a Gaussian distribution of TCR transcripts with different lengths for most BV-BJ combinations. Results are
shown for BV2-BJ combinations in a normal individual, and for BV17-BJ combinations in a patient with psoriatic arthritis (top). The emergence
of a dominant band is suspicious for expansion of one clonal specificity. Clonality was confirmed for a BV2-BJ2S5 specificity in patient RA-5, a
BV3-BJ2Sj specificity in RA-7, and a BV8-BJ2S4 receptor in patient RA-8 (bottom).
nisms underlying the clonal expansion of selected CD4-t
T cells. Emergence of dominant clonotypes was not
simply a consequence of chronic inflammation. Clonally
expanded T cells were infrequently found in patients
with psoriatic polyarthritis, whereas all of the patients
with seropositive RA had evidence of clonal amplifica-
tion of several T cell specificities. In contrast to healthy
individuals without a family history of RA, unagected
siblings of RA patients frequently carried multiple
clonotypes. These findings suggest that individuals are
genetically predisposed to develop clonal outgrowth of
CD4+ T cells. Clonal proliferation of CD4+ T cells may
WAASE ET AL
906
be a risk factor for developing RA, and may result from
a defect in the genetic elements regulating clonal downsizing.
PATIENTS AND METHODS
Study cohorts. Fifteen patients with seropositive RA,
according to the American College of Rheumatology (formerly, the American Rheumatism Association) criteria (12), and
11 patients with active psoriatic polyarthritis were enrolled in
the study. Ten HLA-DRB1*04+ and 10 HLA-DRB1*04healthy individuals without a personal or family history of a
chronic inflammatory disease were recruited as controls. The
cohorts were comparable for age (RA 42-69 years, psoriatic
arthritis 37-71 years, controls 28-62 years). The mean disease
duration was 10.2 years for the RA patients and 19 years for
the patients with psoriatic arthritis. Unaffected siblings of RA
patients were identified from multiplex families. Unaffected
siblings were chosen for study if they were either older, or less
than 2 years younger, than the affected proband. Multiplex
families were defined as 2-generation families with at least 2
affected members. At least 1 of the affected family members
was required to have seropositive erosive RA that had been
diagnosed and treated at the Mayo Clinic. All patients and
families were of Caucasian origin. Patients and controls were
characterized for their HLA-DRB1 alleles by allele-specific
amplification and subsequent oligonucleotide hybridization (13).
Cell purification. Peripheral blood mononuclear cells
were obtained by density gradient centrifugation. CD4+
cells were positively selected by incubation with 40 pg/106 cells
anti-CD4 (OKT4, CRL 8002; ATCC, Rockville, MD), and
subsequent incubation with magnetic beads coupled with
anti-mouse IgG (PerSeptive Diagnostics, Cambridge, MA). In
selected experiments, cells were sorted on a FACSVantage.
The following antibodies were used: fluorescein isothiocyanate
(F1TC)-labeled monoclonal antibodies (MAb) against VLA-4,
BV3, BV17 (AMAC Inc., Westbrook, ME), FITC-labeled
MAb against CD4, CD8, and LFA-1, and phycoerythrinlabeled antibodies against CD4, CD8, and CD25 (Becton
Dickinson, Mountain View, CA).
Molecular analysis of T cell receptor (TCR) sequences.
Total RNA was extracted from 1 X 10" CD4+ cells. Complementary DNA (cDNA) was amplified with primer sets specific
for BV2 (TCATCAACCATGCAAGCCTGACCT). BV3
(GTCTCTAGAGAGAAGAAGGAGCGC),BVSS1 (ATACTTCAGTGAGACACAGAGAAAC), BV8 (ATITACTITAACAACAACGlTCCG), BV14 (GTCTCTCGAAAAGAGAAGAGGAAT), and BV17 (CAGATAGTAAATGACXTTCAG),
and a BC primer (TTCTGATGGCTCAAACAC) (14). A
1:100 dilution of the amplified template was reamplified with
each of the BV primers, combined with each of the BJ
antisense primers. The following BJ primers were used: BJlSl
(TGCCTTGTCCAAAGAAAGC), BJlS2 (ACCTGGTCCCCGAACCGAAGG), BJlS3 (TACAACAGTGAGCCAACTT), BJlS4 (AGACAGAGAGCTGGGTTCCAC),
BJlS6 (TCACAGTGAGCCTGGTCCCATT),BJ2S1 (CCTCTAGCACGGTGAGCCGT), BJ2S2 (GGTCAGCCTAG A G C W , BJ2S3 (TGCCTGGGCCAAAATACT), BJ2S4
(CAGCACTGAGAGCCGGGTCCCGGCG), BJ2S5 (AC-
CAGGAGCCGCGTGCCT), and BJ2S7 (ACCGTGAGCCTGGTGCCC).
The amplified product was labeled using a primer
extension assay with the appropriate end-labeled BJ primer,
and was separated on a 5% polyacrylamide gel. Gels were
scanned using a Bio-Rad phosphorimager. For the majority of
samples, the analysis showed 8-12 bands for one particular
V-J combination, with Gaussian distribution of the band
intensities. Samples that had a dominant band and/or deviated
from the Gaussian distribution were identified and directly
sequenced by reverse transcriptase-mediated dideoxy sequencing, using the BJ primer as the sequence-initiation
primer (15). A band was defined as dominant if the intensity of
the band was larger than the sum of 2 adjacent bands and was
at least 30% of the total product. Previous experiments had
shown that one particular clonotype had to be larger than 25%
of all T cells sharing the particular BV-J combination to give
an unequivocal sequence (11). If more than one dominant
band was identified within one V-J combination, the bands
were eluted and directly sequenced.
Statistical analysis. The cohorts of RA patients, patients with psoriatic arthritis, affected and unaffected siblings,
and normal controls were compared for the frequency of clonal
expansions by exact Wilcoxon rank sum test, using the Stat
Exact program.
RESULTS
RA is characterized by clonal expansion of CD4+
T cells. Sixty-six BV-J combinations were analyzed for
the presence of dominant clonotypes, providing information on 25-30% of t h e total CD4-t T cell repertoire
in each individual. Dominance of a particular TCR size,
suggesting clonal expansion, was a frequent finding in
the CD4+ T cells of RA patients (Figure 1). A total of
131 suspicious bands were identified in the 15 RA
patients studied. Sequencing confirmed clonality for 50
T C R specificities (Table 1). All RA patients carried
clonally expanded C D 4 + T cells.
To investigate whether clonal expansion was simply t h e result of a chronic inflammatory joint disease, 11
patients with active psoriatic arthritis were recruited as
disease controls. Results of the repertoire studies in RA
patients, healthy controls, and patients with psoriatic
arthritis a r e shown in Figure 2. Within the cohort of RA
patients, oligoclonality was a consistent finding. Eighty
percent of the RA patients carried multiple CD4+
clones, with up to 7 clonotypes per patient. Within t h e
group of RA patients, a n average of 3.4 clonally expanded T cell specificities were detected per patient. A
different picture emerged for the patients with psoriatic
polyarthritis. Six of the 11 patients with psoriatic polyarthritis had a single clonotype, and only 2 carried 2 clones.
Therefore, clonal expansion in the cohort of RA patients
OLIGOCLONAL T CELL PROLIFERATION [N RA
Table 1. Deduced amino acid sequences of the V-D-J
clonally expanded CD4+ T cells
BV-BJ
BV
V-D-J
BJ
RA- 1
RA- 1
RA- 1
RA-1
RA-1
RA-1
RA-2
RA-2
RA-2
RA-2
RA-2
RA-2
RA-2
RA-3
RA-3
RA-3
RA-3
RA-3
RA-4
RA-4
RA-4
RA-S
RA-5
RA-6
RA-7
RA-7
RA-7
RA-7
RA-8
RA-8
RA-8
RA-9
RA-9
RA-9
RA-9
RA-9
RA-9
RA-9
RA-10
RA-10
RA-11
RA-11
RA-11
RA-11
5S1-2S2
14-1S4
14-1S6
14-1S6
14-284
17-2SS
14-1S3
14-2S1
14-283
14-2S5
17-1S3
17-1S4
17-1S4
5S1-1S4
14-1S3
14-234
14-284
17-1S3
5s1-1s1
8-1S3
17-2S1
2-2S5
3-237
3-1S3
3-1S6
3-2S1
3-235
17-1S1
8 -2S4
17-1S1
17-235
3-2S3
5s 1-2S4
8-234
14-1S3
14-1S6
14-234
17-1S6
2-1s2
8-283
3-1S3
3-282
14-234
17-2S2
8-1S3
14-285
3-1S6
17-2s 1
3-283
17-2S7
CASS
CASS
CAS
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CAS
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CSA
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CASS
CAS
CASS
CASS
CAS
CSAS
CASS
CASS
CASS
CASS
CASS
CAS
CASS
CASS
CASS
CAS
CASS
FGALY
FSAAP
SRRGDT
DL
GVRD
IRSSRSG
LWSVA
FAS
LSRA
SY
IGRN
RSTGRFS
LSS
SGTA
SA
QFKGP
LYRER
LSHP
FQGEG
LFHGDE
SPN
RSASGS
LSF
CEGT
SQTAE!
LPRRSAN
LGR
TRVK
LVGG
IGV
TDF
FLAG
TGREAMD
SVGRGFAG
KMGT
RGDT
SRRG
RLRG
ATPAGGP
LGAAG
TPDDSS
GTG
SGRLVG
IRGGS
RR
LGIR
LLGGD
TA
RAGSD
GKAA
NTGELFF
NEKLFF
NSPLHF
NSPLHF
KNIQYF
ETQYF
GNTIYF
NEQFF
STDTQF
QETQYF
SGNTIYF
TNEKLFF
TNEKLFF
NEKLFF
SGNTIYF
KNIQYF
NIQYF
SGNTIYF
TEAFF
GNTIYF
SYNEQF
QETQYF
YEQYF
GNTIYF
PLHF
YNEQFF
ETQYF
NTEAFF
NIQYF
TEAFF
QETQYF
TDTQYF
IQYF
NIQYF
SGNTIYF
SPLHF
AKNIQYF
NSPLHF
YGYTF
DTQYF
GNTIYF
TGELFF
AKNIQYF
NTGELFF
NTIYF
QETQYF
NSPLHF
YNEQFF
TDTQYF
SYEQYF
RA-12
RA-12
RA-13
RA-14
RA-1s
RA-15
14 had no evidence of clonal expansion. In these 14
individuals, TCR size classes followed Gaussian distributions. In 6 individuals, dominant bands corresponding
to expanded clonotypes were identified. Three of these
controls were HLA-DRB1*04+, suggesting that the
CD4 clonality within the normal population was not an
HLA-DR-associated phenomenon. In a single individual, 3 clonotypes could be detected. Comparison of RA
patients and controls yielded a statistically significant
difference (P < 0.0001).
We attempted to correlate the number of CD4+
clonotypes to clinical characteristics of the RA patients.
Patients with a disease duration of <10 years carried a
mean of 3.3 clonotypes, compared with 3.4 clones in
patients with a longer duration. Patients with extraarticular disease tended to have more expanded clonotypes (4.1 clonedpatient), compared with patients without extraarticular manifestations (2.1 clones/patient).
Group sizes were too small to allow statistical comparison. There was no correlation between the extent of
oligoclonality and previous or current therapies. In
particular, the patients who had received antiproliferative drugs such as azathioprine or cyclophosphamide had
region of
Patient
was significantly different from that in the patients with
psoriatic arthritis (P = 0.004).
Clonality of CD4+ T cells was a rare finding in
healthy individuals (Figure 2). Twenty normal controls
were analyzed. Ten individuals were selected because
they expressed an HLA-DRBlb04 allele; the other 10
were negative for HLA-DRBlL04. Of the 20 controls,
907
Rheumatoid arthritis
"=IS
PI
PZ
P3
P4
P5
P6
P7
PE
P9
PI0
PI1 PI2 P I 3
PI4
PIS
Psarratic arthritis
n=l I
>
z
<
6
$
4
2
PI
P2
P3
P4
P5
P6
P7
P8
P9
PI0
P11
DR4 pos controls
"=lo
2hm
D1
D2
D3
D4
D5
D6
D7
DE
D9
D10
2
c
DI
DZ
D3
D4
DS
06
D7
D8
D9
D10
Figure 2. Expanded CD4 clonotypes in patients with rheumatoid
arthritis (RA), psoriatic arthritis, and healthy controls. BV-BJ combinations with dominant bands, suggesting clonally expanded CD4+
specificities, were identified by polymerase chain reaction of T cell
receptor sequences and CDR3 length analysis, as described in Figure
1. Sixty-six BV-BJ combinations, including the BV2, BV3, BV5S1,
BV8, BV14, and BV17 gene segments, were analyzed. Clonality was
confirmed by direct sequencing of the total BV-BJ product containing
dominant bands. RA patients had a significantly higher number of
expanded CD4 clonotypes than patients with psoriatic arthritis (P =
0.004) and healthy controls (P < 0.0001). HLA-DR4+ (pos.) and
HLA-DR4- (neg.) controls did not differ regarding the number of
expanded clonotypes or the number of controls carrying clonotypes.
WAASE ET AL
908
numbers of dominant clonotypes similar to those of
patients who had never received disease-modifying
agents (data not shown).
Molecular characteristics of the CD4+ clonotypes in RA patients. Dominant clonotypes could possibly result from chronic antigenic stimulation by an
arthritogenic antigen. In that case, one would expect
similarities in the TCR used by such T cells. The TCR
p-chain sequences of the 50 patient-derived CD4+ T
cell clones showed a nonrandom TCR BV usage. The
BV3, BV14, and BV17 gene elements accounted for
77% of all expanded CD4+ cells, whereas BV2, BV5S1,
and BVS were used by 22% of the clonotypes (Figure 3).
Nonrandomness was also seen for the representation of
BJ elements in the clonal populations. Thirty-four percent of clonotypes expressed BJlS3 or BJ2S4. The
V-D-J region, which represents the presumptive antigen-binding site of the TCR, was characterized by a high
degree of heterogeneity (Table 1). There was no evidence of shared amino acid sequence homologies.
Size and phenotype of expanded CD4+ clonotypes. Functional consequences of clonal expansion
may relate to the frequency of the T cell clone. To
estimate the size of the expanded clonotypes, we analyzed the frequencies of BV3 and BV17 CD4+ T cells by
fluorescence-activated cell sorter (FACS), applying BVspecific MAb. FACS analysis did not predict whether
1
2
3
4
5
Figure 4. Phenotypic characterization of expanded CD4 clonotypes.
To identify the T cell subset containing the clonal specificity that was
originally identified in the unseparated CD4 population (lane l),
peripheral blood mononuclear cells from the same patient were
separated into CD4+, VLA-4+ (lane 2), CD4+, VLA-4- (lane 3),
CD4+, LFA-lhIgh (lane 4), and CD4+, LFA-l1OW(lane 5) T cell
subsets, respectively. Complementary DNA from T cell subsets was
analyzed by polymerase chain reaction with BV-BJ-specific primers
and CDR3 size analysis. All clonotypes were identified in the CD4+,
VLA-4+, LFA-lhlShT cell subset.
BV14
BV17
BV3
BV8
BV5.1
BV2
Figure 3. BV gene segment usage of expanded CD4+ clonotypes in
rheumatoid arthritis (RA) patients. The expanded CD4 clonotypes in
those RA patients shown in Figure 2 showed a nonrandom BV gene
segment usage within the 6 BV elements tested. The BV3, BV14, and
BV17 gene segments accounted for 77% of all expanded clonotypes,
whereas BV2, BVSS1, and BV8 were used by 22% of the clonotypes.
these families included clonally expanded specificities,
indicating that the individual clones reached a size of
4%
of the CD4 compartment (data not shown).
We subsequently analyzed whether the clonotypes could be identified by BV-BC-specific amplification, or whether a BV-BJ-specific amplification was
needed. Only 2 of 19 clones were large enough to yield
a dominant band in the BV-specific amplification product. For more than 90% of the clonotypes, BV-BJ
amplification was required to identify them, suggesting
909
OLIGOCLONAL T CELL PROLIFERATION IN RA
1
A
3
2
B A
B
A
4
well as in the joint. Corresponding bands had identical
TCR p-chain sequences. All expanded clonotypes in the
peripheral blood of the 2 patients were also detected in
the joint. The frequencies of the clonotypes in the 2
compartments were similar.
Persistence of expanded CD4+ clonotypes. For 8
of the 15 RA patients analyzed, the repertoire of CD4+
cells was studied at different timepoints (Figure 6). A
total of 21 CD4+ clonotypes were monitored longitudinally from blood samples collected between 1990 and
1994. Samples were available for 14 clonotypes that were
harvested more than 10 months apart. For 2 patients,
CD4+ T cells collected more than 40 months apart were
examined. Eighteen clones persisted over time. The 3
transient T cell clones disappeared within 6 months.
Expanded CD4+ clonotypes in unaffected siblings of RA patients. Clonal proliferation of CD4+ T
cells could either be an epiphenomenon of the chronic
inflammation, or could actively contribute to the disease
process. The finding that expanded clonotypes were
present in patients with very early disease and infrequent
in patients with psoriatic polyarthritis raised the possibility that dominant CD4 clonotypes preceded disease
B A B
Figure 5. Distribution of expanded clonotypes in peripheral blood
and synovial fluid. Paired samples of peripheral blood mononuclear
cells and synovial fluid cells were collected from patient RA-7 and
analyzed in parallel. All 4 expanded clonotypes (lane 1, BV3-BJlS6;
lane 2, BV3-BJ2Sl; lane 3, BV3-BJ2S5; and lane 4, BV17-BJlS1)
were present in the peripheral blood (lanes A) and in the synovial fluid
compartment (lanes B). Identity of T cell receptor molecules was
confirmed by sequence analysis.
that the size of the majority of clones was in the range of
0.2-1 %.
Due to the size of the CD4+ clonotypes, direct
phenotyping was not possible. To characterize the phenotype of CD4+ clones, CD4+ T cells were subsetted
according to the intensity of CD4, VLA-4, and LFA-1
expression. The subpopulations were collected by cell
sorting and analyzed for the presence of the clonally
expanded T cells (Figure 4). Patient-derived CD4+
clonotypes had the CD4+,LFA-lhigh,VLA-4+phenotype. All clones analyzed expressed the CD45RO
marker, an antigen present on memory T cells (data not
shown).
Distribution of expanded clonotypes. Paired samples of peripheral blood and synovial fluid or synovial
tissue were examined in 2 FL4 patients. As shown in
Figure 5, dominant bands representing a clonal CD4+ T
cell specificity were present in the peripheral blood as
1
A
B
A
4
3
2
B
A
B
5
A B A B
Figure 6. Persistence of expanded CD4+ clonotypes. CD4+ T cells
were obtained at different time points and analyzed for the presence of
dominant clonotypes by BV-BJ amplification and T cell receptor
length analysis. Results are shown for 2 different patients. In patient
RA-2,3 different clonotypes persisted over time (lane 1, BV14-BJlS3;
lane 2, BV14-BJ2S3; and lane 3, BV4-BJ2S5). Persistence of 2
different clonotypes from patient RA-11 is shown in lane 4 (BV3BJlS3) and lane 5 (BV3-BJ2S2). Lanes A are samples collected in July
1993 (patient RA-2) and January 1994 (patient RA-11). Lanes B are
samples collected in November 1990 (patients €?A-2 and RA-11,
respectively).
WAASE ET AL,
910
AfTeelcd siblings
1
;111111111111
DI
D2
D3
D4
D5
D6
D7
D8
D9
DIO
DII
DI2
D13
Figure 7. Clonal expansion of CD4 T cells in the peripheral blood of
unaffected siblings of rheumatoid arthritis (RA) patients in multicase
families. CD4+ peripheral blood mononuclear cells were purified
from 9 patients with RA and 13 unaffected siblings from 8 sibships of
multicase families. Eight of the 9 RA patients and 9 of the 13
unaffected siblings typed HLA-DRB1*04+. Clonally expanded CD4+
cells were identified by BV-BJ-specific amplification of T cell receptor
transcripts and subsequent CDR3 size analysis and direct sequencing,
as described in Figures 1 and 2. There was no significant difference
between affected and unaffected siblings. All unaffected siblings had
clonally expanded CD4+ T cells.
onset and actually represented a risk factor for rheumatoid synovitis. To address this question, we studied a
cohort of individuals with an increased risk of developing RA. Unaffected and affected siblings were recruited
from multiplex families. CD4 + peripheral blood cells
were collected from 9 affected probands and 13 unaffected siblings. To avoid a selection for younger individuals among the unaffected siblings, they were studied
only if they were older, or less than 2 years younger, than
the affected sibling.
Results of the repertoire analysis for 66 BV-BJ
combinations in the 9 affected probands (Figure 7) were
consistent with the findings in the 15 unrelated RA
patients shown in Figure 2. All 9 RA patients had CD4
clonality, with the numbers of clonotypes varying between 1 and 9 per patient. Expanded CD4 clonotypes
were detected in all 13 unaffected siblings. There was a
trend for the unaffected siblings to express a slightly
lower number of clonotypes (2.2 in unaffected siblings
versus 3.4 in affected siblings), but all of the unaffected
siblings had a CD4 repertoire distorted toward dominant
clonotypes. Both distributions were significantly different from those of the normal controls ( P = 0.005 and P
= 0.0003, respectively). T cell clones derived from
affected and unaffected relatives did not show any TCR
p-chain sequence homologies. In general, T cell clones
from the sibpairs used different BV-BJ combinations.
Only one BV-J combination (BV17-BJlS1) was shared
by 2 siblings, but these sequences differed in CDR3
length and CDR3 amino acid polymorphisms. The finding of CD4 clonality in unaffected family members
suggests as one possibility that clonal proliferation is
under genetic control and may represent a genetic risk
factor for the disease.
DISCUSSION
Infiltration of the synovial membrane with CD4-t
T cells has provided evidence of a fundamental role of
the immune system in RA. It has been assumed that the
recruitment of effector T cells is driven by a locally
residing antigen. Our present data indicate that RA
patients have major changes in the afferent limb of the
immune system, raising the possibility that in addition to
antigen recognition, other factors may contribute to the
accumulation of T cells in the joint.
Proliferation and clonal expansion of circulating
T cells has been reported in RA patients. Generally,
such T cell populations have been phenotyped as CD8+
(16). Oligoclonality of CD8+ cells is also frequently
found in normal individuals (17,18). Clonal expansion of
CD8+ cells is so common that it is unlikely to represent
a pathologic event per se. However, there is a trend for
older individuals and patients with RA to have more of
such expanded CD8 clonotypes (19). Conversely, diversity of the CD4+ compartment continues to be a
hallmark of the immune system. The availability of an
enormous spectrum of TCR specificities expressed on
CD4+ T cells is a fundamental principle linked to the
requirement to be able to recognize the universe of
antigens (20). In RA patients, multiple CD4+ clonotypes have undergone expansion. The presence of multiple clonotypes distinguishes RA patients from patients
with psoriatic arthritis, demonstrating that chronic joint
inflammation alone is insufficient to induce CD4+
lymphoproliferation.
Several additional lines of evidence indicate that
the proliferation of selected CD4+ T cells is not an
epiphenomenon induced by the disease process. CD4+
clonotypes are present in RA patients in very early
disease. We have isolated clonally expanded CD4+ T
cells from patients presenting with initial symptoms of
polyarthritis who subsequently developed classic RA
(11). In the data presented herein, we have not found a
correlation of clonality with disease duration. If the
OLIGOCLONAL T CELL PROLIFERATION IN RA
CD4+ clonotypes were a direct result of chronic T cell
stimulation, one would expect an increase in the size and
number of clonotypes with progression of the disease.
Finally, we have detected clonal proliferation of CD4+
T cells in unaffected siblings of RA patients. These
findings support the hypothesis that CD4+ clonality
precedes the onset of the disease itself and may be a
critical risk factor.
While we do not yet understand how dominant
clonotypes contribute to the inflammatory process, we
have begun to address mechanisms that lead to the
emergence of proliferating CD4+ T cells. It has been
suggested that a superantigenic stimulation may occur
during the early pathogenic events in RA and may
distort the repertoire of T cells sharing particular BV
elements (21,22). BV3, BV14, and BV17 share a sequence homology in the fourth hypervariable region,
and may therefore bind the same superantigen (22). The
clonotypes themselves might be antigen or autoantigen
specific, and be expanded through chronic stimulation.
Our finding that t h e majority of dominant clonotypes
were identified in the sample of the TCR repertoire
tested would be consistent with such a model. The
nonrandom usage of BV elements could also be explained by an antigen-specific response to a persisting
antigen, without prior superantigenic stimulation. In
several murine models, antigen specificity and restriction
in BV usage have been linked (23,24). There is also
evidence that antigens impose restrictions on the molecular diversity of human T cells that are recruited in
response to a given antigen (25,26). However, in our
study, the V-D-J region encoding the part of the TCR
structure conferring antigen specificity was characterized by a high degree of heterogeneity in the expanded
clonotypes, although 14 of the 15 RA patients shown in
Figure 1 expressed an HLA-DRB1*04 allele.
Although these data do not support the hypothesis of a shared antigen, it cannot be excluded that the
diversity of T cells able to recognize a single antigen is
high, and that a series of 50 CD4+ clones is too small to
detect homologies indicative of a shared antigen. If the
expanded clonotypes are the result of an antigen-driven
response, the relevant antigen would be widely spread.
Interestingly, the highest numbers of expanded clonotypes were found in patients with extraarticular disease.
We have recently put forward the hypothesis that extraarticular R A represents a discrete dimension of disease, and not simply a complication of joint disease
(13,27). Expanded clonotypes may have a role in driving
RA that is manifested as extrasynovial organ disease.
It is also possible that the clonal proliferation of
911
CD4+ T cells results from dysregulation of cell growth.
We have isolated several clonotypes and have not found
evidence of chromosomal translocations (data not
shown). T cell clones do not exhibit uncontrolled growth
behavior and remain dependent upon T cell growth
factors and repetitive restimulation. This finding does
not rule out the possibility that clonally proliferating
T cell clones have a decreased sensitivity to apoptosisinducing signals.
It has been shown that programmed cell death is
an important mechanism in controlling the steady-state
cellularity and diversity of the mature T cell system
(28-30). In spite of ongoing immune responses to
exogenous antigens, the total number of T cells remains
stable. T cell activation is closely linked to activationinduced cell death, in that activated T cells produce a
molecule critically involved in apoptosis, the Fas ligand.
The binding of Fas ligand to its receptor, Fas, expressed
on the T cells, delivers an apoptosis-inducing signal
(31-34). Following antigen-specific stimulation in vivo,
the majority of stimulated lymphocytes undergo programmed cell death and only a small population develops into memory cells. It is therefore unlikely that
antigenic stimulation alone would lead to such a prominence of single T cell specificities as seen in the RA
patients. A reduction in the extent of activation-induced
T cell death or reduced susceptibility of T cells to
undergoing apoptosis when withdrawn from IL-2 could
both explain a defect in clonal downsizing. Indeed,
preliminary evidence on clonotypes expanded in vivo
and isolated from RA patients show that these cells are
more resistant to both apoptosis-inducing stimuli.
The finding that unaffected siblings of RA patients were also characterized by the presence of clonal
proliferation is of particular interest. The siblings in our
study had not lived together for several years to several
decades. A common environmental factor that could
have resulted in the outgrowth of the clonal T cell
population would, therefore, have to have occurred
during childhood or adolescence. It is possible that the T
cell clones we identified had persisted over several
decades, and that all family members had the same
persistent infection.
The alternative explanation for the data is that
the proliferation of selected CD4+ specificities was
under the control of genetic factors. The control individuals could be subsetted into persons lacking clonality
and persons with a low frequency of CD4+ clonotypes,
which is consistent with one or several allelic polymorphisms important in the genetic control of clonal expansion. The inheritance pattern found in the unaffected
912
WAASE ET AL
siblings is not suggestive of a Mendelian trait of a single
gene. Mendelian inheritance should result in variant
phenotypes, whereas unaffected siblings expressed an
invariant phenotype. RA is a polygenic disease. Most
information on the role of inherited risk factors have
been collected on HLA genes. From the pattern of
inheritance in RA multiplex families, it can be predicted
that non-HLA genes exist that also confer risk to
develop the disease. All sibpairs were recruited from
multicase families, and clustering of several genes associated with RA is likely to occur in such families.
Patients with RA and their family members may share
defects in their ability to clonally downsize T cell specificities that favor the clonal expansion of CD4 clonotypes after antigenic stimulation. A genetic defect in
clonal downsizing has previously been described in some
of the autoimmune phenomena in MRL-lpr and MRLgld mice, which express defective Fas and Fas ligand
genes, respectively (35,36). Our results indicate that RA
multiplex families provide a unique tool for searching
for genetic elements involved both in controlling CD4+
T cell homeostasis and in conferring risk for RA.
ACKNOWLEDGMENTS
The authors would like to thank Toni L. Higgins for
secretarial support, and Kurt D. Turner and Darcy M. Richardson for technical assistance. Dr. W. M. O’Fallon provided
expertise in the statistical evaluation and Dr. D. Schaid gave
his advice on the analysis of family data.
REFERENCES
1. Harris ED Jr: Rheumatoid arthritis: pathophysiology and implica-
tions for therapy. N Engl J Med 322:1277-1289, 1990
2. Stastny P: Association of the B-cell alloantigen DRw4 with RA. N
Engl J Med 298:869-871, 1978
3. Gregersen PK, Silver J, Winchester RJ: The shared epitope
hypothesis: an approach to understanding the molecular genetics
of susceptibility to rheumatoid arthritis. Arthritis Rheum 30:120517-13, 1987
4. Nepom G, Erlich TH: MHC class-I1 molecules and autoimmunity.
Annu Rev Immunol 9493-525, 1991
5. Weyand CM, Hicok KC, Conn D, Goronzy JJ: The influence of
HLA-DRB1 genes on the disease severity in rheumatoid arthritis.
Ann Intern Med 117:801-806, 1992
6. Van Boxel JA, Paget SA: Predominantly T cell infiltrate in
rheumatoid synovial membranes. N Engl J Med 293517420, 1975
7. Kurosaka M. Ziff M: Immunoelectron microscopic study of the
distribution of T cell subsets in rheumatoid synovium. J Exp Med
58:1191-1210, 1983
8. Isaacs JD, Watts RA, Hazleman BL, Hale G, Keogan MT,
Cobbold SP, Waldmann H: Humanized monoclonal antibody
therapy in rheumatoid arthritis. Lancet 240:748-752, 1992
9. Moreland LW, Bucy RP, Tilden A. Pratt PW, LoBuglio AF,
Khazaeli M, Everson MP, Daddona P, Ghrayeb J, Kilgarriff C,
Sanders ME, Koopman WJ: Use of a chimeric monoclonal
anti-CD4 antibody in patients with refractory rheumatoid arthritis.
Arthritis Rheum 36:307-318, 1993
10. Firestein GS, Zvaifler NJ: How important are T cells in chronic
rheumatoid synovitis? Arthritis Rheum 33:768-773, 1990
11. Goronzy JJ, Bartz-Bazzanella P, Hu W, Jendro MC, Walser-Kuntz
DR, Weyand CM: Dominant clonotypes in the repertoire of
peripheral CD4+ T cells in rheumatoid arthritis. J Clin Invest
94:2068-2076, 1994
12. Arnett FC, Edworthy SM, Bloch DA, McShane DJ, Fries JF,
Cooper NS, Healey LA. Kaplan SR, Liang MH, Luthra HS,
Medsger TA Jr, Mitchell DM, Neustadt DH, Pinals RS, Schaller
JG, Sharp JT, Wilder RL, Hunder GG: The American Rheumatism Association 1987 revised criteria for the classification of
rheumatoid arthritis. Arthritis Rheum 31:315-324, 1988
3. Weyand CM, Xie C, Goronzy JJ: Homozygosity for the HLADRBl allele selects for extra-articular manifestations in rheumatoid arthritis. J Clin Invest 89:2033-2039, 1992
4. Choi Y, Kotzin B, Herron L, Callahan J, Marrack P, Kappler J:
Interaction of Staphylococcus aureus toxin “superantigens” with
human T cells. Proc Natl Acad Sci USA 863941-8945, 1989
5. Goronzy JJ, Xie C, Hu W, Lundy S, Weyand CM: Restrictions in
the repertoire of allospecific T cells. J Immunol 151:825-835,1993
16. DerSirnonian H, Sugita M, Glass DN, Maier A, Weinblatt ME,
Reme T, Brenner MB: Clonal Va12.1 T cell expansion in the
peripheral blood of rheumatoid arthritis patients. J Exp Med
177:1623-1631, 1993
17. Posnett DN, Sinha R, Kabak S, Russo C: Clonal populations of T
cells in normal elderly humans: the T cell equivalent to “benign
monoclonal gammopathy”. J Exp Med 179:609-618, 1994
18. Hingorani R, Choi IH, Akolkar P, Gulwani-Akolkar B, Pergolizzi
R, Silver J, Gregersen PK: Clonal predominance of TCRs within
the CD8’ CD45RO+ subset in normal human subjects. J Immunol
1515762-5769, 1993
19. Fitzgerald JE, Ricalton NS, Meyer AC, West SG, Kaplan H,
Behrendt C, Kotzin B L Analysis of clonal CD8+ T cell expansions
in normal individuals and patients with rheumatoid arthritis. J
Immunol 154:3538-3547, 1995
20. Davis MM, Bjorkman PJ: T-cell antigen receptor genes and T-cell
recognition. Nature 334:395-401, 1988
21. Kotzin BL, Leung DY, Kappler J, Marrack P: Superantigens and
their potential role in human disease. Adv Immunol 54:99-166,
1993
22. Howell MD, Diveley JP, Lundeen KA, Esty A, Winters ST, Carlo
DJ, Brostoff SW: Limited,T-cell receptor beta-chain heterogeneity
among interleukin 2 receptor-positive synovial T cells suggests a
role for superantigen in rheumatoid arthritis. Proc Natl Acad Sci
U S A 88:10921-10925, 1991
23. Matis LA: The molecular basis of T cell specificity. Annu Rev
Immunol 8:65-82, 1990
24. Zamvil SS, Steinman L The T lymphocyte in experimental allergic
encephalomyelitis. Annu Rev Immunol 8579-621, 1990
25. Oksenberg JR, Panzara MA, Begovich AB,Mitchell D, Erlich HA,
Murray RS, Shimonkevitz R, Sherritt M, Rothbard J, Bernard
CCA, Steinman L Selection for TCR VP-DP-JP gene rearrangements with specificity for a myelin basic protein peptide in brain
lesions of multiple sclerosis. Nature 362:68-70, 1993
26. Moss PAH, Moots RJ, Rosenberg WMC, Roland-Jones SJ, Bodmer HC, McMichael AJ, Bell JI: Extensive conservation of a and
b chains of the human T cell antigen receptor recognizing
HLA-A2 and influenza A matrix peptide. Proc Natl Acad Sci
U S A 88~8987-8990, 1991
27. Goronzy JJ, Weyand CM: Vasculitis in rheumatoid arthritis. Curr
Opin Rheumatol 6:290-294, 1994
28. Krammer PH, Behrmann 1. Daniel P, Dhein J, Debatin KM:
Regulation of apoptosis in the immune system. Curr Opin Immuno1 6:279-289, 1994
OLIGOCLONAL T CELL PROLIFERATION IN RA
29. Cohen JJ, Duke RC, Fadok VA, Sellins KS: Apoptosis and
programmed cell death in immunity. Annu Rev Immunol 10:267293, 1992
30. Kroemer G: The pharmacology of T cell apoptosis. Adv
Immunol58:211-296. 1995
31. Dhein J, Walczak H, Baumler C, Debatin KM, Krammer PH:
Autocrine T-cell suicide mediated by APO-l/(Fas/CDOS). Nature
373:438 - 44 1, 1995
32. Brunner T. Mogil RJ, LaFace D, Yo0 NJ, Mahboubi A, Echeverri
F, Martin SJ, Force WR. Lynch DH, Ware C F Cell-autonomous
Fas (CD9S)/Fas-ligand interaction mediates activation-induced
apoptosis in T-cell hybridomas. Nature 373:44-444. 1995
33. Ju ST, Panka DJ, Cui H, Ettinger R, El-Khatib M. Sherr DH.
Stanger BZ, Marshak-Rothstein A: Fas(CD9S)IFasL interactions
913
required for programmed cell death after T-cell activation. Nature
373:444-448, 1995
34. Alderson MR, Tough TW, Davis-Smith T, Braddy S, Falk B,
Schooley KA, Goodwin RG, Smith CA, Ramsdell F, Lynch DH:
Fas ligand mediates activation-induced cell death in human T
lymphocytes. J Exp Med 181:71-77, 1995
35. Watanabe-Fukunaga R, Brannan CI, Copeland NG, Jenkins NA,
Nagata S: Lymphoproliferation disorder i n mice explained by
defects in Fas antigen that mediates apoptosis. Nature 356314317. 1992
36. Lynch DH, Watson ML, Alderson MR, Baum PR, Miller RE,
Tough T. Gibson M, Davis-Smith T, Smith CA, Hunter K, Bhat D.
Din W, Goodwin RG, Seldin MF: The mouse Fas-ligand gene is
mutated in gld mice and is part of a TNF family gene cluster.
Immunity 1:131-136, 1994
Документ
Категория
Без категории
Просмотров
4
Размер файла
886 Кб
Теги
oligoclonal, siblings, patients, proliferation, arthritis, unaffected, rheumatoid, cells
1/--страниц
Пожаловаться на содержимое документа