close

Вход

Забыли?

вход по аккаунту

?

Существуют несколько факторов риска развития рака толстой кишки

код для вставкиСкачать
Казахский национальный университет имени аль-Фараби
УДК 575.1/.2:616-006:612.36 На правах рукописи
ИСАБЕКОВА АСЕЛЬ САНИЯРБЕКОВНА
Структурно-функциональные свойства генов и микроРНК, ответственных за возникновение рака толстой кишки 6D060700- Биология (образовательная программа "6D060722- Молекулярная и клеточная биология")
Диссертация на соискание ученой степени
доктора философии (PhD)
Научные консультанты: доктор биологических наук, профессор Иващенко А.Т.;
Professor, PhD Regnier M. Республика Казахстан
Алматы, 2012
СОДЕРЖАНИЕ
ОБОЗНАЧЕНИЯ И СОКРАШЕНИЯ
4 ВВЕДЕНИЕ
5 1ОБЗОР ЛИТЕРАТУРЫ 10 1.1Рак толстой кишки и его генезис10 1.1.1Рак толстой кишки социально значимое заболевание10 1.1.2Генезис рака толстой кишки10 1.1.3Наследственные синдромы11 1.1.4 Цитогенетика рака толстой кишки (микросателлитные и хромосомные нестабильности)14 1.1.5Эпигенетика и рак толстой кишки15 1.1.6 Модификация гистонов при раке толстой кишки16 1.1.7Геномный импринтинг при раке толстой кишки17 1.1.8Генетический полиморфизм и риск развития рака толстой кишки17 1.1.9Раковые стволовые клетки19 1.1.10Стадии рака толстой кишки21 1.1.11Ключевые пути развития рака толстой кишки23 1.1.12Методы диагностики рака толстой кишки26 1.2МикроРНК и их роль при раке толстой кишки28 1.2.1 Обнаружение микроРНК28 1.2.2Общая информация о микроРНК29 1.2.3Биогенез микроРНК29 1.2.4Регуляция экспрессии с помощью микроРНК33 1.2.5Предсказывание генов мишеней микроРНК34 1.2.6 Г:У пары и неспаренные нуклеотиды в сайтах взаимодействия микроРНК38 1.2.7Методы верификации сайтов связывания микроРНК39 1.2.8Роль микроРНК в онкогенезе402МАТЕРИАЛЫ И МЕТОДЫ452.1Объекты исследования45 2.2 Классификации генов452.3Поиск сайтов взаимодействия микроРНК с мРНК и описания их характеристик452.4Методика изучения различий между сайтами, предсказанными с помощью программ RNAhybrid и TargetScan472.5Методика изучения различий между сайтами, предсказанными с помощью программ RNAhybrid и miRanda482.6Изучение филогенетической консервативности сайтов предсказанных RNAhybrid48
3
РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЯ
503.1Характеристики генов ассоциированных с развитием РТК503.2Характеристики межгенных микроРНК553.3Взаимодействие межгенных микроРНК с мРНК генов, участвующих в онкогенезе603.4Характеристика взаимодействия микроРНК с генами мишенями683.5Изучение различий между сайтами, предсказанных с помощью программ RNAhybrid и TargetScan713.6Изучение различий между сайтами, предсказанных с помощью программ RNAhybrid и miRanda763.7Изучение филогенетической консервативности сайтов предсказанных RNAhybrid80 ЗАКЛЮЧЕНИЕ
89 СПИСОК ИСПОЛЬЗОВАННЫХ ИСТОЧНИКОВ91 ПРИЛОЖЕНИЕ А115 ОБОЗНАЧЕНИЯ И СОКРАЩЕНИЯ
5'UTR - 5'-untranslated region 3'UTR - 3'untranslated region
AJCC - American Joint Committee on Cancer
CDS - coding sequence
CIMP - CpG island methylator phenotype
CIN - Chromosomal instability
dsRBD - double stranded RNA binding domain
ELISA - Enzyme-linked immunosorbent assay
HITS-CLIP - high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation
L mir - длина микроРНК
MSI - microsatellite instability
PAR-CLIP - photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation
pSILAC - Stable isotope labelling with amino acids in cell culture
qPCR - quantitative real time polymerase chain reaction
TNM - tumor- node-metastasis
RACE - Rapid amplification of 5'complementary DNA ends
RNA-Seq - high-throughput sequencing technologies RIIID - Rnase III domain siRNA - small interfering RNA
ssRNA - single stranded RNA s/l - количество сайтов на определенную длину мРНК UICC - Union for International Cancer Control
5ФУ - 5 фторурацил
н. - нуклеотид
При-микроРНК - первичная микроРНК
Пре-микроРНК - микроРНК прекурсор
РТК - рак толстой кишки
РСК - роковые стволовые клетки
СК - стволовые клетки
Cр. знач. - среднее значение
ВВЕДЕНИЕ
Общая характеристика работы. Работа посвящена исследованию генов и микроРНК, которые участвуют в развитии рака толстой кишки и их структурно-функциональных характеристик и особенностей взаимодействия друг с другом. Актуальность темы исследования.
Одно из актуальных направлений современной биологии является разработка молекулярных маркеров для диагностики опухолей разных локализаций. Определение рака на поздних стадиях является основной причиной высокой смертности от онкологических заболеваний. Рак толстой кишки входит в тройку самых распространенных онкозаболеваний во всем мире с высоким уровнем смертности [1]. Ключевой проблемой является отсутствие методов ранней диагностики. Канцерогенез - сложный многоступенчатый процесс накопления генетических и эпигенетических нарушений, при котором наблюдаются изменения в генах белков и генах микроРНК [2]. Вогелстеин с соавторами разработали схему нарушений, которые регистрируются последовательно на разных стадиях рака толстой кишки [3], но этот набор генов не нарушен у всех больных [4, 5]. Результаты по изучению экспрессии генов, секвенированию полных геномов рака и изучению эпигенетических нарушений показали, что определить основной набор генов для каждого вида рака очень трудно [6]. В большинстве случаях рак толстой кишки определяют на поздних стадиях с наличием множественных мутаций, вследствие чего определить последовательность нарушений очень трудно. Рак в 65-85% случаях возникает в следствии спорадических мутаций [7]. В развитии болезни участвуют множество генов и один ген может участвовать в развитии нескольких онкозаболеваний [8], что также усложняет поиск селективных маркеров диагностики. Установление ассоциативных связей генов, участвующих в онкогенезе, и разработка молекулярных маркеров для диагностики онкозаболеваний является актуальным. Множество работ посвящены изучению ключевых сигнальных путей важных при возникновении рака толстой кишки, которые исследуют генетические и эпигенетические нарушения генов. Тем не менее, генезис основной доли генетических синдромов, обуславливающих высокий риск развития рака толстой кишки, еще не установлен [9]. В данной работе, анализируя накопленные в мире данные по раку толстой кишки, были предложены гены наиболее важные в развитии этого заболевания. На основе этих генов выявлены микроРНК, которые участвуют в их регуляции. МикроРНК - это одноцепочечные РНК, которые регулируют активность генов на уровне мРНК [10]. В последние годы эти регуляторные молекулы активно изучаются, так как они дают надежду в области диагностики, прогнозирования, лечения рака. МикроРНК осуществляют регуляцию трансляционной эффективности мРНК или скорости деградации мРНК за счет комплементарного связывания с мишенью, поэтому экспрессии мРНК не дает достоверную информацию. Так как при высоком уровне экспрессии мРНК синтез его продукта может быть снижен за счет микроРНК [11]. Данные экспрессии микроРНК отражают более достоверную информацию. В настоящее время только для небольшого количества микроРНК определены мРНК-мишени. Большинство микроРНК растений направляют процесс расщепления мРНК-мишеней, образуя почти полностью комплементарные дуплексы с ними [12]. У животных взаимодействие микроРНК с мРНК-мишенью происходит при более низкой степени комплементарности и приводит к подавлению трансляции [13]. На основе небольшого количества экспериментально определенных мРНК мишеней C. elegans были созданы программы, предсказывающие мишени для микроРНК [14]. Опыт первых работ по in silico определению мишеней для микроРНК животных показал необходимость фильтров для снижения доли ложно-позитивных сайтов микроРНК [15]. Сейчас известны десятки программ для предсказания мишеней микроРНК. При создании первых алгоритмов для поиска мишеней были экспериментально определены только несколько сотен микроРНК. Сейчас количество аннотированных, экспериментально подтвержденных микроРНК превышает более двух тысяч микроРНК. Сайты микроРНК, предсказанные разными программами, доступны на разных базах данных (http://www.TargetScan.org/, http://www.micro-RNA.org/, http://diana.pcbi.upenn.edu/cgi-bin/micro_t.cgi, http://pictar.mdc-berlin.de/). Для множества микроРНК нет информации по генам мишеням, так как информация обновляется ежедневно и не успевает пополняться в базах по мишеням микроРНК. В большинстве проектов поиск сайтов мишеней для микроРНК проводится для тысяч генов одновременно. Поэтому на данный момент особенности взаимодействия микроРНК с мРНК-мишенью имеют много неточностей и нуждаются в дальнейшем исследовании. Сайты микроРНК в большинстве случаев определяются в 3' нетранслируемой области [16, 17]. Хотя ряд экспериментальных работ показал наличие сайтов микроРНК во всех участках мРНК (5'UTR, CDS, 3'UTR) [18]. В настоящей работе мы провели поиск сайтов микроРНК по всей последовательности мРНК. Установление ключевых микроРНК в развитие рака толстой кишки, может стать основой для разработки молекулярных маркеров в диагностике этого заболевания.
Объекты исследования - нуклеотидные последовательности 54 генов и 784 межгенных микроРНК. Предмет исследования - структурно-функциональные свойства генов и микроРНК ассоциированных с развитием рака толстой кишки, и сайтов взаимодействия этих генов с микроРНК. Цель и задачи работы. Целью исследования является поиск генов и микроРНК, ответственных за развитие рака толстой кишки, изучение их структурно-функциональных характеристик, изучение особенностей взаимодействия между микроРНК и генами мишенями. Задачи исследования. 1. Определить гены, ассоциированные с развитием рака толстой кишки, и описать их характеристики.
2. Определить микроРНК, ассоциированные с развитием рака толстой кишки, и описать их характеристики.
3. Найти сайты связывания межгенных микроРНК с мРНК генов, ответственных за развитие рака толстой кишки, и изучить особенности их связывания. 4. Изучить распределение сайтов связывания микроРНК в 5'UTR, CDS, 3'UTR мРНК и выявить особенности взаимодействия микроРНК с вторичной структурой мРНК.
5. Изучить различия между сайтами связывания, предсказанными программами RNAhybrid, TargetScan и miRanda.
6. Изучить филогенетическую консервативность сайтов, расположенных в белок кодирующей последовательности мРНК. Научная новизна исследования. Впервые создана база данных 142 генов и 38 микроРНК, которые ассоциированы с развитием рака толстой кишки. Для определения важных микроРНК в онкогенезе рака толстой кишки была создана методика отбора сайтов связывания микроРНК на основе программы RNAhybrid. С помощью этой методики были предложены 185 ранее не описанных сайтов для 120 микроРНК, которые могут быть основными в регуляции генов, ответственных за развитие рака толстой кишки. Создана новая классификация сайтов связывания по вкладу микроРНК в энергию гибридизации. Впервые было установлено, что во всех сайтах предсказанных программой RNAhybrid, микроРНК связываются с неспаренными нуклеотидами во вторичной структуре мРНК, которые служат основой для образования связи между микроРНК и мРНК.
Впервые сравнены программы RNAhybrid, miRanda и TargetScan по способности предсказывать сайты связывания с высокой комплементарностью и установлены недостатки программы TargetScan в выявлении таких сайтов. Впервые установлена филогенетическая консервативность сайтов связывания микроРНК, локализованных в кодирующей области мРНК. Теоретическая значимость исследования. В результате исследования предложены гены и микроРНК, ассоциированные с развитием рака толстой кишки, которые расширяют фундаментальные представления об этом заболевании. В работе показано наличие в геноме человека сайтов связывания микроРНК с высокой комплементарностью. На основе сайтов, отобранных по разработанной нами методике, были показаны отличия между программами RNAhybrid, TargetScan, miRanda. Практическая ценность работы. Установленные in silico сайты взаимодействия микроРНК с мРНК могут быть основой для экспериментальных работ по верификации сайтов микроРНК. Введенная методика по отбору сайтов может быть использована для выявления сайтов с высокой комплементарностью. Полученные данные по микроРНК могут использоваться для разработки молекулярных маркеров в диагностике рака толстой кишки. Разработанная методика изучения филогенетической консервативности сайтов в кодирующей последовательности мРНК может применяться для подтверждения сайтов связывания микроРНК. Основные положения, выносимые на защиту:
Созданная база данных по генам и микроРНК, ассоциированным с развитием рака толстой кишки, и их сайты взаимодействия пригодны для разработки молекулярных маркеров этого заболевания.
Геном человека содержит множество генов, которые имеют сайты связывания микроРНК с высокой комплементарностью. В 5'UTR, CDS и 3'UTR мРНК генов человека имеют сайты связывания микроРНК. Плотность сайтов микроРНК в 5'UTR в несколько раз выше, чем CDS и 3'UTR.
Существуют три вида сайтов связывания микроРНК с мРНК в зависимости от вклада микроРНК в энергию гибридизации: 5'-доминантный, 3'-доминантный сайты и сайты с центральным доминированием. Неспаренные нуклеотиды во вторичной структуре мРНК служат основой для образования связи между микроРНК и мРНК.
Сайты взаимодействия микроРНК с высокой комплементарностью, расположенные в CDS, имеют высокую филогенетическую консервативность. Связь с планом основных научных работ. Диссертационная работа выполнена в рамках проекта "Структурно-функциональные свойства генов человека, ответственных за некоторые онкологические заболевания. Их маркирование и диагностика заболеваний".
Апробация работы. Материалы диссертационной работы доложены и обсуждены:
* на Международном конгрессе студентов и молодых ученых "Мир науки"/КазНУ (2010 и 2012, Алматы, Казахстан); * на Международной конференции "The 7th and 8th international Conference on Bioinformatics of Genome regulation and Structure \ systems biology." BGRS\SB'10 и BGRS\SB'12 (2010 и 2012, Новосибирск, Россия); * на Международном междисциплинарном симпозиуме "Нанотехнология и ноосферология в контексте системного кризиса цивилизации" (2011, Симферополь-Ялта);
* на VI Московском международном конгрессе "Биотехнологя: состояние и перспективы развития" (2011, Москва, Россия);
* на Международной конференции "Advances in Stem Cell Rasearch"/ 3rd EMBO Stem Cell Conference (2011, Paris, France);
* на Международной конференции "Non-coding RNA, Epigenetic Memory, and the Environment" (2011, London, UK);
* на международной конференции MCCMB'11 (2011, Moscow, Russia);
* на Международной конференции "International Conference on Bioinformatics, Computational Biology and Biomedical Engineering" (2011, Paris, France); * на Международной конференции "NCRI Cancer conference" (2011, Liverpool, UK); * на 13-м Международном PhD симпозиуме "The Rhythm of Life: Cycles in biology" (2011, Heidelberg, Germany); * на 2-ой Международной конференции Астана Биотех2011(2011, Астана, Казахстан); * на Международной научно-практической конференции "Фармацевтические и медицинские биотехнологии (2012, Москва, Россия)
* на третьей Московской международной конференции "Molecular Phylogenetics" "MolPhy-3" (2012, Москва, Россия);
* на 9-ой Международной конференции "Nanosciences & Nanotechnologies" (NN12) (2012, Greece);
* на Международной конференции Развитие нанотехнологий: задачи международных и региональных научно-образовательных и научно-производственных центров (2012, Барнаул, Россия).
Публикации. Основное содержание диссертации отражено в 31 печатных работах, в том числе 1 статье в международном издании цитируемой в Thomson Royters и 1 статье принятой в журнал с импакт фактором, 1 статье цитируемой в Scopus, 12 статьях в республиканских научных журналах, 16 в тезисах международных конференций и симпозиумов.
Структура диссертации. Диссертация состоит из обозначений и сокращений, введения, литературного обзора, материалов и методов, результатов и обсуждения, включающего 3 подраздела, заключения и списка использованных источников из 350 наименований, содержит 29 таблиц и 13 рисунков и 1 приложение. ОБЗОР ЛИТЕРАТУРЫ 1.1 Рак толстой кишки и его генезис
1.1.1 Рак толстой кишки социально значимое заболевание
Рак толстой кишки (РТК) одно из распространенных онкозаболеваний во всем мире. Часто рак толстой кишки рассматривают как колоректальный рак, то есть рак толстой и прямой кишки. Механизмы возникновения этих новообразований сходные. Согласно данным проекта "Globocan 2008" международной организации исследований по раку, рак толстой кишки занимает третье место по частоте встречаемости у мужчин (после рака легких и рака простаты) и второе у женщин (после рака молочной железы) в мире. Ежегодно в мире регистрируется около миллиона больных колоректальным раком и 440000 смертей от этого заболевания [1]. По смертности это заболевание стоит на четвертом месте (после рака легкого, желудка и печени) среди всех новообразований в мире [19, 20] и составляет примерно 33% летальных исходов в развивающихся странах [21]. В настоящее время колоректальный рак становится все более значимой патологией в Республике Казахстан. Каждый год в республике выявляется более 2000 больных с колоректальным раком [22]. Согласно Приказу Министерства здравоохранения Республики Казахстан № 145 от 16 марта 2011 года в республики Казахстан проводится скрининг для выявления предопухолевых и опухолевых заболеваний толстой и прямой кишки [23]. Основной проблемой малоэффективного лечения рака толстой кишки является выявление заболевания на поздней стадии. Отсутствуют эффективные методы ранней диагностики, вследствие чего заболевание определяется на поздней стадии и часто с сопутствующими метастазами. Выяснение начальных стадий онкогенеза остается актуальным и для этого необходимо установление пусковых причин развития злокачественных опухолей.
1.1.2 Генезис рака толстой кишки
Рассмотрим кратко генетические и эпигенетические нарушения экспрессии белок-кодирующих генов при развитии рака толстой кишки. РТК можно подразделить на две группы: наследственно предрасположенный и спорадический. В разных странах 10-30% случаев развитие рака обусловлено наследственными генетическими изменениями [7]. Принято считать, что спорадический РТК развивается через последовательное накопление генетических и эпигенетических мутаций и, как правило, канцерогенез является многоступенчатым процессом [2]. В некоторых случаях изменяются специфические локусы, детерминирующие активацию онкогенов или инактивацию генов-онкосупрессоров рака. Глобально рак связан с хромосомными и микросателлитными нестабильностями, которые увеличивают возможность приобретения добавочных повреждений генов, значимых для канцерогенеза.
1.1.3 Наследственные синдромы
Существуют несколько факторов риска развития РКТ: возраст старше 50 лет, особенности питания, генетические синдромы, предшествующие заболевания и т.д. Семейные случаи развития рака толстой кишки занимают большой процент этого заболевания. Было показано рядом исследователей, что семейный рак составляет приблизительно 30% [24, 25]. Около 5% всех случаев рака ассоциировано с хорошо изученными наследственными мутациями и охарактеризованной клинической картиной. Этиология оставшихся 20-30% случаев наследственного колоректального рака до конца неизвестна, больные этой группы имеют родственников с полипозом или РТК. Этиология может быть связана с полиморфизмов генов, участвующих в регуляции метаболизма или генов, регулируемых другими генетическими факторами. В ряде случаев причиной могут быть изменения генов в ломких локусах, которые имеют множественные эффекты [9]. К группе генетических синдромов c полипозом относятся диффузный семейный полипоз, синдром Гарднера-Тернера, синдром Пейтца-Джигерса, болезнь Тюрка [26]. Синдромы рака толстой кишки классифицируются на основе клинических, патологических и генетических исследований. В основном синдромы классифицируются по характеристике множественных полипов. Полипозные синдромы делятся на аденоматозные, гамартоматозные и гиперпластические полипозисы [27]. К синдромам с аденоматозными полипами относятся: сидром Линча, семейный аденоматозный полипоз, аттенуированный семейный аденоматозный полипоз, MUTYH-ассоцированный полипоз [28]. Диффузный семейный полипоз, аттенуированный семейный аденомазный полипоз, синдром Гарднера обуславливаются мутациями в гене APC, белок которого отвечает за уровень β-катенина в цитозоле. Белок гена APC негативный регулятор в Wnt/Wingless (Wg) сигнальном пути трансдукции. Разница между этими тремя синдромами в локализации мутации в гене APC. Синдром диффузного семейного полипоза является наиболее распространенным наследственным фактором развития рака толстой кишки, он составляет около 1% от всех случаев возникновения рака [27]. Аденомы развиваются после первой декады жизни. Это заболевание передается по аутосомно-доминантному типу. Диффузный полипоз рассматривается как облигатный предрак, и если его не лечить, то он в 98% случаев перерождается в рак [29]. Средний возраст определения рака 39 лет. В 7% случаях рак развивается к 21 году, а в 95% случаях к 50 годам. Это заболевание может проявляться как остеомы, дентальные нарушения, врожденной гипертрофией пигментного эпителия сетчатки и опухолями вне кишечника (фиброзный рак, рак желудка, щитовидной железы, поджелудочной железы и т. д.) [30].
Аттенуированный семейный аденоматозный полипоз является причиной менее агрессивного вида рака. Заболевание характеризуется меньшим количеством полипов (обычно от 10 до 100). Риск рака толстой кишки составляет 69%, возникновение аденом начинается в более позднем возрасте. Также могут возникать другие патологии [28]. Синдром Гарднера - это вариант диффузного семейного полипоза, который характеризуется симптомами внутри и вне кишечника [31]. Болезнь Тюрка характеризуется диффузным полипозом толстой кишки и опухолями центральной нервной системы [26]. Синдром Линча связывают с возникновением наследственного неполипозного колоректального рака обусловленного мутациями в генах MSH2, MLH1 PMS1, PMS2, MSH6, продукты которых участвуют в репарации ДНК [32]. Синдром Линча является причиной развития РТК в 2-3% случаях этого заболевания. При развитии этого синдрома вероятнее образование небольшого количества полипов. Риск развития рака составляет 80%. Рак толстой кишки и полипы развиваются в раннем возрасте и имеют проксимальное расположение. В 90% случаях синдром Линча возникает за счет мутаций в генах MSH2 и MLH1 [33, 34]. Гены MSH2 и MLH1 также являются причиной развития синдрома Muir-Torre. Синдром Линча характеризуется и наличием микросателлитных нестабильностей. Недавно обнаружено, что делеции в гене EpCAM приводят к развитию одной разновидности неполипозного рака толстой кишки [35]. Группа синдромов гамартоматозными полипами относится к редко встречаемым заболеваниям, при которых полипы развиваются в раннем возрасте. Гамартоматозные полипы образуются при синдроме Пейтца-Джигерса, ювенильного полипозного синдрома, смешанного полипозного синдрома и др. Чаще всего среди гамартоматозных синдромов встречаются синдром Пейтца-Джигерса и синдром ювинильного полипоза. Синдром Cowden тоже относится к этой группе синдромов, но как все остальные синдромы этой группы встречается очень редко [36]. Синдром Пейтца-Джигерса аутосомно-доминантное заболевание, характеризующее гамартоматозными полипами в желудочно-кишечном тракте и пигментными кожно-слизистыми поражениями, которые преимущественно появляются в детстве на губах, слизистой оболочке щек. Сидром может привести к развитию рака желудочно-кишечного тракта, поджелудочной железы, легких, груди, мочевого пузыря и т.д. Индивиды с этим синдромом имеют от 81 до 93% риска развития рака в течение жизни [37, 38].
Ювенильный полипозный синдром не имеет фенотипических характеристик как синдром Пейтца-Джигерса. В основном полипы образуются в толстой кишке, также могут быть в желудке, двенадцатиперстной и тонкой кишке. Риск развития рака составляет 39% в течение жизни [39, 40].
Таблица 1 - Наследственные синдромы рака толстой кишки [9, 24 ,25] Синдром ГеныЗакономерность наследования Предоминантный ракСемейный аденоматозный полипозиз (FAP)APCДоминантныйТолстая кишка, весь кишечникАттенуированный семейный аденомазный полипозAPCДоминантныйСиндром Гарднера-Тернера APCДоминантныйАттенуированный полипозAXIN2 ДоминантныйТолстая кишки Синдром Пейтца-Джигерса STK11ДоминантныйМножественный (включая толстую кишки)Синдром Cowden PTEN ДоминантныйМножественный (включая толстую кишки)Синдром Ювинильного полипоза BMPR1A ДоминантныйЖелудочно-кишечный тракт SMAD4 (DPC4) ДоминантныйЖелудочно-кишечный трактСидром Линча
MLH 1, MSH2, MSH6, PMS2ДоминантныйМножественный (включая толстую кишку, мочевой пузырь, и др.)EPCAM (TACSTD1)ДоминантныйМножественный (включая толстую кишку, мочевой пузырь, и др.)Muir-Torre синдром MSH2, MLH1Также как при сидроме Линча и плюс карциномы сальных желез и молочной железыMUTYH-ассоцированный полипоз MYH (MUTYH) Рецессивныйтолстую кишкуBloom BLMРецессивныйМножественный (включая толстую кишки)Семейный стромальный рак желудочно-кишечного трактаKITЖелудочно-кишечный тракт стромальный рак PDGFRAЖелудочно-кишечный тракт стромальный рак Гиперпластические полипозные синдромы встречаются редко, характеризуются множественными или большими гиперпластическими полипами в толстой кишке. В большинстве случаев этиология заболеваний неизвестна. Международная организация Здравоохранения определила критерии гиперпластического полипозного синдрома, согласно которым при синдроме должен быть один из следующих признаков: 1. может быть около 30 (хотя чаще используется 20) гиперпластических полипов расположенных в толстой кишке или от одного до пяти больших полипов в определенной области кишки; 2. должно быть пять гиперпластических полипов, расположенных в проксимальной части сигмоидной толстой кишки [41, 42]. 1.1.4 Цитогенетика рака толстой кишки (микросателлитные и хромосомные нестабильности)
Генетические и эпигенетические изменения, которые могут привести к развитию опухоли, следующие: точечные мутации, изменение плоидности, вставки или делеции, транслокации и абберантное метилирование, модификация гистонов (ацетилирование и метилирование гистонов). Для рака толстой кишки приобретение геномных нестабильностей является одной из предпосылок развития этого заболевания. Существуют три основных вида геномных нестабильностей: микросателлитные нестабильности (MSI), хромосомные нестабильности (CIN) и метилирование CpG островков (CIMP) [6, 43]. Микросателлитные нестабильности являются причиной возникновения 15-20% спорадического рака. Это хорошо изученный вид рака, который происходит за счет потери или инактивации генов ДНК мис-матч репарации [44]. В основном при микросателлитной нестабильности сохраняется нормальный кариотип [45]. Хромосомные нестабильности - частая патология при раке толстой кишки, которая встречается примерно в 80-85% случаях [46]. При хромосомной нетабильности характерно наличие перестроек хромосом и большое количество нарушений. CIN используется для описания анеуплоидов и полиплоидов, делеций хромосом или хромосомных плеч, потеря гетерогенности [47]. Хромосомные нестабильности приводят к потере генов супрессоров-рака, таких как APC, TP53, SMAD4 и др. [8]. Развитие рака толстой кишки связано с часто встречаемыми геномными потерями. Аккумуляция потери 8q21, 15q11-q21, 17p12-13, 18q12-21 локусов и вставки в 8q23, 13q14, 20q13 областях ассоциировано с переходом аденомы в карциному [48]. Было показано, что делеции в хромосоме 4 приводят к развитию агрессивной формы рака, плохим прогнозам течения рака. Появление метастаз в печени связано с делециями 8p и вставками в хромосомах 7q и 17q, также на прогрессирующей стадии метастазирования ассоциированы с делециями 14q и вставками 1q, 11, 12p, 19 [49]. Несколько групп ученых провели полный анализ мутаций, связанных с раком толстой кишки, и было выявлены наиболее часто встречающиеся трисомии: + 7, +13, +20, +Х; среди моносомиков -4, -5, -8, -10, -14, -15, -17, -18, -21, -22, -Y [50]. 1.1.5 Эпигенетика и рак толстой кишки
У млекопитающих большинство CpG сайтов (90-98%) метилированы, но в геноме существуют CpG богатые районы, где основная масса островков не метилирована. Также существуют гены, участвующие в импринтинге, которые регулируются за счет метилирования CpG островков в промоторной области. Таблица 2 - Эпигенетические изменения при раке толстой кишки [51-55]
Гены, участвующие в РТКНазвание генаФункция гена и эпигенетические нарушения123APCAdenomatosis polyposis coliГен супрессор-опухолиMGMTO-6-methylguanine-DNA methyltransferaseРепарация ДНК повреждений, гиперметилированиеCDKN2A/P14Ciclin-dependent kinase inhibitor 2A, alternated readig frameГен супрессор-опухоли, регуляция клеточного циклаHLTFHelicase-like transcription factorФактор ремоделирование хроматинаhMLH1, hMLH2MutL homolog 1,2Ген ДНК репарацииCDKN2A/P16Cyclin-dependent kinase inhibitor 2AГен супрессор-опухоли, регуляция клеточного циклаCDH13H-cadherinРегулятор процессов адгезии-отлипанияUNC5CUnc-5 homolog CОдин из рецепторов к Netrin-1DCCDeleted in colorectal carcinomaГен супрессор-опухоли, который контролирует апоптозCOX2Prostaglandineendoperoxide synthase 2Участвует в процессах воспаления, митогенеза, ангиогенеза опухоли, метастазированияHACE 1E3 ubiquitine ligaseМетилирование этого гена предшествует метастазированиюRASSF1ARas association (RalGDS/AF-6) domain family 1Ген супрессор-опухоли, в апоптозе ассоциированный с рецептором смерти, расположен в микротрубочкахRUNX3Runt-related transcription factor 3Транскрипционный фактор, который может действовать как активатор и супрессор
Продолжение таблицы 2 123SOCS1Suppressor of cytokin signaling 1Белок гена действует как негативный регулятор в JAK/STAT3 сигнальном пути. CHFRCheckpoint with FHA and RING fingerCHFR действует в G2/M чекпоинте, поэтому является геном супрессоромADAM23A disintegrine and metalloproteinase domain 23Белок участвует в многих процессах межклеточного взаимодействия и взаимодействия между клеткой и матриксом DLEC1Deleted in lung and oesophageal cancer 1Ген супрессор-опухоли ингибирующий клеточную пролиферациюSERF1Secreted frizzled-related protein 1Эпигенетическое выключения этого гена приводит к активации Wnt путиMYODMyogenic factor 3Ингибирует клеточный цикл за счет стимуляции экспрессии p21P15Cyclin-dependent kinase inhibitor 2BP73Tumor protein p73Белок участвует в апоптотическом ответе на ДНК повреждения, делеции обнаружены при многих опухолях Гиперметилирование ДНК происходит в специфических регуляторных сайтах в промоторной области или повторяющихся последовательностях. Высокий уровень метилирования цитозина в CpG островках генов супрессоров-опухоли приводит к блокированию трансляции. В опухолях различной локализации были обнаружены аналогичные нарушения. Эпигенетические нарушения являются признаком рака, в том числе и при РТК. Другие эпигенетические нарушения включают ацетилирование гистонов. Таблица 2 представляет эпигенетические нарушения, которые были обнаружены при РТК [51-55].
1.1.6 Модификация гистонов при раке толстой кишки
Другой вид эпигенетического изменения - модификация хроматина, то есть ковалентная модификация гистонов хроматина. Ацетилирование гистонов - признак активного участка хроматина, процессы ацетилирования-деацетилирования происходят за счет ферментов гистон деацетилаз (HDAC) и гистон ацилтрансфераз. Фосфорилирование серина 10 в гистоне H3 коррелирует с инактивацией генов у млекопитающих, метилирование лизина 9 в гистоне H3 связано с выключением гена. Модификации кончиков гистонов распознаются ферментами ремоделирования хроматинов, которые могут модифицировать структуру хроматина. CDH5 (Chromodomain helicase DNA-binding protein 5) ген супрессор-опухоли, который участвует в процессах пролиферации, апоптоза, клеточного старения. Было найдено, что эпигенетическая инактивация гена CDH5 приводит к абберантному структурному изменению хроматина в геномах раковых больных (РТК, рак молочной железы, рак шейки матки, глиома) [56].
RGC-32 (Response gene to complement 32) ген, который является субстратом и регулятором CDC2, его гиперэкспрессия индуцирует клеточный цикл. Высокий уровень продукта гена RGC-32 было найден на поздних стадиях рака толстой кишки. Нокаут этого гена приводит к увеличению ацетилирования гистонов H2BK5, H2BK15, H3K9, H3K18, H4K8, а также уменьшению экспрессии SIRT1 и уменьшению триметилирования гистона H3K27. Эти данные подтверждают участие гена в РТК за счет регуляции хроматинового ансамбля [57].
1.1.7 Геномный импринтинг при РТК
Метилирование цитозина в промоторной CpG области генов-онкосупрессоров опухоли подавляет транскрипцию и является причиной развития РТК [58]. По некоторым данным изменения отпечатка метилирования (геномный импринтинг) переданного от родителей может играть важную роль в малигнизации. Геномный импринтинг - эпигенетический феномен, характеризующийся моноаллельной экспрессией генов в зависимости от их родительского происхождения. Молекулярную основу такой экспрессии составляют ковалентные модификации ДНК и гистоновых белков, происходящие при созревании половых клеток. Аномалии формирования геномного импринтинга в гаметогенезе или его поддержания на различных этапах онтогенеза являются причинами развития опухоли. Потеря импринтинга в локусе IGF2 обнаружена при раке толстой кишки [59].
1.1.8 Генетический полиморфизм и риск развития рака толстой кишки
Полиморфизм может быть показателем чувствительности разных индивидов к развитию рака толстой кишки. Связь полиморфизма с раком изучают классическим методом генов кандидатов (на основе известных функций генов и их значимости в метаболических путях, связанных с развитием рака толстой кишки) и с помощью геномных ассоциативных исследований, когда тестируется полмиллиона или более однонуклеотидных полиморфизмов. Генетические варианты или полиморфизмы многих генов ассоциированы с риском развития рака толстой кишки (Таблица 3). Варианты генов ассоциированных с РТК включают APC-I1307K, HRAS1-VNTR, MTHFR, NAT1, NAT2, GSTM1, GSTT1, GSTP1 [60, 61]. Таблица 3 - Некоторые гены и локусы, ассоциированные с риском развития РТК [62]
Ген или локусВид исследованияЗамечания GSTT1Мета-анализ ген-ассоциированного исследованияНулевой генотип GSTT1 гена повышает риск РТКGSTM1Мета-анализ ген-ассоциированного исследованияНулевой генотип GSTM1 гена повышает риск РТК COX2Мета-анализ ген-ассоциированного исследованияПолиморфизм в промоторе гена повышает риск РТКMTHFRМета-анализ ген-ассоциированного исследованияMTHFR 677 C>T ассоциирован с риском к РТК NATsВзаимодействие гена с окружающей средойNATs полиморфизм и курение повышает риск РТКMTRМета-анализ ген-ассоциированного исследованияMTR 2756 A>G ассоциирован с риском к РТКSMAD7Генетический-ассоциированные исследованияВарианты гена SMAD7 ассоциированы с риском к РТКAPC Генетический-ассоциированные исследованияAPC I1307 ассоциированы с риском к РТКIGF1Генетический-ассоциированные исследованияполиморфизм промотора IGF1 гена ассоциирован с развитием Сидрома Линча8q23.3Генетический-ассоциированные исследованияАссоциирован с риском РТК8q24Генетический-ассоциированные исследованияАссоциирован с риском РТК10p14Генетический-ассоциированные исследованияАссоциирован с риском РТК11q23Генетический-ассоциированные исследованияАссоциирован с риском РТК15q13Генетический-ассоциированные исследованияАссоциирован с риском РТК14q22.2Мета-анализ геном-ассоциированного исследованияАссоциирован с риском РТК16q22.1Мета-анализ геном-ассоциированного исследованияАссоциирован с риском РТК18q21Геном-ассоциированные исследованияАссоциирован с риском РТК19q13.1Мета-анализ геном-ассоциированного исследованияАссоциирован с риском РТК20p12.3Мета-анализ геном-ассоциированного исследованияАссоциирован с риском РТК Описан целый ряд полиморфизмов, для которых был подтвержден риск развития РТК. Например, диабет ассоциированные варианты гена TCF7L2, который участвует в WNT сигнальном пути. Аллели генов IGF-1, IGFBP-3 вместе с разными факторами окружающей среды и образа жизни по разному влияют на риск развития РТК [63]. Один из вариантов 1-рецептора к TGF-β (TGFBR1*6A) известен как фактор риска развития РТК, который составляет около 3% случаев РТК [64]. Варианты SMAD7 (rs12953717) также связывают с риском развития РТК [65]. Описанные и другие генетические варианты изменяют экспрессию генов, чувствительных к раку толстой кишки. Взаимодействие гена с геном важная детерминанта, которая может определять риск развития рака. Полиморфизм может влиять на изменения чувствительности гена, например, APC-I1307K вариант гена APC может в 2 раза увеличить риск возникновения аденом. Было показано, что этот вариант чувствителен к мутациям, то есть у обладателей этого варианта повышен риск развития РТК [66, 67].
Другой вариант гена APC (APC-D1822V) имеет очень низкий риск возникновения РТК у женщин после менопаузы, и считается, что обладатели этого варианта толерантны к РТК [68].
1.1.9 Раковые стволовые клетки
Лечение рака толстой кишки предусматривает операционное удаление опухоли и химиотерапию. После такой терапии у большинства больных в течение месяца или года наблюдается ремиссия заболевания. После этого периода в 30-50% случаях происходят рецидивы обычно в виде метастаз. Возобновления рака зависит от стадии, на которой определили рак. На первой стадии колоректального рака у большинства пациентов не возникают рецидивы (95-98%), на второй стадии в 20-25% и на третьей стадии в 40-50% заболевание возобновляется после лечения. Основная доля смертности наблюдается у больных с рецидивами. Основной причиной возникновения рецидивов обусловлено наличием пролиферирующих клеток, против которых не эффективна химиотерапия. В организме только один тип клеток имеет такие свойства, это - стволовые клетки [69].
Нормальные стволовые клетки в толстой кишке расположены в криптах между кишечными субэпителиальными миофибробластами. Эпителий желудочно-кишечного тракта постоянно самообновляется за счет стволовых клеток, большинство дифференцированных клеток желудочно-кишечного тракта обновляются каждые 2-7 дня [70]. В норме СК продуцируют около 1010 клеток, которые дифференцируются по вертикальной оси [71]. Существует предположение, согласно которому накопление генетических и эпигенетических мутаций приводит к образованию раковых стволовых клеток из стволовых клеток взрослого организма [72]. Эти клетки являются причиной малигнизации тканей, а также причиной развития метастазов. После образования таких клеток химиотерапия и лучевая терапия, как правило, малоэффективны, так как у стволовых раковых клеток множество защитных механизмов. Таблица 4 - Потенциальные маркеры нормальных и раковых стволовых клеток толстой кишки [80]
МаркерыФункцияНормальные стволовые клетки толстой кишкиLgr5 (GPR49)Ген-мишень Wnt, Lgr5+ клетки после потери гена APC образуют микроаденомы у мышейMsi-1 (musashi-1)Белок, связывающий РНК, экспрессируется временно-амплифицирующимися прогениторными клеткамиCD29 (integrin β1)Адгезивная молекула клеткиDCAMKL-1КиназаРаковые стволовые клетки толстой кишкиCD133 (Prominin 1)Вместе с β-катенином увеличивает риск прогрессирования и уменьшает выживаемость после операционного лечения. Коррелирует с Т-стадией и метастазами. CD24 (HSA)Адгезивная молекула клеткиOCT4Экспресия в желудочно-кишечном тракте приводит к дисплазииSOX2Участвует в процессах инвазивности и метастазирования.c-MycСтимулирует клеточное обновление, экспрессия увеличена в начальных этапах канцерогенезаLgr5 (GPR49)Ген-мишень Wnt, Lgr5+ клетки после потери гена APC образуют микроаденомы у мышейMsi (musashi-1)Белок, связывающий РНК, экспрессируется в временно-амплифицирующихся прогениторных клеткахCD29 (integrin β1)Адгезивная молекула клеткиCD44 (CDW44)Адгезивная молекула клетки, рецептор к гиалуроновой кислотеALDH1 (ALDC)ФерментESA (EpCAM)Адгезивная молекула клеткиCD166 (ALCAM)Адгезивная молекула клетки Частота встречаемости раковых стволовых клеток 1 на 60 000 раковых клеток толстой кишки [73]. Раковые стволовые клетки толстой кишки имеют определенные фенотипические маркеры, такие как CD133+, CD44+, Musashi-1, EpCAM+, CD166+, CD49f. Эти клетки не экспрессируют белки ответственные за дифференцировку (СК20) [74]. Таблица 4 представляет потенциальные маркеры для определения нормальных и раковых стволовых клеток толстой кишки. В основном раковые стволовые клетки толстой кишки выделяют по CD133+ фенотипу. После выделения раковых стволовых клеток проверяется их потенциал самообновления в среде без сыворотки и потенциал к образованию опухоли на иммунно-дефицитных мышах [75]. Обнаружение раковых стволовых клеток изменило понимание канцерогенеза и стратегию терапии. Исследование раковых стволовых клеток показало, что у этих клеток существуют насосы для выведения лекарств, есть изменения в механизмах ДНК-репарации, изменения в чекпоинтах клеточного цикла, неисправный механизм апоптоза. На данный момент медицина может убить дифференцированные и высоко пролиферирующие клетки, а раковые стволовые клетки пролиферативно неактивны, мало дифференцированы, обходят пути апоптоза [76].
На данное время для лечения больных с РКТ при химиотерапии используют комбинацию препаратов из фторурацила (5ФУ), оксалиплатина и леуковорина (FOLFOX) и комбинацию из 5ФУ, оксалиплатина и иринотекан (FOLFIRI). Также для пациентов с метастазами используются моноклональная терапию против anti-VEGF или EGFR [77]. Хотя при наличии РСК это терапия не эффективна. Для борьбы с РСК на данный момент разрабатываются новые подходы лечения. Во-первых, разрабатываются методы стимуляции процессов дифференцировки РСК [78]. Также разрабатываются подходы подавления механизмов выживания, свойственных стволовым клеткам [79]. При обнаружении эффективных методов элиминации РСК можно будет в большинстве случаев побороть рак.
1.1.10 Стадии РТК
В предыдущей части мы упоминали о стадиях рака толстой кишки. Определение стадии очень важно для прогнозирования и назначения терапии при РТК. Существует анатомическая классификация Дюка (1944), которая рассматривает степень проникновения опухоли в стенку кишечника и вовлечения лимфатических узлов в процесс. В 1950 году в Париже в институте Густава-Росси создали классификацию TNM [81]. В 1987 году Международный Центр против Рака (UICC) и Американский Объединенный комитет по Раку (AJCC) унифицировали TNM классификацию. Последнее седьмое издание TNM классификации с поправками вышло в 2009 году (таблица 5). В TNM классификации показатель Т отражает глубину проникновения первичной опухоли в стенку кишки, показатель N - состояние регионарных лимфоузлов, показатель М - наличие или отсутствие отдаленных метастаз. Недостатком этой классификации является то, что не учитывается размер первичной опухоли [82, 83]. На данный момент обе классификации используются на практике. Таблица 5 - ТNМ классификация 2009 года [84, 85] ОписаниеTТх - первичная опухоль не может быть оценена;
Т0 - нет признаков опухолевого роста;
Тis - carcinoma in situ;
Т1 - опухоль распространяется на подслизистый слой;
Т2 - опухоль распространяется на мышечный слой;
Т3 - опухоль проникает через мышечный слой в подслизистую оболочку или в не покрытые брюшиной периколярные ткани;
Т4а - проникновение опухоли в брюшину
Т4b - инвагинация в другие органы или структурыNNx - состояние регионарных лимфатических узлов не может быть оценено
N0 - метастазы в регионарных лимфоузлах отсутствуют
N1: метастазы в 1-3 лимфоузлах
N1a в 1 лимфоузле
N1b в 2-3 лимфоузлах
N1c саттелиты между серозными оболочками, без регионарных лимфоузлов
N2: 4 или больше позитивных лимфоузла
N2a в 4-6 лимфоузлах
N2b в 7 и более лимфоузлахИзолированные раковые клеткиЭти клетки рассматриваются как N0
Узловые микрометастазыРассматриваются как N1MMx наличие метастаз не может быть оценено
M1a наличие одной метастаз в органе
M1b больше одной метастазы в органе или брюшинеСтадииСтадия I T1 N0M0, T2N0M0 Стадия II IIA - T3 N0M0, IIB - T4a N0M0, IIC - T4b N0M0
Стадия III IIIA - T1, T2, N1, N2a, M0
IIIB - любая Т кроме T4b; N2b, M0
IIIC - T4b, N1, N2, M0
Стадия IV
IVA - любая Т, любая N, M1a
IVB - любая Т, любая N, M1b 1.1.11 Ключевые пути развития рака толстой кишки
РТК не моногенное заболевание и больные с одинаковой стадией заболевания имеют разный прогнозы течения болезни и разный ответ на лечение, потому что у каждого больного свой набор мутаций в разных генах и очень трудно определить основной путь развития этого заболевания. Хотя считается, что есть набор генов, который в большинстве случаев мутирован при определенном онкологическом заболевании. Вогелстеин с соавторами предполагают, что развитие рака всех локализаций ассоциировано со своим набором ключевых генов [3, 86]. Для РТК это члены Wnt/β-катенин и фосфотидилинозитол-3-киназных путей, онкоген KRAS, ген-онкосупрессор ТР53 и др. (рисунок 1). Ключевые гены нарушены в 50-60% случаев и обнаруживаются у больных с прогрессирующей болезнью на поздних стадиях. RAS-RAF-MEK-ERK-MAP киназный путь - важный сигнальный путь трансдукции, который обеспечивает клеточный ответ на ростовой сигнал,. Поэтому он участвует в регуляции таких процессов как пролиферация, клеточное выживание, арест клеточного цикла, дифференциация, апоптоз [87]. RAS белок, который находится на внутренней стороне мембраны. RAF, MEK, ERK цитоплазматические протеин-киназы, которые последовательно активируют друг-друга [88]. KRAS активируется посредством протеин-киназы BRAF. Мутации в 12 кодоне гена KRAS были найдены у 8,6% всех пациентов [89] и в среднем у 40% пациентов обнаружены мутации в этом гене [4]. При мутационной активации продукта гена KRAS происходит аберрантная активация EGFR пути. Исследование мутаций в этом гене являются важным прогностическим маркером для лечения с помощью агентов против EGFR (цетуксимаб и панитумумаб). Потому что при наличии мутаций в гене KRAS такое лечение неэффективно. Также мутации в генах этого сигнального пути ассоциированы с раком с микросателлитными нестабильностями [90]. Мутации в гене PIK3CA и делеция гена PTEN также как KRAS являются маркерами для предсказывания устойчивости против EGFR моноклональной терапии. Фосфотидилинозитол 3-киназный путь - сигнальный путь активированный стимуляцией EGFR. В 70% случаях мутации в гене PIK3CA и делеция гена PTEN, которые сопровождаются мутациями в генах KRAS и BRAF, не чувствительны к лечению цетуксимабом и панитумумабом [91, 92]. Wnt/ β-катенин сигнальный путь играет ключевую роль в гомеостазе и поддержании стволовых клеток желудочно-кишечного тракта [93]. Существует градиент Wnt сигнала от основания крипт до ворсинок кишечника [94]. Если у эпителиальных клеток основания крипты нет источника Wnt, то клетки теряют пролиферативную активность и дифференцируются [95, 96]. Ген Adenomatous polyposis coli (APC) играет центральную роль в Wnt сигнальном пути, который действует на деградацию β-катенина [97]. Wnt сигнал ингибирует деградацию β-катенина за счет ингибирования GSK3 [98], параллельно PI3K-зависимый путь стимулирует проникновение β-катенина в ядро [99], где β-катенин взаимодействует с белками семейства LEF/TCF [100]. Этот комплекс активирует транскрипция целого ряда белков: p300, CBP, Hrpt2, Foxo, Bcl9-2, reptin, pontin, Grouchos, Prmt2, CtBP [101]. По одним данным, в 85% случаях спорадического рака толстой кишки есть мутации в гена APC, и в 50% случаях есть активирующая мутация в гене β-катенина [5]. Также за счет ингибирования GSK3 Wnt сигнальный путь активирует mTOR путь, который отвечает за рост и пролиферацию клетки [102]. Один из маркеров раковых стволовых клеток толстой кишки CD44 является мишенью Wnt сигнального пути [103]. Многие исследования показали, что ингибирования Wnt сигнала в РСК может аннулировать их канцерогенные свойства. При блокировании взаимодействия β-катенина с транскрипционным фактором TCF приводит к аресту клеточного цикла на G1 фазе [104, 105]. Для терапии рака разработано множество потенциальных антагонистов Wnt сигнального пути на основе антител, которые могут действовать на разной стадии передачи сигнала. Антагонисты Wnt сигнального пути являются будущим для терапии рака. Основной целью является создание безопасных препаратов, которые целенаправленно будут действовать на раковые клетки или РСК. Еще одна проблема в том, что существует тканеспецифичный и клеткоспецифичный пути, так как есть 19 Wnt лиганд и множество участников этого пути [106].
Термины протоонкоген, онкоген и ген-онкосупрессор часто используются в онкогенетике. Протоонкогены встречаются во всех нормальных клетках, они являются генами белков, многие из которых передают сигнал от мембраны в ядро в процессах клеточной дифференцировки, деления, апоптоза. После мутаций вызывающих онкогенез их называют онкогенами. К онкогенам относятся и гены вирусов, которые встраиваются в геном хозяина. Первый онкоген был обнаружен в опухоли курицы, который являлся встроенным вирусным геном. Гомологи таких генов были найдены у человека, которые тоже относят к онкогенам. К онкогенам человека относятся гены RAS, SRC, BRAF, MYC. v-myc - онкоген вируса миелоцитомы курицы, v-src - онкоген вируса саркомы Рауса. Рисунок 1 - Сигнальные пути, наиболее часто измененные при раке толстой кишки [110]
Многие гены-онкосупрессоры осуществляют контроль процессов клеточного деления и повреждения ДНК. Гены-онкосупрессоры в норме экспрессируются на определенном уровне, снижение их экспрессии может привести к неопластическим превращениям. К генам-онкосупрессорам относятся MSH2, MLH1 PMS1, PMS2, MSH6, APC, TP53, DCC, PDGFRL [107].
Все гены, участвующие в развитии наследственных синдромов, являются одним из ключевых участников онкогенеза рака толстой кишки и при спорадическом течении заболевания (таблица 1). Кроме генов представленных в таблице 1 на поздних прогрессирующих стадиях рака толстой кишки участвуют такие ключевые гены, как TP53. Ген TP53 кодирует транскрипционный фактор, который является хранителем генома, потому что участвует в таких процессах как ответ на оксидативный стресс, ДНК репарация, регуляция клеточного цикла, апоптоз и многих других метаболических путях. Потеря функции TP53 найдена при многих опухолях, в основном происходят мутации в центральном домене, который отвечает за связывания с ДНК. Инактивирующие мутации в этом гене обнаружены в 29% случаях РТК [108, 109]. 1.1.12 Методы диагностики рака толстой кишки
В последние годы множество исследований посвящено секвенированию полных геномов, транскриптомов всех видов рака [111]. В 2006 году была опубликована работа, в которой провели секвенирование 13023 генов в 11 опухолевых линиях РТК. Выявлено 519 генов с мутациями, которые в разных комбинациях присутствуют в этих линиях, так что в среднем в каждой линии опухоли найдено около 90 генов с мутациями. Из 519 генов только 69 генов были ассоциированы с развитием рака толстой кишки [112]. Кроме этих генов по данным литературы и другие гены участвуют в онкогенезе РТК. Следовательно, можно предположить, что количество ключевых генов ассоциированных с раком толстой кишки гораздо больше. Например, в базе HuGE Navigator (www.hugenavigator.org) 491 ген ассоциирован с развитием рака толстой кишки. Поэтому разработать селективные молекулярные маркеры для диагностики очень сложно. В диагностике РТК на практике используются следующие инструментальные методы обследования: рентгенологический (ирригоскопия, обзорная рентгенография брюшной полости, компьютерная томография), эндоскопический (колоноскопия) и ультразвуковой. Компьютерная томография является основным современным методом первичного обследования больных с РТК. Метод позволяет оценить местное распространение опухоли, наличие отдаленных метастазов. Для повышения чувствительности метода используется дополнительное контрастирование, которое особенно эффективно для паренхиматозных органов [85]. Исследование кала на скрытую кровь один из неинвазивных методов диагностики, основанный на определении крови в стуле. Метод имеет низкую чувствительность (30-50%) [113, 114]. Пациентов с положительным результатом направляют на колоноскопию. Было выявлено, что этот метод на 16% позволяет уменьшать инциденты рака и ликвидировать заболевание на стадии аденомы [115, 116].
Существуют ряд коммерчески доступных тест систем, которые определяют маркеры РТК. В США для ранней диагностики РТК используется ColoSureTM тест, который проверяет метилирование гена Vimentin в кале [117]. В нормальном эпителии толстой кишки этот ген выключен. Тест показывает 77% чувствительность и 83% специфичность по сравнению с тестом на скрытую кровь [118, 119]. Метилирование гена Septin9 коррелирует с наличием РТК. Изучение метилирование Septin9 в плазме коммерциализировано как тест ColoVantage(r) [120]. Существуют прогностические маркеры, которые помогают прогнозировать ответ на лечение. Очень трудно определить вторую и третью стадию. На второй стадии нет метастаз в регионарных лимфоузлах. На практике трудно определить наличие или отсутствие метастаз в регионарных лимфоузлах. Экспрессия гена GCC (тест PrevistageTM) в лимфоузлах коррелирует со стадией заболевания [121]. Также есть коммерческий тест (ColoPrint(r)) на основе экспрессии 18 генов, который также используется для точного определения группы с повышенным риском больных со стадией II и III РТК [122]. Другой коммерческий тест (OncoType DX(r)) предназначен для прогнозирования рецидивов у пациентов со второй стадией заболевания на основе экспрессии 12 генов [123]. В таблице 5 представлено описание всех упомянутых тест систем. Универсальных молекулярных маркеров для ранней диагностики РТК на данный момент нет [124]. Талица 5 - Коммерческие доступные тест системы
Название тестаБиологический материалБиомаркерColoSureTMМетилирование ДНК в калеVimentinColoVantage(r)Метилирование ДНК в плазмеSEPT9ColoPrint(r)Экспрессия мРНК в опухолиMCTP1, LAMA3, CTSC, PYROX D1, EDEM1, IL2RB, ZNF697, SLC6A11, IL2RA, CYFIP2, PIM3, LIF, PLIN3, HSD3B1, ZBED4, PPARA, THNSL2, CA4388O2OncoType DX(r)Экспрессия мРНК в опухолиKi-67, C-MYC, MYBL2, FAP, BGN, INHBA, GADD45B, ATP5E, PGK1, GPX1, UBB, VDAC2PrevistageTMЭкспрессия мРНК в лимфоузлахGCC (GUCY2C) Надежды в этой области связаны с изучением микроРНК. Обнаружение микроРНК - одно из самых крупных открытий конца XX века. На настоящее время в геноме человека предсказано более 3000 микроРНК, из которых аннотировано более 1000 микроРНК [125]. На микроРНК сфокусировано большое внимание, потому что изменения в их функционировании непосредственно связаны с возникновением, прогрессией и метастазированием злокачественных опухолей. Предполагается, что нарушение синтеза микроРНК является одной из первопричин изменений во многих патологиях, в том числе при раке.
1.2 МикроРНК и их роль при РТК
1.2.1 Обнаружение микроРНК
Впервые микроРНК была обнаружена в 1993 году Викором Амбросам и его коллегами Розалинд Ли и Ронда Феинбаум. Генетический скрининг кольчатого червя Caenorhabditis elegans выявил гены lin-4, который контролирует личиночную стадию развития нематоды и не кодирует белок, а кодирует две РНК молекулы разной длины (22 н. и 61 н.) [10]. Длинная РНК является предшественником короткой РНК и имеет шпилечную вторичную структуру. Lin-4 имеет антисмысловую комплементарность к множеству сайтам в 3'UTR гена lin-14. В 1993 году было найдено, что при уменьшении количества белка LIN-14 не происходит существенного изменения уровня мРНК lin-14. Это наблюдение привело к созданию модели действия РНК lin-4 на 3'UTR lin-14, которое приводило к подавлению трансляции гена lin-14 [10]. Эта негативная регуляция приводила к переходу из первой личиночной стадии ко второй личиночной стадии. У нематоды клетки на всех четырех личиночных стадиях (L1-L4) имеют разные характеристики и мутации в lin-4 нарушают временную регуляцию развития, что приводит к L1 специфичному делению на более поздних стадиях развития. А в нематодах дефектных по lin-14 проявляются противоположный эффект (L1стадия опускается и происходит ранний переход в L2 стадию) [10, 126]. Спустя семь лет Реинхарт с соавторами открыли вторую микроРНК let-7, которая тоже участвует в регуляции личиночного развития нематоды. Let-7 стимулиреут переход с поздней личиночной стадии на стадии взрослого организма [127]. Далее гомологи let-7 были найдены в геноме человека, Drosophila и 11 других билатеральных животных [128]. Обнаружение механизма действия коротких РНК исторически связано с другими исследованиями. Впервые механизм РНК интерференции наблюдали две группы ученых, которые хотели с помощью сверх синтеза халкон-синтазы придать петунии фиолетовый цвет. При введении гена экспрессия эндогенной и трангенной халкон-синтазы понизилась. Феномен назвали ко-супрессия генов [129]. Пародоксальные результаты начали получать на нематоде. В 1998 году Андрю Файер и Крейг Меллоу с соавторами обнаружили экзогенные двухцепочечные РНК, которые у C. elegans специфически выключали гены по механизму, названному РНК интерференция [130]. За это открытие в 2006 году им была вручена Нобелевская премия в области физиологии и медицины. Позже были обнаружены многие новые микроРНК, их регуляторные мишени и функции. Было показано на дрозофиле, что в функции микроРНК входит регуляция клеточной пролиферации, клеточной смерти, метаболизма жиров [131, 132], на млекопитающих модуляция развития гемопоэтических предшественников [13], на растениях участие в регуляции развития листьев и цветов [12, 133].
1.2.2 Общая информация о микроРНК
МикроРНК - это малые не белок-кодирующие РНК, которые регулируют экспрессию генов на уровне трансляции мРНК [134]. МикроРНК, обычно состоящие из 16-27 нуклеотидов, входят в семейство малых РНК, которое включает малые ядерные РНК, участвующие в сплайсинге пре-мРНК (snRNA) [135], малые ядерные РНК, модифицирующие рибосомную РНК (snoRNA) [136], и короткие интерферирующие РНК (siRNA) [137], Piwi-взаимодействующие РНК (piRNA) [138].
Больше половины известных микроРНК расположены в межгенных участках или в участках с антисмысловой ориентацией к аннотированным генам [139]. Эти микроРНК локализованы на расстоянии от известных белок-кодирующих генов и у них есть свой независимый транскрипт [140] (рисунок 2). Остальные микроРНК у животных расположены в интронах [141] . То есть они кодируются на той же стороне ДНК цепи, что и мРНК транскрибирующая белок. Большинство интронных микроРНК не имеют своего промотора и вырезаются из интронов, также как многие snoRNA [142]. Существует небольшая группа микроРНК, которая расположена в экзонах [143].
Такое расположение микроРНК в геноме обеспечивает удобный механизм координации экспрессии микроРНК и белков. Между интронной микроРНК и хозяйской мРНК может сохраняться взаимосвязь при наличии сайтов связывания микроРНК. Было подтверждено сохранение такой связи между miR-7 и мРНК hnRNP K гена, в интроне которого кодируется микроРНК [144].
Другие микроРНК класстеризованы в геноме и транскрибируются как мульти-цистронные первичные транскрипты [140]. МикроРНК из одного кластера могут образовать общий первичный транскрипт и ко-экспрессироваться. 1.2.3 Биогенез микроРНК
Биогенез микроРНК начинается с синтеза первичного транскрипта (при-микроРНК), который содержит шпильку длиной 60-70 н [145]. МикроРНК могут быть транскрибированы РНК полимеразой II и III (RNA pol-II, pol-III). Обычно РНК полимераза II продуцирует мРНК и некоторые некодирующие РНК, такие как маленькая ядерная РНК (snoRNA), четыре малые ядерные РНК сплайсеосом (snRNA). РНК полимеразой III синтезируются некоторые короткие некодирующие РНК: тРНК, 5S рибосомальные РНК, U6 snRNA. Интронные и экзонные микроРНК транскрибируются вместе с хозяйской мРНК и большинство межгенных микроРНК с РНК-полимеразой II [146, 147]. а) Экзонная микроРНК, которая кодируется в белок некодирующем транскрипте, б) Интронная микроРНК, которая кодируется в белок некодирующем транскрипте, c) Интронная микроРНК, которая кодируется в белок кодирующем транскрипте. Рисунок 2 - Расположение микроРНК в геноме [140]
МикроРНК, ассоциированные с Alu повторами, синтезируются полимеразой III [147]. Первичный транскрипт имеет длину в несколько тысяч нуклеотид.
При-микроРНК процессинг - один из важных этапов биогенеза микроРНК. После транскрипции следует процессинг при-микроРНК, который происходит в ядре. Процессинг при-микроРНК осуществляется у растений и животных за счет РНазы III типа [148, 149]. У животных фермент называется Drosha, у растений DLC1. По организации доменов РНазы III разделяются на 3 класса: А) РНазы III первого класса есть в геномах бактерий и дрожжей. Каждый белок состоит из одного домена РНазы III (RIIID) и домена связывающего двухцепочечную РНК (dsRBD).
Б) Ферменты второго класса, такие как Drosha состоят из двух RIIID доменов и одного dsRBD домена. Гомологи гена Drosha присутствуют только в геноме животных. Этот большой белок (130-160 kDa) имеет длинный N-конец, функция которого не известна. N-конец содержит пролин и серин/аргинин богатые районы [149].
В) Третий класс РНазы III включает гомологи гена Dicer, который консервативный у Schizosaccharomyces pombe, растений и животных. DICER является белком с массой около 200 kDa и состоит из множества доменов. Кроме двух доменов RIIID и домена dsRBD белок на N-конце имеет DExH РНКгеликаза/АТФазный, DUF283 и PAZ домены. PAZ домен был найден у группы высоко консервативных белков, которые относятся к семейству AGO. Структура и биохимический анализ PAZ домена ago1 и ago2 дрозофилы предполагает, что PAZ домен связывается с 3'выступающим концом коротких РНК [150]. Функции остальных доменов белка DICER пока не известны. Белок DICER может связываться с некоторыми другими белками, но это взаимосвязь не требуется для реакции расщепления, потому что было показано, что очищенный белок DICER обладает ферментативной активностью [151, 152]. Drosha и Dicer относятся к РНазы III и характеризуются наличием двух тандемных доменов RNase III (RIIIDs) и одного домена связывающего с двухцепочечной РНК (dsRBD). Адаптировано с работы [153].
Рисунок 3 - Доменные структуры важных РНазы III
Доменный состав всех важных РНазы III представлен на рисунке 3. Человеческий белок Drosha выделяют во фракцию около 650 kDa, который является частью большого комплекса, называемого микропроцессор. Комплекс вырезает шпилечную структуру, называемую пре-микроРНК, которая имеет длину около 70 нуклеотид. Комплекс состоит из Drosha и DGCR8. В белке DGCR8 есть два dsRBD и один WW домены. Белок Drosha образует внутримолекулярный димер, оба домена обладают уникальной функцией. RIIIDa разрезает 3'цепь, а RIIIDb разрезает 5'цепь при-микроРНК, каждая независимо друг от друга. То есть белок Drosha должен быть правильно сориентирован по отношению к при-микроРНК. Предполагается, что DGCR8 участвует в правильной ориентировки при-микроРНК. По данным экспериментов, Drosha и DGCR8 являются ключевыми компонентами комплекса, но в состав должны входить еще другие неопределенные субъединицы. DGCR8 является типичным компонентам комплекса для млекопитающих, а Pasha для D. melanogaster и C. elegans [154, 155]
Мышиные стволовые клетки с мутацией по DGCR8 гену не продуцируют микроРНК и имеют дефекты в клеточном делении и дифференциации [156]. У простейших (metazoan) шпилька состоит из 33 нуклеотидов: терминальная петля и две фланкирующие одноцепочечные цепи (ssRNA). DGCR8 помогает ферменту Drosha от точки перехода одноцепочечной РНК в двуцепочечную шпильку разрезать на 11 нуклеотиде [157].
Drosha является ингибитором своего же кофактора, он может вырезать шпильку, которая образуется во втором экзоне мРНК гена DGCR8 [157].
После синтеза в ядре пре-микроРНК переносится в цитоплазму. Этот процесс осуществляется экспортином 5, который относится к семейству ядерных рецепторных транспортеров. Экспортин 5 узнает двухцепочечную РНК шпильку длиной 14 нуклеотид с коротким выступом на 3'конце. В начале этот белок был известен как переносчик тРНК, позже было найдено, что главная его функция перенос микроРНК [158]. Пре-микроРНК процессируется в зрелую микроРНК с помощью эндонуклеазы Dicer (рисунок 4) [159]. Некоторые организмы, такие как млекопитающие и нематоды имеют только один фермент, который контролирует биогенез микроРНК и siRNA, тогда как другие организмы имеет несколько ферментов. Например, у дрозофилы экспрессируются два разных фермента, а в геноме арабидопсиса их четыре. Организмы с множеством ферментов имеют строгую специализацию ферментов. Например, у дрозофилы Dicer-1 участвует в биогенезе микроРНК, а Dicer-2 в биогенезе siRNA [160, 161]. Биохимический, генетический и структурный анализ показали, что PAZ и RNase III домены играют ключевую роль в вырезании siRNA с конца двухцепочечной цепи. PAZ домен специфически связывается с концом РНК, у которого на 3'конце есть пара (2 нт) свободных нуклеотидов. После связывания с концом двухцепочечной РНК после двух спиралей субстрата Dicer находит свой центр разрезания. Этот центр находится между двумя димерами RNase III. Каждый домен разрезает одну цепь двухцепочечной шпильки. Процесс вырезания зрелой микроРНК аналогичен процессу вырезания пре-микроРНК из первичной последовательности [161, 162].
У человека были найдены два белка, которые связываются с белком Dicer: белок TRBP (TAR RNA-binding protein, также известный как TARBP2) и белок PACT. Функции этих белков на данный момент неизвестны [161].
На верхней части рисунка представлена доменная организация белка. Фермент Dicer разрезает двухцепочечную РНК (dsRNA) с помощью RNase III домена. Концы dsRNA ассоциированны с PAZ доменом. RNase III домен вырезает 20-30 нуклеотидный дуплекс из прекурсора. Адоптировано от [163]. Рисунок 4 - Композиция доменов и структура протеина Dicer 1.2.4 Регуляция экспрессии с помощью микроРНК
После вырезания дуплекса зрелых микроРНК из пре-микроРНК, одна из цепей соединяется с белком из семейства аргонавт и образует RISC (RNA induced silencing complex) комплекс. Семейство белков аргонавт может быть разделено на три типа: Piwi белки связываются с piRNA, Ago белки могут быть ассоциированы с микроРНК и siRNA, третья группа белков была описана только у нематоды [164]. Во всех регуляторных процессах с участием РНК длиной 20-30 нуклеотидов принимают участие белки семейства аргонавт, которые имеют вес около 100 kDa. Зрелый дуплекс микроРНК связывается с компонентами RISC комплекса, после чего происходит раскручивание дуплекса и образование стабильной связи между одной цепью микроРНК и Ago белком. МикроРНК в RISC комплексе находит ген-мишень по принципу комплементарности пар Уотсон-Крика, тогда как вторая микроРНК из первичного дуплекса будет сброшена. Аргонавт белки имеют четыре домена: PAZ домен, PIWI домен уникальный для этих белков, N и Mid домены [165, 166]. На рисунке 5 представлено расположение доменов и структура типичного аргонавт белка.
На верхней части рисунка представлено каноническое расположение доменов, ниже представлена структура Ago белка Thermus thermophilus.
Рисунок 5 - Белок Ago PAZ домен первым распознает и связывает 3'конец микроРНК, другой конец микроРНК связывается с Mid доменом. PAZ домен слабо связывает около 5 нуклеотидов одноцепочечной или двухчепочечной РНК, то есть комплекс сохраняется после присоединения с мРНК мишенью. У животных во время образования первичного комплекса белка с микроРНК/микроРНК* дуплексом было показано сохранения связи белка с микроРНК цепью, которая имеет более стабильный 5' конец [167]. 1.2.5 Предсказывание генов мишеней микроРНК
На данный момент существует ряд программ, которые предсказывают гены мишени микроРНК. Для животных предсказывать сайты микроРНК сложнее, чем для растений, потому что у большинства сайтов нет высокой комплементарности. У растений большинство сайтов микроРНК имеют почти полную комплементарность [168]. Сайты связывания микроРНК должны быть экспериментально подтверждены и должны иметь следующие критерии: 1. должна быть полная комплементарность между 3'-концом мРНК и восьмью нуклеотидами 5'конца микроРНК; 2. взаимодействие должно быть структурно и термодинамически стабильное; 3. сайт должен быть эволюционно консервативным среди позвоночных [169]. Несколько независимых групп ученых создали алгоритмы предсказывания сайтов микроРНК. Центр Sanger miRBase (http: // www.mirbase.org/) - основная организация создавшая базу, которая имеет нуклеотидные последовательности микроРНК. Этот центр определяет номенклатуру для генов микроРНК и присваивает имена новым микроРНК для публикации в рецензируемых журналах. Онлайн база данных miRBase содержит все опубликованные последовательности микроРНК вместе с текстовой аннотацией и ссылками на первичный источник и другие базы данных [17].
Гены мишени для всех микроРНК из базы данных miRBase представлены в базе данных MicroCosm (http: // www.ebi.ac.uk/enright-srv/microcosm/htdocs/targets/v5/), в которой представлены предсказанные гены мишени для микроРНК нескольких видов организмов. Впервые сайт микроРНК был предсказан в 2003 году для дрозофилы, когда было обнаружено, что в гене Bantam кодируется микроРНК, которая негативно регулирует экспрессию гена Hid [14]. Hid был первым геном мишенью, который определили с помощью полно-геномного нуклеотид основанного биоинформатического анализа последовательности. Большое количество при-микроРНК были предсказаны компьютерными методами, то есть был проведен поиск последовательностей имеющих шпилечные структуры во вторичной структуре мРНК. Другие компьютерные алгоритмы были созданы для предсказания пре-микроРНК [170]. Но самое большое внимание ученых уделяется определению генов мишеней. Для предсказывания генов мишеней микроРНК разработано множество алгоритмов, наиболее популярные из них мы рассмотрим далее. Алгоритмы предсказывания могут быть разделены на три группы: основанные на комплементарности последовательностей, основанные на энергии взаимодействия, основанные на компьютерном изучении (machine learning-based) [171]. К первой группе алгоритмов можно отнести такие программы как: TargetScan, Pic Tar, miRanda. К программам, основанным на энергии гибридизации, относятся Diana-microT, RNAhybrid. К третьей группе - такие алгоритмы, как: NBmiRTar, miTarget и программа Zhang с соавторами [172]. Программа TargetScan (http: // www.TargetScan.org/) основана на термодинамическом взаимодействии микроРНК с мРНК мишенью. Программа находит сайты микроРНК в 3'UTR гена мишени, которые имеют полную комплементарность со 2 по 8 нуклеотид к 5'концу микроРНК. Сайт должен быть консервативным в нескольких геномах. Область микроРНК с 2 по 8 нуклеотид называется "seed" областью. По консервативности сайтов микроРНК в генах мишеней весь перечень микроРНК поделен на три группы: высоко консервативные, консервативные и низко консервативные. Высоко консервативные сайты должны сохраняться в геномах пяти организмов (человек, мышь, крыса, собака, курица). Поиск сайтов осуществляется по комплементарности в "seed" области. Сайты с мисматчами и Г-У парами в "seed" области отбрасываются. Алгоритм присваивает каждому сайту свой "score", который вычисляется на основе энергии гибридизации и консервативности сайта среди видов [15, 16]. Недостаток программы заключается в поиске сайтов комплементарных только в "seed" области и изучении консервативности сайтов в разных геномах тоже только в этой области.
Pic Tar (http: // pictar.mdc-berlin.de/) - одна из программ, которая широко используется для предсказывания сайтов микроРНК [173]. Это программа обеспечивает сравнение между различным видами, используя многократное выравнивание последовательности ортологичных 3'UTR последовательностей. Расчет параметров проводится для каждой последовательности разных видов отдельно. Программа ищет сохраненные сегменты 3'UTR содержащий комплементарный участок к первым 7-8 нуклеотидам 5'конца микроРНК. "score" рассчитывается по Hidden Markov Model (HMM) для каждого 3'UTR последовательности [174]. Используя вышеперечисленные две программы, которые ведут поиск сайтов в 3'UTR, было предсказано, что 60% всех 3'UTR генов человека регулируются по средствам консервативных у позвоночных микроРНК за счет семи комплементарных нуклеотидов между сайтами мишенями и 5'концами микроРНК [175]. Diana-microT (http://diana.pcbi.upenn.edu/cgi-bin/micro_t.cgi) позволяет вычислять сайты, имеющие полную комплементарность в "seed" области, но и сайты с высокой комплементарностью к 3'концу микроРНК и с мисматчами к 5'концу микроРНК [176, 177]. Используя динамическое программирование, вычисляется минимальная энергия связывания микроРНК с определенным 3'UTR мРНК и случайной последовательности, которая состоит из тех же нуклеотидов, что исследуемый 3'UTR. Г-У пара учитывается, как и уотсон-криковские комплементарные пары. Этот метод выдает 66 % достоверных сайтов, что гораздо выше, чем у большинства программ [178].
miRanda (http://www.micro-RNA.org/) - это программа, которая была создана для предсказания генов мишеней у D. melanogaster, но может использоваться для предсказывания микроРНК мишеней любых организмов [179]. Для каждой микроРНК программа подбирает гены мишени на основе трех свойств: комплементарность последовательности, используя локальный алгоритм выравнивания, свободную энергию гибридизации РНК-РНК дуплекса по программе Vienna RNA fold [180] и консервативность сайтов связывания в близкородственных геномах. miRanda может корректно определить девять из десяти сайтов микроРНК, программа выдает около 24% ложно-положительных сайтов. John с соавторами улучшили программу с помощью введения жесткого критерия для отбора сайтов микроРНК, который требовал полную комплементарность в "seed" области с допущением одного колебания [181].
RNAHybrid - это программа, в которой термодинамика является основой поиска сайтов связывания микроРНК [182]. Программа является классическим усовершенствованным алгоритмом предсказывания вторичной структуры РНК, например, таких как RNAfold [183] и Mfold [184]. RNAHybrid находит наиболее энергетически выгодные сайты для микроРНК, сканируя длинную последовательность РНК мишени. Метод был успешно протестирован на дрозофиле (D. melanogaster). Программа имеет низкий уровень предсказывания ложно-позитивных сайтов. Можно использовать он-лайн версию программы для поиска сайтов микроРНК, также доступна локальная версия программы, в которой можно задавать свои критерии отбора [185]. Как известно большинство программ предсказывают сайты только в 3'нетранслирующей области [186], а RNAHybrid предсказывает сайты локализованные во всех участках мРНК (5'UTR, CDS, 3'UTR) [185]. На данный момент в нескольких работах показано наличие сайтов микроРНК, которые располагаются в 5'UTR and CDS. В программе можно ограничить наличия Г:У пар в seed области. Также можно регулировать количество неспаренных нуклеотидов в сайте взаимодействия. RNAHybrid позволяет определить количество сайтов мишеней предсказанных для одной микроРНК и одного гена. Рисунок 6 - Приблизительная вторичная структура трех основных видов сайтов мишеней [188]
Программа позволяет задать минимальную энергию взаимодействия для сайта взаимодействия [185]. Большинство программ предсказывают только два вида сайта, то есть 5'доминантный канонический и 5'-seed доминантный сайты [187]. Программа RNAHybrid позволяет найти все виды сайтов. Существуют три вида подтвержденных сайта взаимодействия: 5'доминантный канонический, 5'-seed доминантный, 3'-компенсаторный сайт (рисунок 6) [188]. Большинство известных программ лимитируют поиск сайтов, ограничиваясь этими критериями. Тогда как RNAHybrid позволяет варьировать параметры поиска сайтов. 1.2.6 Г:У пары и неспаренные нуклеотиды в сайтах взаимодействия микроРНК
Были экспериментально доказаны некоторые предсказанные сайты, в которых есть Г:У пары или неспаренные одиночные нуклеотиды [14, 169, 189 - 193]. В большинстве случаев эти мРНК-мишени имеют множество предсказанных сайтов, вклад в регуляцию каждого из этих сайтов не были изучены. In vitro экспериментах было показано функциональность сайтов с Г:У парами [194, 195].
Таблица 6 - Дополнить из статьи случаи с разной локализацией Г:У пар [196]
Сайты взаимодействия Характеристика seed мРНК 5' A 3'
ACAGCAGAAUCA UAGUCUUCCG
UGUUGUUUUAGU AUCAGAAGGU miR-7 3' G 5' 10mer мРНК 5' GAA U 3'
ACAACAAAAUCACUAG UUCC
UGUUGUUUUAGUGAUC AAGG
микроРНК 3' AG U 5' 4mer (2-5 нуклеотиды) мРНК 5' CAA GU 3'
ACAACAAAAUCACUA CUUC
UGUUGUUUUAGUGAU GAAG
микроРНК 3' CA GU 5' 4mer (3-6 нуклеотиды ) мРНК 5' GAA 3'
ACAACAAAAUCACUAG UUCCA UGUUGUUUUAGUGAUC AAGGU
микроРНК 3' AG 5' 5mer (1-5 нуклеотиды) мРНК 5' UUA GU 3' ACAACAAAAUCACU UCUUC
UGUUGUUUUAGUGA ACAAG
микроРНК 3' UC GU 5' 5mer (3-7 нуклеотиды) мРНК 5' AAA U 3'
AAACGGACGAAA CCCAUCG UUUGCCUGCUUU GGGUGGC
микроРНК 3' CA U 5' 7mer (2-8 нуклеотиды) Brennecke с соавторами экспериментально протестировали функциональность сайтов с Г:У парами и неспаренными нуклеотидами [196]. В таблице 6 представлены разные варианты сайтов, эффективность которых была подтверждена в этой работе. Также они проверили эффективность сайтов с Г:У парами в "seed" области, но с наличием неспаренных нуклеотидов после "seed"области. Вероятно, поэтому структура была нестабильна и такие сайты не имеют эффективности. Также была показана эффективность сайтов с парными и одиночными неспаренными нуклеотидами в "seed" области при наличии комплементарного 3'конца микроРНК [196]. В большинстве программ сайты с Г:У парами в сайте взаимодействия и не спаренными нуклеотидами в "seed" области отбрасываются. 1.2.7 Методы верификации сайтов связывания микроРНК
Для экспериментального подтверждения взаимодействия микроРНК с мРНК используются такие методы как qRT-PCR, люцеферазный репортерный анализ, вестерн блот анализ [197]. Для оценки действия определенной микроРНК на генные сети проводят изменение экспрессии определенной микроРНК и затем проверяют экспрессию генов на уровне мРНК с помощью microarray анализа и изменения на уровне белка с помощью протеомного анализа. Для изменения экспрессии микроРНК обычно проводится увеличение или ингибирование экспрессии. Чтобы увеличить экспрессию микроРНК проводится трансфекция синтетических микроРНК прекурсоров или в клетки вводятся лентивирусные конструкции, которые стабильно экспрессируют определенную микроРНК [198]. Для ингибирования микроРНК налаживают экспрессию антисмысловых олигонуклеотидов, которые связываются со зрелой микроРНК мишенью [199]. Влияние эктопической экспрессии микроРНК на глобальную экспрессию генов изучается с помощью microarray анализа. Первое исследование с такой стратегией показало, что после трансфекции HeLa клеткам miR-1 и mir-124 были проингибированы более 100 генов в каждом случае [200]. Позднее такие же результаты были получены другими исследователями для других микроРНК [201]. В таких исследованиях методика секвенирования следующего поколения RNA-seq на данный момент не может заменить microarray анализ, хотя этот метод дает более точные результаты. Для определения прямого связывания микроРНК с мРНК было создано несколько биохимических методов. Для этого можно провести выделение комплекса микроРНК с мРНК с помощью иммунопресипитации за счет компонентов комплекса RISC, аргонавт (AGO), TNRC6 белков [202, 203]. мРНК мишень осаждается вместе с комплексом RISC и затем проводится или microarray анализ, или секвенирование. Иммунопресипитация за счет белков AGO была проведена для определения генов мишеней для известных микроРНК miR-1 и mir-124. После выделения мРНК мишени был проведен microarray анализ [204]. Метод исследования мРНК мишеней при помощи высоко точного секвенирования называется HITS-CLIP (high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation). Для увеличения устойчивости связи между микроРНК и мРНК в этой методике используется предварительная обработка ультрафиолетом 254 нм. Впервые это методика была использована для определения мРНК мишеней в мозгу мыши, а затем для нематоды за счет AGO-связывающих мРНК [205, 206]. Недостатком метода является низкая эффективность ультрафиолетового облучения. Альтернативным методам (photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation - PAR-CLIP) является применение фотоактивируемых рибонуклеозидов для увеличения связи между микроРНК и мРНК мишени [207]. Для этого используются такие нуклеозиды, как 4-тиоуридин, которые усиливают связь для Т и Ц нуклеотидов. Другим биохимическим методам выделения мРНК мишени является использование биотинилированных микроРНК для выделения микроРНК-мРНК комплексов из клеточных лизатов с помощью стрептавидиновых антител. Этот метод был использован для определения сайтов связывания для микроРНК bantam и miR-124a на клеточных линиях дрозофилы и млекопитающих [208]. Vatolin с соавторами разработали методику определения мРНК мишеней на основе обратной транскрипции мРНК. То есть микроРНК использовали как праймеры для синтеза кДНК мРНК мишени. С помощью метода был подтвержден сайт связывания между lin-4 и lin-14 C. Elegans [209].
pSILAC (Stable isotope labelling with amino acids in cell culture) - метод количественной протеомики, в котором уровень белка измеряется за счет масс спектрометрии для образцов меченных разными изотопами. Этот протеомный метод позволяет регестрировать действие микроРНК на уровне белка. Yang с соавторами проверили действие miR-143 и выявили 93 белка, у которых наблюдалась понижение экспрессии после введения микроРНК. Люцеферазный репортерный анализ показал, что из 34 проверенных мРНК 10 являются мишенью для miR-143 [210]. Из приведенных данных видно, что на данный момент доступно множество методов подтверждения действия микроРНК. В базе данных TarBase на 2012 год насчитывается 65814 экспериментально проверенных сайтов. Базе данных TarBase 6.0 (http://www.microrna.gr/tarbase) объединяет экспериментальные данные, полученные с помощью всех перечисленных методов (репортерный анализ, qPCR, вестерн блот, Micro Array, протеомные (pSILAC), секвенирование (RNA-Seq, HITS-CLIP, PAR-CLIP), Degradome-Seq и другие (ELISA, RACE, иммуногистохимия)). Хотя основная масса данных основана на таких методах, как репортерный анализ, qPCR, вестерн блот, Micro Array [211].
1.2.8 Роль микроРНК в онкогенезе
Эндогенная микроРНК встречается в геноме у животных [212], растений [213], беспозвоночных [214] и вирусов [215]. Обнаружено, что микроРНК занимают приблизительно около 3% генома человека и регулируют примерно 60% всех генов [212]. Одна микроРНК может контролировать экспрессию более ста различных генов [11]. МикроРНК осуществляют регуляторную функцию в процессах развития, клеточной пролиферации и дифференцировки, апоптозе и т.д. [216]. Нарушение регуляции функционирования микроРНК может повлиять на канцерогенез, если микроРНК действуют на мРНК онкогенов и генов-онкосупрессоров. По профилю экспрессии микроРНК можно классифицировать опухоль. Впервые связь микроРНК с раком выявили Калин с соавторами, когда обнаружили, что гены miR-16 и miR-15, расположенные в ломком сайте на 13 хромосоме, делетированы в 65% случаев хронической лимфоцитарной лейкемии [217]. Гиперэкспрессия, понижение или полное подавление экспрессии специфичных микроРНК влияет на канцерогенез РТК [125]. Для описания проявления функции различных генов микроРНК и соответствующих микроРНК можно использовать термины, принятые в онкологии. Гены микроРНК, проявляющие свое действие как белок-кодирующие онкогены, можно называть тоже онкогенами. МикроРНК, проявляющие себя подобно белок-кодирующим генам-онкосупрессорам, можно называть соответственно генами-онкосупрессорами, то есть у первых экспрессия понижена в норме, а у вторых повышена. Такая терминология позволяет описывать функцию микроРНК независимо от локализации их генов в межгенных участках, в белок-кодирующих генах (в том числе в белок-кодирующих онкогенах и генах-онкосупрессорах), либо в других участках ДНК.
МикроРНК, работающие как онкогены, подавляют экспрессию белок-кодирующих генов-онкосупрессоров. Например, семейства miR17-92, miR-21, miR-155, miR-372, miR-373. В результате повышенной экспрессии гена mir-17-92 соответствующая микроРНК проявляет себя как онкоген. Она подавляет активность гена, белок которого должен обеспечить синтез белка-супрессора опухоли или белка, стимулирующего апоптоз опухолевых клеток [218]. МикроРНК, функционирующие как гены-онкосупрессоры, подавляют экспрессию кодирующих онкогенов. Например, let-7, miR-15a, miR-16-1, miR-143, miR-145 [219]. Из-за множественного действия микроРНК некоторые микроРНК действуют в некоторых случаях как онкогены, в других случаях как онкосупрессоры рака. Например, miR-21 и miR-24. В клеточной линии HeLa ингибирование экспрессии этих микроРНК приводит к усилению пролиферации, а в клеточной линии А549 ингибирование экспрессии miR-24 приводит к угнетению клеточного роста. Супрессия miR-21 в культуре глиобластомы активирует каспазы апоптоза, тогда как в гепатоме miR-21 ингибирует онкосупрессор PTEN [220]. МикроРНК, связанные с онкогенезом называют - oncomirs [221]. Синтез многих белков, участвующих в ключевых сигнальных путях развития РТК, таких как белки Wnt/β-катенин и фосфотидилинозитол-3-киназных путей, KRAS, p53 [222], регулируется посредствам микроРНК. Изучение этих микроРНК важно для лучшего понимания патогенеза РТК, определения маркеров для диагностики и для выявления новых терапевтических мишеней. Wnt/β-катениновый путь играет центральную роль в начальной стадии развития рака толстой кишки. Инактивация гена APC - главное инициирующие событие при РТК в 60% случаях аденомы и карциномы толстой кишки и сопровождается стимуляцией Wnt пути посредством освобождения β-катенина [222]. Считается, что это основное событие в большинстве случаев трансформации нормального эпителия в раннюю аденому. В работе Ногеля с соавторами открыт новый путь регуляции APC при РТК. MiR-135a и miR135-b уменьшают транскрипцию APC in vitro. При аденоме и карциноме толстой кишки увеличивается экспрессия miR-135a и miR135-b in vivo, что коррелирует с уменьшением продукта гена APC [223]. Сигнальный путь рецептора эпидермального фактора роста (EGFR) стимулирует прогрессию широкого спектра солидных форм рака и перспективен в качестве мишени для противораковой терапии. Активация EGFR и KRAS инициирует каскад эффекторов, которые стимулируют рост, выживание, ангиогенез и метастазы опухоли [224]. В 30-60% аденокарцином имеются мутации в гене KRAS [225]. Продукт этого гена - белок (21 kDa), расположенный на внутренней стороне плазматической мембраны, который участвует в передаче митогенных сигналов от рецептора внутрь клетки [226]. Предполагается, что мутации в этом гене способствуют переходу начальной аденомы в позднюю аденому или аденокарциному [227]. Онкоген KRAS является прямой мишенью для микроРНК семейства let-7 [228]. Когда в культуру DLD-1 раковых клеток, которые слабо экспрессируют микроРНК let-7, вводили прекурсор let-7a-1, рост опухоли значительно супрессировался с параллельным уменьшением белка KRAS, в то время как уровень мРНК KRAS оставался неизменным [229]. В регуляции синтеза KRAS при РТК участвует и miR-143. В клинических образцах опухоли уровень белка KRAS коррелирует с miR-143. Экспрессия KRAS in vitro значительно уменьшается во время обработки прекурсорами miR-143 [230]. Было обнаружено, что и miR-18a регулирует синтез KRAS, но не N- и HRAS уровни в клетках HT-29 аденокарциномы [231].
Другой сигнальный путь, связанный с рецептором эпидермального фактора роста и важный в развитии РТК - фосфотидилинозитол-3-киназный (PI-3-K) путь. Исследования, основанные на анализе профиля экспрессии микроРНК, обнаружили потерю экспрессии miR-126 в линиях рака толстой кишки, тогда как восстановление экспрессии miR-126 в эпителии толстой кишки приводит к значительному уменьшению роста опухоли [232]. Было доказано, что P85β регуляторная субъединица самой фосфотидилинозитол-3-киназы участвует в стабилизации и распространении PI-3-K сигнала посредством miR-126. Кроме того уменьшение P85β регулируется miR-126 и сопровождается значительным уменьшением фосфорилированного уровня белка онкогена АКТ в раковых клетках, приводящего к торможению PI-3-K пути. В опухоли отмечено уменьшение miR-126 вместе с увеличением р85β белка [232]. Другой важный регуляторный компонент PI-3-K пути - ген-онкосупрессор PTEN, экспрессия которого сильно угнетается miR-21, что было продемонстрировано на карциноме печени [233]. При РТК также показано нарушение регуляции miR-21 [234]. Итак, супрессия PTEN контролируется miR-21 и ассоциируется с усилением PI-3-K пути и прогрессией РТК.
Хорошо известный супрессорный ген ТР53 мутирован в 50-75% случаях РТК. ТР53 участвует в контроле ДНК репарации и регулирует митогенные онкогены через индукцию белков точек сверки клеточного цикла, апоптоза, клеточного старения [222]. Многочисленные исследования показали, что транскрипционный активатор ТР53 прямо или косвенно супрессирует экспрессию специфичных генов [235]. Было обнаружено, что ТР53 контролирует экспрессию микроРНК, которая позволяет косвенно регулировать транскрипцию гена мишени на посттранскрипционном уровне [236]. На линии опухолевых клеток толстой кишки HCT-116 показано, что семейство miR-34a-c является транскрипционной мишенью для TP53 [237]. Экспрессия miR-34a является достаточным условием для запуска апоптоза через TP53 зависимый и независимый пути. Ген микроРНК miR-34b/с эпигенетически выключен у 9 из 9 клеточных линий РТК и 101 из 111 первичных опухолей РТК [238]. Изучение экспрессии микроРНК может быть полезным для определения и предсказания причины развития рака. С использованием real-time PCR метода была идентифицирована экспрессия большой группы микроРНК для выявления отличия рака поджелудочной железы от нормальной железы и от доброкачественной опухоли [239]. Был определен профиль экспрессии более 200 микроРНК прекурсоров. Более ста прекурсоров микроРНК абберантно экспрессируются в опухолях поджелудочной железы, среди них микроРНК уже ассоциированные с раком в предшествующих работах: miR-155, miR-21, miR-221 и miR-222. MiR-376a и miR-301 были впервые ассоциированы с онкозаболеваниями. По панели экспрессии микроРНК были правильно определены 28 из 28 опухолей поджелудочной железы, 11 из 15 доброкачественных опухолей и 6 из 6 нормальных тканей поджелудочной железы [239]. Большинство дифференциально экспрессируемых микроРНК в опухолях поджелудочной железы показали повышенную экспрессию микроРНК. Высоко экспрессируемые микроРНК могут быть терапевтическими мишенями при использовании антисмысловых олигонуклеотидов, а также как маркеры для диагностики рака. Обнаружено, что при РТК у 21 микроРНК уровень экспрессии повышен, а экспрессия одной мироРНК понижена. Было зарегистрировано нарушение экспрессии miR-17-5p, miR-20a, miR-21, miR-92, miR-106a, miR-155 [240]. В другой работе проанализировано 156 микроРНК и для 13 микроРНК были значительные изменения в экспрессии. Уровень экспрессии miR-31 коррелировал со стадией опухоли [241]. Еще одним применением микроРНК является противораковая терапия. Основная цель лекарств будущего поколения - индуцировать клеточную смерть исключительно опухолевых клеток. МикроРНК проявляют регуляторную роль в малигнизации и апоптозе, поэтому их можно использовать в модуляции чувствительности опухолей к терапии. Например, miR-145 проявляет проапоптозный эффект, который зависит от активации TP53. MiR-145 подавляет экспрессию альфа рецептора к эстрогену. Предлагается терапия с возобновлением экспрессии miR-145, которую можно использовать для опухолей с диким типом гена TP53 и с рецепторами к эстрогену [242].
MiR-15b и miR-16 проявляют модулирующую чувствительность к пяти из шести протестированных лекарств при раке желудка. Гиперэкспрессия обеих микроРНК наблюдается вместе с увеличением винкристин индуцированного апоптоза в клетках рака желудка. Обнаружено, что эти микроРНК регулируют уровень противоапоптозного белка BCL-2. Уменьшение экспрессии miR-15 и miR-16 вызывает устойчивость к лечению [243].
Показано, что глобальная репрессия микроРНК приводит к прогрессированию рака через быстрый рост опухоли и метастазирование. На модели KRAS индуцированного рака легких мыши установлено, что делеция гена белка DICER1, участвующего в биогенезе микроРНК, приводит к быстрой прогрессии опухоли. Восстановление нормального уровня экспрессии микроРНК может ингибировать рост опухоли [244]. В заключение необходимо отметить, что изучение функционирования микроРНК приведет к решению проблемы ранней молекулярной диагностики и будет способствовать разработке новых способов лечения рака. 2 МАТЕРИАЛЫ И МЕТОДЫ
2.1 Объекты исследования
В качестве материала использованы нуклеотидные последовательности мРНК 54 генов человека (Homo sapiens Genome build 37.2.), которые были получены из GenBank (http: // www.ncbi.nlm.nih.gov). Нуклеотидные последовательности 787 межгенных микроРНК получены из базы данных miRBase (http: // www.mirbase.org). Для подтверждения происхождения межгенных микроРНК была разработана программа miRNA Finder 2.2 (http: // sites.google.com/site/malaheenee/software/mirna-finder), которая определяла локализацию гена на хромосоме. 2.2 Классификации генов
Для классификации генов по функциям и их роли в развитии РТК была использована он-лайн программа DAVID Bioinformatics Resources 6.7, NIAID/NIH (http: // niaid.abcc.ncifcrf.gov/home.jsp). Программа работает на основе идентификационных кодов разных баз данных, мы использовали Refseq_мРНК коды. Для генов с несколькими альтернативными вариантами использовали самый длинный вариант (в основном первый транскрипт). На основе информации таких баз данных как NCBI, PIR and Uniprot/SwissProt, BioCarta & KEGG pathway гены были классифицированы по функциям. 2.3 Поиск сайтов взаимодействия микроРНК с мРНК и описания их характеристик
Для подготовки последовательностей мРНК была использована программа lextractor (разработанная В.А. Хайленко) (http://sites.google.com/site/malaheenee/software/). Поиск сайтов был осуществлен с помощью программы RNAhybrid 2.1. (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid), http://bibiserv.techfak.uni-bielefeld.de/rnahybrid), которая по запросу выдавала 5 лучших сайта по энергии гибридизации (ΔG) для каждой микроРНК в каждом гене. Программа выдает энергию гибридизации (ΔG) и схему взаимодейтвия для каждого сайта. Для автоматизации процесса поиска для нескольких генов использовали скрипт E-RNAhybrid (http://sites.google.com/site/malaheenee/software/) (разработанный В.А. Хайленко), который расчитывал ΔG/ΔGm, коэффициент стьюдента (p) для каждого сайта, также программа выдает информацию о локализации (5'UTR, CDS и 3'UTR) и позиции начала сайта в нуклеотидной последовательности мРНК. При рассчете коэффициента студента использовали корректирующий коэффициент, который зависит от длины микроРНК. Для микроРНК длиной меньше 21 нуклеотида значение p умножали на корректирующий коэффициент и достоверность становилась ниже, для микроРНК длиной выше 21 н. значение p делили на коэффициент и доставерность становилась выше. Корректирующие коэффициенты представлены в таблице 7. Для расчета параметра ΔG/ΔGm (%) или введенного нами score была использована следующая формула (1)
Score (ΔG/ΔGm) = 100 x (ΔG / ΔGm) (1)
где, ΔG - энергии гибридизации сайта определенной микроРНК, ΔGm - максимальная возможная энергии гибридизации для этой микроРНК. То есть этот параметр является сравнительным количественным критерием силы взаимодействия микроРНК с мРНК.
Таблица 7 - Корректирующие коэффициенты
Длина микроРНККоэффициентДлина микроРНККоэффициент275,15211,00263,05201,13252,16191,27241,68181,40231,37171,53221,16161,67
Сайты взаимодействия микроРНК с мРНК определяли на основании величины ΔG/ΔGm и ее стандартного отклонения (p<0,0005). Пороговая величину ΔG/ΔGm зависит от длины микроРНК (таблица 8). Сродство ig-miRNA к 5'UTR, CDS и 3'UTR мРНК 54 изученных генов оценивали для каждого из этих участков с достоверностью p<0,0005. Плотность сайтов связывания в 5'UTR, CDS, 3'UTR и всей мРНК рассчитывали как отношение числа сайтов (s) к длине нуклеотидной последовательности (l) этих участков умноженное на 103 (s/l), то есть в расчете на 1000 нуклеотидов.
Таблица 8 - Значения ΔG/ΔGm для микроРНК разной длины Длина микроРНКΔG/ΔGm, %Длина микроРНКΔG/ΔGm, %2770217626712077257219782473188023741782,522751685 Для описания характеристик сайтов были построены 2D структуры мРНК 13 генов мишеней микроРНК (ABCC2, ABCG2, ALCAM, APC, AXIN1, BAX, CDH1, FLCN, MLH3, MMP2, PTPN12, SRC, TP53) с помощью программы UNAFold.3.7 (http://dinamelt.bioinfo.rpi.edu). С помощью графической программы GNU Image Manipulation были построены сайты микроРНК.
2.4 Методика изучения различий между сайтами, предсказанными с помощью программ RNAhybrid и TargetScan
Сайты, предсказанные программой TargetScan, были получены с базы данных (www.targetscan.org) от июня 2012. В этой последней версии TargetScan введены сайты связывания для всех подтвержденных микроРНК (miRBase Release 17). Также в этой версии базы есть сайты микроРНК для пяти орзанизмов (человек, мышь, нематода, дрозофила, рыба). С прошлого года в базе можно найти все канонические виды сайтов (5'-доминантный канонический сайт, сайт с 5'-доминантной seed областью и 3'-компенсаторный сайт) в генах мишенях микроРНК. Для изучения консервативности предсказанных сайтов микроРНК были скачены выравненные последовательности 3'UTR для семи сайтов (CCND1:hsa-miR-4487, GSK3B:hsa-miR-4710, GSK3B:hsa-miR-4732-3p, MTHFR:hsa-miR-1260, PTPN12:hsa-miR-4711-3p, TP53:hsa-miR-1285, ZEB1:hsa-miR-4663). Консервативность сайтов связывания изучена для следующих организмов: hsa - Homo sapiens (человек), mml - Macaca mulatta (макака-резус), ptr - Pаn troglodytes (шимпанзе), ocu - Oryctolagus cuniculus (кролик), oga - Otolemur garnetti (галаго). 2.5 Методика изучения различий между сайтами, предсказанными с помощью программ RNAhybrid и miRanda
Для поиска сайтов программой miRanda были использована версия miRanda v3.3a. Для удобства использования программы был использован скрипт emiRanda (разработанной В.А. Хайленко). Для сравнения были изучены мРНК 14 генов мишеней (ABCC2, APC, AXIN1, BAD, DLC1, FLCN, FZD7, KIT, KLF12, MET, MLH1, MLH3, MMP2, MMP9). Cайтов предсказанных программой miRanda представлены в базе www.microrna.org. Для проверки доступности сайтов предсказанных этой программой для 11 сайтов локализованных в 3'UTR, представленных в таблице 15 был проведен поиск по базе данных www.microrna.org, потому что в базе преставлены только сайты разположенные в 3'UTR области мРНК. 2.6 Изучение филогенетической консервативности сайтов предсказанных RNAhybrid
В качестве объектов исследований использовали нуклеотидные и аминокислотные последовательности мРНК гена PTPN12 Homo sapiens (Hsa) и ортологичных генов PTPN12 в геномах следующих видов животных: Anolis carolinensis (Aca) - красногорлый анолис (green anole), Ailuropoda melanoleuca (Ame) - панда (panda), Bos Taurus (Bta) - дикий бык (cow), Cricetulus griseus (Cgr) - Китайский хомяк (hamster), Cavia porcellus (Cpo) - морская свинка (guinea pig), Callithrix jacchus (Cja) - обыкновенная игрунка (common marmoset), Canis lupus familiaris (Cfa) - собака (dog), Danio rerio (Dre) - поласатый данио (zebrafish), Equus caballus (Eca) - лошадь (horse), Galus galus (Gga) - курица (chicken), Homo sapiens (Hsa) - человек (human), Loxodonta Africana (Laf) - слон (African elephant), Macaca mulatta (Mml) - макака-резус (rhesus monkey), Monodelphis domestica (Mdo) - опоссум (opossum), Meleagris gallopavo (Mga) - индейка (turkey), Mus musculus (Mmu) - мышь (mouse), Nomascus leucogenys (Nle) - гиббон (gibbon), Ornithorhynchus anatinus (Oan) - утконос (platypus), Oryctolagus cuniculus (Ocu) - кролик (rabbit), Oreochromis niloticus (Oni) - теляпия (tilapia), Pongo abelii (Pab) - орангутаны (orangutan), Pan troglodytes (Ptr) - шимпанзе (chimpanzee), Rattus norvegicus (Rno) - крыса (rat), Sus scrofa (Ssc) - свинья (pig), Taeniopygia guttata (Tgu) - зебровая амадина (zebra finch), Xenopus laevis (Xla) - гладкая шпорцевая лягушка (African clawed frog), Xenopus tropicalis (Xtr) - когтиская шпорцевая лягушка, которые были получены из GenBank (http://www.ncbi.nlm.nih.gov). Нуклеиновую и аминокислотную последовательность ортологов PTPN12 имеют следующие идентификационные номера (Aca XM_003221488.1; Bta NM_001205991.1; Cja XM_002751667.1; Cfa XM_003432299.1; Dre NM_200669.1; Eca XM_001915066.1; Gga XM_415970.3; Hsa NM_002835.3; Laf XM_003407183.1; Mdo XM_001371009.2; Mga XM_003201888.1; Mmu NM_011203.2; Nle XM_003268189.1; Oan XM_001507411.2; Ocu XM_002712097.1; Oni XM_003445026.1; Pab XM_002818305.1; Ptr XM_003318551.1; Rno NM_057115.2; Tgu XR_053986.1; Xla NM_001091372.1; Xtr NM_001030495.1), MSH6 ортологов (Aml, XM_002912423.1; Bta, NM_001192737.1; Clu, XM_531814.3; Cgr, XM_003499545.1; Cpo, XM_003473077.1; Dre, NM_182860.1; Eca, XM_001497961.2; Hsa, NM_000179.2; Laf, XM_003417585.1; Mdo, XM_001382140.1; Mml, XM_001113749.2; Mmu, NM_010830.2; Ocu, XM_002709880.1; Nle, XM_003262562.1; Ptr, XM_003309053.1; Pab, XM_002812046.1; Ssc, XM_003354836.2), ZEB1 ортологов (Ame, XM_002920455.1; Bta, NM_001206590.1; Cja, XM_002750141.1; Clu, XM_003433703.1; Dre, NM_131709.1; Gga, NM_205131.1; Hsa, NM_001128128.2; Mml, XM_001089463.2; Mmu, NM_011546.3; Nle, XM_003276020.1; Pab, NM_001131215.2; Ptr, XM_003312512.1; Rno, NM_013164.1; Xtr, NM_001015808.1; Xla, NM_001092493.1).
Нуклеотидные последовательности hsa-miR-1279, hsa-miR-548m получены из базы miRBase (http://www.mirbase.org). Свободная энергия гибридизации (ΔG) рассчитывалась с помощью программы RNAHybrid 2.1 (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/). Величина ΔG/ΔGm (%) является сравнительным количественным критерием силы взаимодействия микроРНК с мРНК. ΔGm равна энергии связи микроРНК с полностью комплементарной ей нуклеотидной последовательностью. Величины ΔGm для hsa-miR-1279 и hsa-miR-548m соответственно равны -28,2 kcal/mol, -33,3 kcal/mol. Величину ΔG и ее стандартное отклонение использовали для определения по критерию Стьюдента уровня достоверности сайтов взаимодействия микроРНК с мРНК. Графики вариабельности нуклеотидных и аминокислотных последовательностей построены по программе WebLogo (http://weblogo.berkeley.edu/). 3 РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ
3.1 Характеристики генов, ассоциированных с развитием РТК
На первом этапе работы по литературным данным был проведен поиск генов с наличием мутаций при раке толстой кишки и составлена база генов из 142 генов, в которых экспериментально были обнаружены мутации при этом заболевании. Таблица А.1 (Приложение А) представляет все гены, которые мы ассоциировали с развитием рака толстой кишки. Из 142 генов для дальнейшего исследования были отобраны 54 гена, которые наиболее важны и часто встречаются в опухоли этой локализации, то есть наибольшее количество исследований приходилось на эти гены. В таблице 9 представлены 54 гена и их характеристики. В таблице 9 указаны ссылки на работы, в которых были обнаружены нарушения и мутации в этих генах. В результате анализа литературы можно сделать вывод, что ключевую роль в развитии онкогенеза играют активирующие мутации в протоонкогенах и инактивирующие мутации в к генах супрессорах опухоли. Из 54 генов 9 генов относятся к протоонкогенам и 12 генам супрессорам опухоли. Все остальные гены участвуют в ключевых путях развития и малигнизации опухоли. Используя он-лайн программу DAVID Bioinformatics Resources 6.7, NIAID/NIH (http: // niaid.abcc.ncifcrf.gov/home.jsp) 54 гена были классифицированы в зависимости от функции гена. Анализ литературы показал, что Wnt-сигнальный путь - основной путь активации пролиферации стволовых клеток кишечника, которые отвечают за постоянное самообновление эпителия кишечника. APC, AXIN1, AXIN2, CTNNB1, FZD7, GSK3B гены - участники Wnt-сигнального пути. Wnt-сигнальный путь играет ключевую роль в процессах регуляции дифференцировки и плюрипотентности стволовых клеток. Особо надо отметить APC ген, наследственные мутации в разных позициях этого гена вызывают развитие разных синдромов с высоким риском развития рака в течении всей жизни (таблица 1). Ген CTNNB1 кодирует β-катенин, за уровень этого белка отвечают участники Wnt-сигнального пути. Активация Wnt-сигнального пути осуществляется за счет семи трансмембранных белков семейства Frizzled, ген FZD7 является одним из представителей этого семейства. Активация рецептора приводит к фосфорилированию цитоплазматического хвоста белка Lrp6 или Lrp5, который после активации связывает мульти-протеиновый комплекс, состоящий из APC, Axin, GSK3 белков. Без стимуляции рецептора этот комплекс отвечает за инактивацию β-катенина. При активации рецептора происходит ингибирование комплекса и активируется β-катенин, стимулируется его проникновение в ядро. В ядре белок связывается с белками семейства LEF/TCF, отвечает за транскрипционную активность генов мишеней [245-250]. Гены MLH1, MLH3, MSH2, MSH3, MSH6, MUTYH, PMS1, PMS2 участвуют ДНК репарации и наследственные мутации в этих генах могут быть причиной развитии наследственного неполипозного колоректального рака, которые обусловлены двумя наследственными синдромами (синдром Линча или MUTYH-ассоцированный полипозный синдром) [251-257]. Таблица 9 - Гены, участвующие в раке толстой кишки
ГенRefseq_мРНКПолное название генаХарактеристика гена, источник1234 Гены Wnt-сигнального путиAPCNM_001127511adenomatous polyposis coliген супрессор опухоли [245]AXIN1NM_003502axin 1ген супрессор опухоли [246]AXIN2NM_004655axin 2[247]CTNNB1NM_001904catenin (cadherin-associated protein), beta 1, 88kDa[248]FZD7NM_003507frizzled homolog 7 (Drosophila)[249]GSK3B NM_002093 glycogen synthase kinase 3 beta[250] Гены наследственного неполипозного колоректального рака и ДНК репарацииMLH1NM_001167617mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)ген супрессор опухоли [251]MLH3NM_014381mutL homolog 3 (E. coli)[252]MSH2 NM_000251 mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli)ген супрессор опухоли [253]MSH3 NM_002439 mutS homolog 3 (E. coli)[254]MSH6NM_000179mutS homolog 6 (E. Coli)[255]MUTYHNM_012222mutY homolog (E. coli)ген супрессор опухоли, репарация окислительного повреждения ДНК [256]PMS1NM_000534PMS1 postmeiotic segregation increased 1 (S. cerevisiae)ген супрессор опухоли [257]PMS2NM_000535PMS2 postmeiotic segregation increased 2 (S. cerevisiae)ген супрессор опухоли [258]Гены апоптозаBADNM_004322BCL2-associated agonist of cell death[259]BAXNM_138765BCL2-associated X proteinген супрессор опухоли [259]BUB1NM_004336budding uninhibited by benzimidazoles 1 homolog (yeast)[260]PTENNM_000314phosphatase and tensin homolog pseudogene 1ген супрессор опухоли [261]TP53NM_001126116tumor protein p53ген супрессор опухоли [262]TNFSF10 NM_003810 tumor necrosis factor (ligand) superfamily, member 10[263]
Продолжение таблицы 9
1234Клеточный циклEP300NM_001429E1A binding protein p300[264]CCND1NM_053056cyclin D1протоонкоген [265]Гены клеточной адгезии и трансмембранные белкиADAM29NM_014269ADAM metallopeptidase domain 29Белок межклеточного и клетка-мартикс взаимодействия [266]ALCAMNM_001627activated leukocyte cell adhesion moleculeБелок клочной адгезии и миграции [267]CDH1NM_004360cadherin 1, type 1, E-cadherin (epithelial)кальций зависимый белок межклеточной адгезии [268]EPCAM NM_002354 epithelial cell adhesion moleculeкальций независимый белок межклеточной адгезии [269]PROM1 NM_006017prominin 1Белок стволовых клетки взрослых [270] Гены MAP киназного путиBRAFNM_004333v-raf murine sarcoma viral oncogene homolog B1Протоонкоген [271]EGFRNM_005228epidermal growth factor receptor протоонкоген [272]KRASNM_004985v-Ki-ras2 Kirsten rat sarcoma viral oncogene homologпротоонкоген
[273]MYC NM_002467 v-myc myelocytomatosis viral oncogene homolog (avian)протоонкоген
[274]Гены металлопротеиназ и метастазированияMMP2NM_004530matrix metallopeptidase 2 (gelatinase A, 72kDa gelatinase, 72kDa type IV collagenase)[275]MMP9NM_004994matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV collagenase)[276]ABC-транспортерыABCB1 NM_000927 ATP-binding cassette, sub-family B (MDR/TAP), member 1Белок-насос для откачивания ксенобиотиков из клетки [277]ABCC2NM_000392ATP-binding cassette, sub-family C (CFTR/MRP), member 2Белок-насос для откачивания ксенобиотиков из клетки [278]ABCG2NM_004827ATP-binding cassette, sub-family B (MDR/TAP), member 1Белок-насос для откачивания ксенобиотиков из клетки [279]
Продолжение таблицы 9
1234Гены цинковых пальцевKLF12NM_007249Kruppel-like factor 12Аткиватор транскрипции [280]ZEB1NM_001128128zinc finger E-box binding homeobox 1Транскипционный фактор [281]SNAI1 NM_005985sapiens snail homolog 1 (Drosophila)Репрессор транскрипции [282]VDRNM_000376vitamin D receptor[283] Гены клеточной миграцииCD44NM_001001390CD44 molecule[284]METNM_000245met proto-oncogeneПротоонкоген [285]KITNM_000222Proto-oncogene tyrosine-protein kinase Kit (c-kit) (CD117 antigen)протоонкоген
[286]SRC
NM_005417
v-src sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog (avian)протоонкоген
[287]Гены, участвующие в стимуляции роста сосудовENGNM_001114753endoglinРецептр к TGFB
[288]TGFBR2NM_001024847transforming growth factor, beta receptor II (70/80kDa)Рецептр к TGFB
[289]VEGFA NM_001025366vascular endothelial growth factor A[290]Гены, участвующие в регуляции роста клеток и изменения цитоскелетаPIK3CANM_006218phosphoinositide-3-kinase, catalytic, alpha polypeptideген супрессор опухоли
[291]SMAD4NM_005359SMAD family member 4Транскрипционный фактор [292]DLC1NM_182643deleted in liver cancer 1Изменения цитоскелета
[293]PTPN12NM_002835protein tyrosine phosphatase, non-receptor type 12Тирозин-фосфотаза активирующая многие клеточные процессы
[294]Гены с разной функцией, ассоциированные с РТКGNASNM_000516GNAS complex locusПротоонкоген, импринтированный ген [295]MTHFRNM_005957methylenetetrahydrofolate reductase (NAD(P)H)Фермент, катализирующий превращение 5,10-метилентетрагидрофолата в 5-метилентетра-гидрофолат [296]FLCNNM_144997folliculinген супрессор опухоли
[297] Гены BAD, BAX, BUB1, PTEN, TP53, TNFSF10 относятся к генам, ответственных за активацию апоптоза. Мутации в этих генах часто встречаются при всех видах рака [258-263]. Гены клеточной адгезии и трансмембранных белков ADAM29, ALCAM, CDH1, EPCAM экспрессируются в клетках толстой кишки и отвечают за межклеточное и клетка-мартикс взаимодействия. Мутации во всех генах часто встречаются при карциноме толстой кишки, EPCAM считается карцинома-ассоциированным антигеном. CDH1 кодирует адгезивную молекулу Е-кадгерина, потеря которого приводит к активации матричных протеаз, которые расщепляют базальную ламину и приводит к подвижности клетки, активации процессов инвазивности. Антиген PROM1 или CD133 также относится к трансмембранным белкам, который экспрессируется на стволовых клетках толстой кишки и является одним из основных маркеров для определения этих клеток [266-270].
Гены BRAF, EGFR, KRAS, MYC [271-274] являются протоонкогенами и классифицированы как гены MAP киназного пути, потому что путь активирует mitogen-activated protein киназы. Анализ литературы показал, что активация этого сигнального пути свойственна для множества случаев РТК. Также этот путь называют Ras сигнальный путь, активация которого приводит к бесконтрольному росту клетки. Мутации генов MMP2, MMP9 характерны для поздних стадий РТК с регионарными и отдаленными метастазами, так как эти гены кодируют металопротеиназы, которые участвуют в метазстазировании и инвазивности опухоли [275, 276].
Гены ABCB1, ABCC2, ABCG2 экспрессируется в стволовых раковых клетках и стволовых клетках. Гены обеспечивают множественную лекарственную устойчивость, потому что уменьшают аккумуляцию лекарств в клетках по средствам выкачивания их из клетки [277-279]. Гены с содержанием цинковых пальцев составляют следующую группу генов (KLF12, ZEB1, SNAI1, VDR) [280-283]. Эти гены имеют разнообразные функции, от транскрипционных факторов до регуляторов транскрипции. Мутации во всех генах были ассоциированы с РТК. Можно особо отметить ген VDR. По последним данным витамин Д является антагонистом РТК предположительно за счет ингибирования β-катенина. Предполагается, что β-катенин непосредственно взаимодействует с рецептором к витамину Д продуктом гена VDR. Гены CD44, MET, KIT, SRC [284-287] относится к генам, ответственным за клеточную миграцию. Хотя многие гены участвуют и в других важных процессах. CD44 высоко экспрессируется у раковых стволовых клеток. Остальные гены относятся к протоонкогенам, активирующая мутация которых была зарегистрирована при РТК. KIT кодирует рецептор, активация которого отвечает за пролиферацию, ингибирование апоптоза при нехватке ростовых стимулов или гамма излучении. Ген SRC кодирует нерецепторную тирозин киназу, которая участвует в процессах клеточного деления, миграции, адгезии, клеточного выживания. Ген MET кодирует тирозин киназный рецептор, активация которого влияет на клеточную пролиферацию, выживание, подвижность, дифференцировку, морфогенез, при раке этот путь активируется на стадиях инвазивности и метастазирования опухоли. Все три киназы являются мишенями в разработке лекарств против рака. Гены ENG, TGFBR2, VEGFA [288-290] имеют прямое или косвенное действие на стимуляцию роста сосудов. Первые два гена являются рецепторами к трансформирующему ростовому фактору бета - цитокину, который стимулирует рост сосудов в опухоли и ингибирует иммунные ответ. Третий ген кодирует фактор, активирующий рост сосудов, который также играет ключевую роль в разрастании и прогрессировании опухоли.
Последние семь генов имеют разные функции (PIK3CA, SMAD4, FLCN, DLC1, PTPN12, GNAS, MTHFR), участвуют в таких процессах как регуляции роста клеток и изменения цитоскелета и др. [291-297].
Результаты исследования были опубликованы в нескольких публикациях [298, 299]. 3.2 Характеристики межгенных микроРНК
Из базы miRBase были получены нуклеотидные последовательности 787 межгенных микроРНК, с помощью программы miRNAFinder было подтверждено межгенное происхождение для 784 микроРНК. Для miR-1244, miR-3178, miR-3928 программа miRNAFinder не подтвердила межгенное происхождение. На рисунке 7 представлено распределение количества микроРНК в зависимости от длины микроРНК. Было установлено, что большинство межгенных микроРНК (612) имеют длину 21-23 нуклеотида. 385 межгенных микроРНК имеют длину 22 нуклеотида. Высокое содержание гуанина и цитозина влияет на высокую энергию взаимодействия микроРНК с генами мишенями. Изучена доля гуанин-цитозина (ГЦ) в межгенных микроРНК (Рисунок 8). Минимальное ГЦ-содержание имеет miR-2054 (8,7%), а максимальное у miR-4466 (94,4%). На рисунке 8 представлено ГЦ-содержание межгенных микроРНК с разной длиной. Ичучение ГЦ содержания межгенных микроРНК показало, что несмотря на их межгенное происхождение 51% всех межгенных микроРНК имеют ГЦ содержание от 50% до 94%. То есть ГЦ содержание половины всех микроРНК имеет высокое значение, что будет влиять на высокое значение энергии взаимодействия микроРНК с мРНК-мешенью.
Рисунок 7 - График зависимости количества и длины микроРНК Рисунок 8 - ГЦ-содержание межгенных микроРНК
Для определения важных микроРНК в развитии РТК в результате анализа литературы была создана база данных микроРНК, у которых обнаружено нарушение экспрессии при РТК. База данных состоит из 38 микроРНК, которые идентифицированы как потенциальные маркеры для диагностики, прогнозирования течения заболевания, возникновения рецидивов после лечения, назначения терапии. Например, экспрессия таких микроРНК, как miR-200c [313], miR-21 [309, 310] и miR-18a [315], ассоциирована с низким уровнем выздоровления и используется как прогностический маркер для предсказания выживания постоперационных больных с РТК. По последним клиническим данным, пациенты с низким уровнем экспрессии miR-200c живут в среднем на двенадцать месяцев дольше, чем пациенты с высоким уровнем экспрессии этой микроРНК. При высокой экспрессии miR-21 высокий риск наличия метастаз в регионарных лимфоузлах и отдаленных органах. То есть, экспрессии miR-21 коррелирует с клинической стадией РТК. Экспрессия miR-31 также может быть маркером для определения стадии заболевания. Экспрессия miR-320 и miR-498 ассоциирована с течением заболевания без рецидивов, то есть может быть прогностическим маркером. Есть работы, которые предлагают использовать уровень miR-145 и miR-320 для диагностики РТК. В таблице 10 представлены микроРНК, потенциально участвующие в развитии рака толстой кишки. В результате анализа литературы можно предложить следующие микроРНК как наиболее перспективные микроРНК для использования в качестве молекулярных маркеров: miR-106a, miR-126, miR-143, miR-145, miR-17-5p, miR-181b, miR-183, miR-200c, miR-20a, miR-21, miR-31, miR-34a, miR-92. В результате анализа данных, представленных в таблице 10, следует, что экспрессия некоторых микроРНК нарушена при нескольких опухолях. Приведенные результаты предварительные, потому что в большинстве случаев основаны на нарушении уровня экспрессии микроРНК при РТК по microarray анализу и нуждаются в дальнейшем подтверждении другими методами. Для дальнейшего изучения будут использованы все межгенные микроРНК человека.
Результаты работы отражены в одной статье и нескольких тезисах [323-325]. Таблица 10 - Потенциальные маркеры РТК
микроРНКГены мишениДругие опухолиЭксп-рессиязначимостьисточникlet-7gRas, TGFRIIhighИндикатор для химиотерапии [300]miR-130aTGFRII[301]miR135aAPC, MSH2[223]miR-135bAPC, MSH2high[223]miR-143DNMT3A, ICP4, ERK5лейкемияdown[302, 303]
Продолжение таблицы 10
микроРНКГены мишениДругие опухолиЭксп-рессиязначимостьисточникmiR-145YES, STAT1, TP53, ER-alha, ICP-4, IRS-1, TGFRII, APC, IRS1Лейкемия, рак молочной железыdown[242,304]miR-214TP53, B-CATENIN, TGFRII, BAX, CDKN2B, EGFR[301]miR-378SuFu, Fus-1[305]miR-34aBAX, E2F, P53down[306]miR-424[301]let-7a-1C-myc, RASdownАгент против рака[307]miR-96CHES1high[308]miR-21PDCD4, Maspin, TPM1 PTENРак молочной железы, глиобластомаhighПрогности-ческий маркер в стуле[309, 310]miR-133bKRAShigh[308]miR-126PI3Kdown[311]miR-31FOXP3highСоответствует стадии[308]miR-183high[308]miR-106aE2F1, Rb1, IL-10, HIPK3Рак желудкаhighПрогности-ческий маркер в стуле[312]miR-15bhigh[313]miR-181bVSNL1, GRIA2, cytC, ECIP-1, MAPPKKK1, TEM6, E2F5, GATA6, Глиоблас-томаhighИндикатор для химиотерапии[313]miR-191high[313]miR-222[314]
Продолжение таблицы 10
микроРНКГены мишениДругие опухолиЭксп-рессиязначимостьисточникmiR-155TP53INP1лимфомы, рак молочной железыhigh[240]miR-92highПрогностический маркер в плазме[314]miR-200cTCF8, MAPKKK3, eIF-4E, RAS homologs, RNA polymerase II, cyclin L1highПрогностичес-кий маркер[313]miR-17-3phighПрогностический маркер в плазме[314]miR-95[314]miR-18aРак печениhighПрогности-ческий маркер[315]miR-20ahigh[315]miR-17-5phigh[316]miR-203high[316]miR-101COX-2down[317]miR-137TGF2Idown[318]miR-125bVEFG, VEGFR, IGFR-1Рак молочной железыhigh[318]miR-320Без рецидивов[319]miR-498Без рецидивов[319]miR-29aПрогностичес-кий маркер в плазме[320]miR-221Прогностичес-кий маркер[321, 322] 3.3 Взаимодействие межгенных miRNA с мРНК генов, участвующих в онкогенезе
Для определения микроРНК, играющих ключевую роль в регуляции трансляции белок кодирующих генов, участвующих в развитии РТК, была разработана методика поиска сайтов взаимодействия микроРНК с высокой комплементарностью по всей последовательности сайта. Для этого был введен параметр ΔG/ΔGm, который определяет долю энергии взаимодействия определенного сайта микроРНК от максимально возможной энергии гибридизации для этой микроРНК. Значение коэффициента Стьюдента для сайтов не должно быть ниже p<0.0005. Минимальное значение параметра ΔG/ΔGm зависит от длины микроРНК (min-70%, max -85%), это значения для всех микроРНК представлено в таблице 8. В результате изучения связывания 784 межгенных микроРНК с мРНК 54 белок-кодирующих генов человека установлено, что 47 мРНК являются мишенями и мРНК семи генов (ABCB1, MSH2, MSH3, MYC, PROM1, SNAI1, TNFSF10) не имеют сайтов связывания с межгенными микроРНК при установленных критериях взаимодействия. Только 120 микроРНК из 784 межгенных микроРНК действуют на мРНК 47 генов, которые имеют 185 сайтов связывания межгенных микроРНК. Большинство обнаруженных сайтов имеют Г:У пары и очень высокий уровень комплементарности [327]. В таблице 11 приведены результаты исследования взаимодействия межгенных микроРНК с мРНК 47 генов, каждая из которых связывает от одной до несколько межгенных микроРНК. Некоторые из этих мРНК связывают шесть и более межгенных микроРНК. Например, мРНК генов AXIN1, CCND1, CDH1, GSK3B FLCN, MMP2, SMAD4, SRC, VEGFA имеют от 6 до 13 сайтов для связывания микроРНК, что значительно больше среднего числа сайтов связывания микроРНК в расчете на одну мРНК 47 генов и равного 3,9. мРНК гена SRC имеет в CDS два сайта, в 3'UTR девять сайтов связывания с микроРНК. Из данных, представленных в таблице 11 видно, что большинство мРНК имеют по одному сайту связывания для одной микроРНК. Некоторые микроРНК связываются с несколькими мРНК. Например, miR-4472 связывается с мРНК семи генов, а miR-1279 имеет пять мРНК-мишеней [327]. Между длиной изученных мРНК и числом сайтов связывания микроРНК отсутствует связь, т.к. коэффициент корреляции равен -0,061. Плотность сайтов связывания разных микроРНК с мРНК изученных генов существенно отличалась. 23%, 42%, 35% сайтов находятся в 5'UTR, CDS и 3'UTRs соответственно для 47 мРНК. Для мРНК, представленных в таблице 12, плотность сайтов изменялась от 0,18 s/l (мРНК APC) до 3,17 s/l (мРНК SRC). В среднем плотность сайтов составляла 0,99 s/l сайтов на тысячу нуклеотидов для мРНК. мРНК гена SRC имеет наибольшую плотность сайтов связывания, что предполагает важную роль межгенных микроРНК в регуляции экспрессии этого гена [327].
Таблица 11 - Сайты взаимодействия 47 мРНК с межгенными микроРНК
ГенымикроРНКПозиция сайта, нУчасток мРНКΔG
(kcal/mol)P<ΔG/ΔGm, %L mir, нABCC2hsa-miR-12464484CDS-29,10,0003082,419 hsa-miR-44552725CDS-26,40,0 0,0003283,317ABCG2hsa-miR-44554165'UTR-280,0001988,317 hsa-miR-4472825'UTR-31,50,0003681,818ADAM29hsa-miR-4284235'UTR-35,10,0002884,018ALCAMhsa-miR-127943003'UTR-24,90,0001988,317 hsa-miR-21*3045'UTR-39,10,0001885,021 hsa-miR-44724785'UTR-31,10,0004080,818APChsa-miR-302f2287CDS-27,60,0000799,617 hsa-miR-4693-5p91723'UTR-370,0000889,823AXIN1hsa-miR-12042033CDS-35,90,0003778,921 hsa-miR-12682885'UTR-39,50,0003083,218 hsa-miR-15872006CDS-39,60,0003979,420 hsa-miR-324-5p1891CDS-39,30,0005174,423 hsa-miR-365*1210CDS-41,50,0002481,222 hsa-miR-43071072CDS-26,00,0002185,519AXIN2hsa-miR-125b-1*35'UTR-38,10,0005375,2922 hsa-miR-339-5p29563'UTR-41,90,0004375,4923 hsa-miR-44881765CDS-43,70,0002086,7018 hsa-miR-76036223'UTR-38,90,0004678,1120BADhsa-miR-1538285'UTR-43,20,0005573,9723 hsa-miR-3180565CDS-38,10,0004379,5419 hsa-miR-4665-5p368CDS-46,40,0002579,3123BAXhsa-miR-42757033'UTR-24,90,0002286,7517BRAFhsa-miR-1260b76CDS-36,80,0002484,2119 hsa-miR-44581012CDS-32,70,0002982,7819BUB1hsa-miR-4727-3p1037CDS-35,40,0004376,7822CCND1hsa-miR-1260b22453'UTR-34,40,0004778,7119 hsa-miR-22322613'UTR-320,0004776,0022 hsa-miR-3180-5p22503'UTR-45,10,0003174,5425 hsa-miR-448118923'UTR-340,0002884,3617 hsa-miR-448720223'UTR-37,60,0002484,1119 hsa-miR-50721133'UTR-29,90,0004178,0621CD44hsa-miR-12683685'UTR-38,80,0003681,6818 hsa-miR-4455465'UTR-26,90,0002784,8517CDH1hsa-miR-128536773'UTR-36,70,0003278,7522 hsa-miR-1587575'UTR-42,20,0002084,5620 hsa-miR-44721890CDS-32,60,0002584,6718 hsa-miR-4481495'UTR-34,50,0002585,6017 hsa-miR-4488195CDS-43,00,0002385,3118 hsa-miR-4507625'UTR-46,40,0001090,9820 hsa-miR-4710925'UTR-36,60,0002783,9418CTNNB1hsa-miR-4708-5p29833'UTR-36,90,0004178,0121DLC1hsa-miR-4307466CDS-23,90,0004878,6119
Продолжение таблицы 11
ГенымикроРНКПозиция сайта, нУчасток мРНКΔG
(kcal/mol)P<ΔG/ΔGm, %L mir, нDLC1hsa-miR-47363515CDS-35,40,0002783,0919hsa-miR-44723158CDS-31,40,0003681,5518EGFRhsa-miR-42532633CDS-35,70,0004779,5118 hsa-miR-44831145'UTR-33,90,0001292,3717 hsa-miR-4795-3p489CDS-30,70,0002879,7422 hsa-miR-525-5p1852CDS-35,20,0003878,5721 hsa-miR-5443816CDS-28,30,0003578,1722ENGhsa-miR-15872075'UTR-38,70,0005077,5520 hsa-miR-43273135'UTR-360,0004878,6019 hsa-miR-4456964CDS-290,0003782,1517 hsa-miR-447227613'UTR-32,40,0002684,1518EP300hsa-miR-44815992CDS-33,60,0003283,3717 hsa-miR-44836356CDS-31,40,0002585,5517 hsa-miR-4717-3p5548CDS-38,40,0004976,821EPCAMhsa-miR-44561125'UTR-30,60,0002286,6817FLCNhsa-miR-125b-1*685'UTR-38,90,0004176,8722 hsa-miR-128531143'UTR-36,40,0003578,1122 hsa-miR-150*863CDS-43,90,0002181,9022 hsa-miR-197233743'UTR-48,20,0000989,9222 hsa-miR-4508678CDS-40,30,0002685,2017 hsa-miR-4727-5p1503CDS-39,30,0001983,9721 hsa-miR-515-3p1099CDS-34,90,0003378,4222FZD7hsa-miR-194*577CDS-36,90,0005275,3022 hsa-miR-45161785CDS-35,60,0003782,0217GNAShsa-miR-12683085'UTR-40,20,0002584,6318 hsa-miR-15872395'UTR-39,50,0004079,15820 hsa-miR-44661895'UTR-420,0003681,7118 hsa-miR-45072505'UTR-39,50,0005077,4520 hsa-miR-4787-5p3385'UTR-45,40,0005375,1622GSK3Bhsa-let-7a*68233'UTR-26,60,0005875,5621 hsa-miR-1268165'UTR-38,80,0003681,6818 3615'UTR-38,70,0003781,4718 hsa-miR-426540203'UTR-38,20,0002783,2219 hsa-miR-46564195'UTR-47,60,0002280,4023 hsa-miR-46647163'UTR-37,40,0001087,5823 hsa-miR-4666-3p34483'UTR-27,30,0002881,0021 hsa-miR-471040463'UTR-34,60,0004879,3518 hsa-miR-4732-3p31703'UTR-410,0001785,2321 hsa-miR-4787-5p75'UTR-47,20,0003578,1422 hsa-miR-56835443'UTR-23,90,0004977,5920 46993'UTR-26,10,0002084,7420 hsa-miR-876-5p9605'UTR-31,30,0003378,4422KIThsa-miR-314745053'UTR-41,70,0005073,2824 hsa-miR-4776-3p648CDS-37,90,0005474,0223
Продолжение таблицы 11
ГенымикроРНКПозиция сайта, нУчасток мРНКΔG
(kcal/mol)P<ΔG/ΔGm, %L mir, нKIThsa-miR-5442796CDS-280,0003977,3422KLF12 hsa-miR-221*34623'UTR-32,10,0002879,8522hsa-miR-43281269CDS-27,50,0003582,5817hsa-miR-466675'UTR-34,20,0002380,0923 hsa-miR-4704-3p79433'UTR-31,60,0004476,5122KRAShsa-miR-499a-3p19893'UTR-310,0003677,8822 hsa-miR-548ak39273'UTR-27,20,0004377,7121METhsa-miR-43072579CDS-24,70,0003481,2519MLH1hsa-miR-21131458CDS-34,10,0002880,9921 hsa-miR-320a2278CDS-36,70,0004476,4522 hsa-miR-320c2281CDS-34,70,0002682,6120 hsa-miR-4795-3p1971CDS-28,90,0005475,0622MLH3hsa-miR-12054527CDS-31,30,0005676,7120 hsa-miR-22161033'UTR-35,20,0004475,3723 hsa-miR-378b60943'UTR-37,60,0001290,6019 hsa-miR-378d60943'UTR-30,90,0005676,6720 hsa-miR-3841375CDS-24,20,0005576,8220 hsa-miR-4795-3p3670CDS-28,70,0005974,5422MMP2hsa-miR-12052025'UTR-31,70,0004977,6920 hsa-miR-1541231CDS-35,50,0002780,1322 hsa-miR-212495'UTR-380,0002581,7221 hsa-miR-3130-5p1205'UTR-38,80,0005476,0721 hsa-miR-320226073'UTR-32,60,0004176,8822 hsa-miR-4665-3p1265'UTR-54,10,0001875,8726 hsa-miR-4665-5p334CDS-43,70,0004974,7023MMP9hsa-miR-3186-5p1109CDS-38,10,0003478,2322 hsa-miR-4443442CDS-29,40,0003782,1217 hsa-miR-45302142CDS-36,60,0004380,2618MSH6hsa-miR-1279964CDS-25,20,0001689,3617 hsa-miR-141*1718CDS-33,50,0004276,8322 hsa-miR-45272813CDS-34,30,0004276,7322 hsa-miR-4787-5p249CDS-46,90,0003777,6422MTHFRhsa-miR-126063143'UTR-38,70,0001390,4218 hsa-miR-426936513'UTR-42,50,0002880,9521 hsa-miR-445632543'UTR-29,50,0003183,5617 hsa-miR-4665-5p42523'UTR-43,10,0005773,6723 hsa-miR-513b24663'UTR-30,30,0005275,3722 hsa-miR-513c24663'UTR-32,20,0004177,0322 hsa-miR-7201725CDS-37,50,0002386,4017MUTYHhsa-miR-331-5p1252CDS-38,80,0003777,622 hsa-miR-42781596CDS-31,90,0004479,9418PIK3CAhsa-miR-4787-5p115'UTR-47,70,0003178,9722PMS1hsa-miR-44643170CDS-29,80,0002980,5421 hsa-miR-4746-3p565'UTR-44,60,0002681,3821
Продолжение таблицы 11
ГенымикроРНКПозиция сайта, нУчасток мРНКΔG
(kcal/mol)P<ΔG/ΔGm, %L mir, н PMS1hsa-miR-92912CDS-31,60,0004275,5923PMS2hsa-miR-12791497CDS-23,40,0003382,9717 PTENhsa-miR-3187-5p10075'UTR-41,70,0004774,8623hsa-miR-3195695'UTR-39,50,0002485,8617hsa-miR-36765145'UTR-33,90,0004877,7520hsa-miR-3677-5p8025'UTR-400,0005475,0422hsa-miR-44724955'UTR-31,70,0003382,3318PTPN12hsa-miR-1279927CDS-24,40,0002286,5217 hsa-miR-4711-3p24383'UTR-28,90,0004579,8318 hsa-miR-548m2352CDS-25,40,0005376,2721SMAD4hsa-miR-126844133'UTR-39,30,0003182,7318 hsa-miR-128542903'UTR-35,90,0004177,0322 hsa-miR-197245473'UTR-43,10,0002680,4122 hsa-miR-31953385'UTR-38,20,0003383,0417 hsa-miR-4645-5p56213'UTR-27,40,0004279,6519 hsa-miR-513a-5p66633'UTR-32,20,0002783,8518SRChsa-miR-129-5p20643'UTR-33,40,0005875,5621 hsa-miR-302f29503'UTR-24,40,0001988,0817 hsa-miR-320a29233'UTR-38,90,0002481,0422 hsa-miR-320b29233'UTR-39,60,0001485,5222 hsa-miR-320c29243'UTR-35,90,0001885,4720 hsa-miR-320d29263'UTR-31,30,0003880,4619 hsa-miR-4278679CDS-32,90,0003282,4518 hsa-miR-4327554CDS-35,80,0005178,1619 hsa-miR-4436a21283'UTR-36,50,0004477,4921 hsa-miR-446625013'UTR-41,10,0004479,9618 hsa-miR-45211273CDS-35,20,0005674,8922 hsa-miR-46635523'UTR-320,0004774,9423 hsa-miR-56835643'UTR-26,20,0001985,0620TGFBR2hsa-miR-30b*45833'UTR-33,80,0005075,6122 hsa-miR-377*1364CDS-35,60,0003478,2422 hsa-miR-44721165'UTR-31,40,0003681,5518TP53hsa-miR-128522983'UTR-460,0000498,7122 hsa-miR-239215403'UTR-36,50,0004278,6620 hsa-miR-443014183'UTR-34,50,0004579,8618VDRhsa-miR-127526943'UTR-35,40,0002984,2817 hsa-miR-158730663'UTR-41,70,0002383,5620 hsa-miR-42981092CDS-40,60,0005275,3222 hsa-miR-450730663'UTR-41,60,0002981,5620 hsa-miR-4650-5p881CDS-310,0004678,8819VEGFAhsa-let-7i*858CDS-36,70,0005674,8922 hsa-miR-302f23643'UTR-240,0002286,6417 hsa-miR-328615CDS-40,60,0005375,1822 hsa-miR-4483963CDS-32,20,0001987,7317
Продолжение таблицы 11
VEGFAhsa-miR-4488596CDS-44,30,0001787,8918 hsa-miR-520d-3p982CDS-33,30,0004875,8522 hsa-miR-56833103'UTR-24,20,0004378,5720 hsa-miR-760975CDS-39,40,0004079,1120ZEB1hsa-miR-12791131CDS-25,20,0001689,3617 hsa-miR-3613-5p3405CDS-24,30,0003178,8922 hsa-miR-43073328CDS-24,30,0004079,9319 hsa-miR-466361033'UTR-46,10,0001283,6624 hsa-miR-4732-3p3326CDS-36,70,0005276,2921
мРНК изученных генов отличаются по связыванию межгенные микроРНК в 5'UTR, CDS и 3'UTR (таблица 12). Средняя плотность сайтов связывания микроРНК в 5'UTR, CDS и 3'UTR мРНК всех 47 генов составляла 2,80 s/l; 0,77 s/l и 0,69 s/l соответственно. Средняя плотность связывания miRNA в 5'UTR выше, чем в CDS в 3,36 раза и в 4,1 раза больше, чем в 3'UTR. Полученные данные свидетельствуют, что микроРНК могут связываться с 5'UTR и CDS, а не только с 3'UTR. мРНК генов GNAS, PTEN связывают каждая по пять межгенных микроРНК и все только в 5'UTR. мРНК генов CCND1, MTHFR, SMAD4 и SRC связывают межгенные микроРНК предпочтительно в 3'UTR. Это свидетельствует о специфическом взаимодействии микроРНК с мРНК [327].
Канонические сайты взаимодействия подразделяются на три вида (рисунок 6). В нашем исследовании были определены сайты взаимодействия с высоким уровнем комплементарности по всей последовательности микроРНК. Большинство таких сайтов взаимодействия имеют некоторые отличительные характеристики, поэтому не могут быть отнесены к каноническим сайтам. Во первых, эти сайты имеют Г:У пары в seed области - это область от 2 по 8 нуклеотид 5' конца микроРНК [14]. Во вторых, у сайтов, описанных нами, количество неспаренных нуклеотид в центральной области сайта равняется 1 н. на каждой цепи, тогда как в канонических сайтах количество неспаренных нуклеотид обычно превышает 1 н. на каждой цепи. В результате анализа структуры сайтов микроРНК разработана новая классификация сайтов связывания с высокой комплементарностью. Сайты связывания по преимущественному вкладу в энергию взаимодействия участков микроРНК поделены на три типа связывания: 1) 5'-доминантный сайт, где преобладает вклад 5'-участка микроРНК (miR-4455:ABCG2 мРНК и miR-1279:PTPN12 мРНК); 2) 3'доминантный сайт с основным вкладом 3'-участка микроРНК (miR-1972: FLCN мРНК и miR-4455:CD44 мРНК); 3) сайт с центральным доминированием по вкладу микроРНК (miR-1285:TP53 мРНК и miR-320f: APC-1 мРНК). Таблица 12 - Характеристики взаимодействия микроРНК с 47 мРНК [327]
ГенL. генаL. 5'UTR L. CDS L. 3'UTR сайты с p<0.0005s/L.s/5'UTRs/CDSs/3'UTRABCC25051139463827420,400,000,430,00ABCG244314931968197020,454,060,000,00ADAM293325670246319210,301,490,000,00ALCAM47415401752244930,633,700,000,41APC108401938533211420,180,000,120,47AXIN13675389258969761,632,571,930,00AXIN242342892531141440,943,460,401,41BAD9708250738133,0912,203,940,00BAX8106958016111,230,000,006,21BRAF294461230258120,680,000,870,00BUB13502112325913110,290,000,310,00CCND14289209889319161,400,000,001,88CD4445894341087306820,444,610,000,00CDH148151252649204171,4532,000,760,49CTNNB137202682346110610,270,000,000,90DLC174794444587244830,400,000,650,00EGFR56012463633172250,894,061,100,00EPCAM171935894541610,582,790,000,00ENG3060413197767041,314,840,511,49EP30087613957246112030,340,000,410,00FLCN36875041740144371,901,982,301,39FZD73851611725206520,520,001,160,00GNAS1907356118536652,6214,040,000,00GSK3B712198313024636131,825,090,001,72KIT5174872932215530,580,000,680,46KLF12109092221209947840,374,500,830,21KRAS5297181568454820,380,000,000,44MET66761874227226210,150,000,240,00MLH12662198227219241,500,001,760,00MLH378962164363331760,760,000,690,90MMP235493111983125571,9712,861,010,80MMP9238719212424431,260,001,410,00MSH6432815240849240,920,000,980,00MTHFR71502291972494970,980,000,511,21MUTYH194521616507921,030,001,210,00PIK3CA3712157320734810,276,370,000,00PMS13538529279921030,851,890,710,00PMS2283687258916010,350,000,390,00PTEN557210311212332950,904,850,000,00PTPN12322591234379130,930,000,851,26SMAD487695381660657160,681,860,000,76SRC409744916122036133,170,001,864,91TGFBR247043821779254330,642,620,560,39TP5325861971182120731,160,000,002,49VEGFA36634981239192682,180,004,841,04VDR50604011434322550,990,001,390,93ZEB162683913327255150,800,001,200,39Ср. знач4619,68310,682424,791874,983,940,992,800,770,69Обозначения s/l, s/5'UTR, s/CDS, s/3'UTR - отношение числа сайтов (s) к длине нуклеотидной последовательности этих участков умноженное на 103 (s/l) Следовательно, преимущественный вклад в энергию взаимодействия микроРНК с мРНК могут вносить все участки микроРНК. Первый вид взаимодействия имеет полную комплементарность в 5'конца и имеет не спаренные нуклеотиды с 3'конца микроРНК. Второй вид сайтов микроРНК имеет мисматчи в 5'конце микроРНК. Третий вид взаимодействия характеризуется неспаренными нуклеотидами с обоих концов сайта. Схемы взаимодействия для некоторых генов представлены в таблице 13, где наглядно представлена степень комплементарности пар микроРНК и мРНК-мишени в описанных сайтах. В рузультате изучения сайтов связывания микроРНК и их характеристик были опубликованы ряд статей и тезисов [326-345]. Таблица 13 - Схемы взаимодействия микроРНК с мРНК мишенями
мРНК FLCN 5' G C 3'
UGAGCCACUGUGCCUGGCC ACUCGGUGACACGGACCGG miRNA-1972 3' ACU5'мРНК TP53 5'U C3'
GGGUCUCGCUUUGUUGCCCAGG UCCAGAGUGAAACAACGGGUCU miR-1285 3' 5' 3'UTR,3374 ΔG = -48,2 ΔG/ΔGm = 89,93'UTR,2298 ΔG = -46,0 ΔG/ΔGm = 98,7APC 5'A U A3'
UGUGGC GUGAAAUUCACAGUA ACACUG CACUUUAAGUGUCAU miR-4693-5p 3' U A5'TP53 5'A C C 3'
GCCUC CACCCCCAUCU UGGAG GUGGGGGUAGG miR-2392 3'G A AU 5'3'UTR,9172ΔG = -37,0 ΔG/ΔGm = 89,83'UTR,1540ΔG = -36,5 ΔG/ΔGm = 78,7мРНК PTPN12 5' C A 3'
AAAGGAGCAAUAUGA UUUCUUCGUUAUACU miR-1279 3' UC 5'мРНК APC 5' G G 3'
GGACAUGGGGGCAGUUA UUUGUACCUUCGUUAAU miR-302f 3' 5'CDS,927 ΔG = -24,4 ΔG/ΔGm = 86,5CDS,2287 ΔG = -27,6 ΔG/ΔGm = 99,6AXIN1 5'A A 3'
GGGACAGGGAAGGGCAU CUUUGUCCUUUUUUGUA miR-4307 3'C A 5'ABCC2 5' C A 3'
UCUGCUUCGGAAAUCCA GGACGAGGUUUUUAGGU miR-1246 3' AA 5'CDS,1072ΔG = -26,0 ΔG/ΔGm = 85,5CDS,4484ΔG = -29,1 ΔG/ΔGm = 82,4мРНК CD44 5' C G C 3'
GGAGGCACA GCACCC UUUUUGUGU UGUGGG miR-4455 3' G A 5'мРНК ABCG2 5' C G 3' GAGCGCACGCAUCCU UUUGUGUGUGUGGGA miR-4455 3' UU 5'5'UTR,46 ΔG = -26,9 ΔG/ΔGm = 84,95'UTR,416 ΔG = -28,0 ΔG/ΔGm = 88,3CDH1 5' C A 3'
UCCAGCCCGGCCCGACCCG GGGUCGGGUCGGGUUGGGU miR-4507 3' C 5'PTEN 5'C C 3'
GGCGGCACCUCCCGCU UUGUUGUGGGGGGUGG miR-4472 3'UU 5'5'UTR,62ΔG = -46,4 ΔG/ΔGm = 91,05'UTR,495ΔG = -31,7 ΔG/ΔGm = 82,3Энергия взаимодействия (ΔG) - kcal/mol; ΔG/ΔGm значение - %
3.4 Характеристика взаимодействия микроРНК с генами мишенями
С помощью программы UNAFold.3.7 (http: // dinamelt.bioinfo.rpi.edu) были построены 2D структуры мРНК 13 генов мишеней микроРНК (ABCC2, ABCG2, ALCAM, APC, AXIN1, BAX, CDH1, FLCN, MLH3, MMP2, PTPN12, SRC, TP53). На вторичной структуре мишеней была изучена характеристика взаимодействия микроРНК с мРНК-мишенью. Как показано на рисунке 2, микроРНК взаимодействует с неспаренными нуклеотидами мРНК с 5' или 3'конца микроРНК. Это позволяет разрушить уотсон-криковское взаимодействие в 2D структуре мРНК для образования взаимодействия между микроРНК и мРНК. Неспаренные нуклеотиды мРНК служат затравкой для образования связи между микроРНК и мРНК. Из приведенных примеров видно, что затравкой может быть как 5' так и 3'конец микроРНК. В сайте для miR-21* в мРНК гена ALCAM затравкой служит взаимодействие 5'конца микроРНК с неспаренными нуклеотидами вторичной структуры мРНК (рисунок 9). А в сайте взаимодействия miR-1279 с мРНК гена ALCAM затравкой образования связи служит взаимодействие между 3'концом микроРНК со свободными нуклеотидами мРНК (рисунок 9). Так как программа RNAhybrid предсказывает сайты на основе вторичной структуры мишени и микроРНК было обнаружено, что во всех изученных случаях микроРНК взаимодействует с неспаренными нуклеотидами вторичной структуры мишени.
Копмлементарные участки представлены непрерывной чертой, ондонуклеотидные мисматчи точкой, несколько некомплементарных нуклеотида в сайте связывания точкой-тире.
Рисунок 9 - мРНК с двумя сайтами микроРНК
Как видно из примеров генов CDH1 и ALCAM одна мРНК может связываться с несколькими микроРНК с высоким уровнем комплементарности (рисунки 9 и 10). Если микроРНК связываются с одной областью мРНК, то они конкурируют за область взаимодействия. miR-1587 и miR-4507 взаимодействуют в одном сайте с мРНК CDH1, то есть сайты перекрываются и конкурируют за мишень мРНК (рисунок 10). Тогда как в других мРНК есть сайты связывания для нескольких микроРНК в разных областях мРНК. Например, сайты связывания для miR-21* и miR-1279 в мРНК гена ALCAM (рисунок 9).
Комплементарные участки представлены непрерывной чертой, ондонуклеотидные мисматчи точкой, несколько некомплементарных нуклеотида в сайте связывания точкой-тире.
Рисунок 10 - мРНК с перекрывающими сайтами микроРНК Из рассмотренных 63 сайтов в мРНК 13 генов 27% 5'-доминантных сайтов, 43% сайтов с центральным доминированием, 30% 3'-доминантных сайтов. На рисунках 9, 10, 11 можно найти сайты всех трех видов. Взаимодействия miR-21*:ALCAM, miR-1587:CDH1, miR-4508:FLCN1 являются сайтами с доминирующим 5'-концом микроРНК. Сайты miR-212:MMP2, miR-4472:ABCG2 являются сайтами с доминированием центрального участка микроРНК (рисунок 11). К 3'-доминирующим сайтам относятся сайты следующих пар: miR-1279:AlCAM, miR-4507:CDH1. Несмотря на то, какая часть микроРНК вносит больший вклад в энергию взаимодействия из рассмотренных примеров видно, что в основном затравкой для образования связи между микроРНК и мРНК служит 5' конец микроРНК. По итогам исследования была опубликована одна публикация [346].
Копмлементарные участки представлены непрерывной чертой, ондонуклеотидные мисматчи точкой, несколько некомплементарных нуклеотида в сайте связывания точкой-тире.
Рисунок 11 - Характеристика взаимодействия микроРНК с генами мишенями
Изучение распределения сайтов микроРНК в зависимости от длины микроРНК показало, что основная доля сайтов приходится на микроРНК длиной 22 нуклеотида. Пять микроРНК с длинной 16 нуклеотид не имеют сайтов связывания при установленных критериях взаимодействия. Из рисунка 12 видно, что микроРНК с короткой длиной имеют большое количество сайтов. Это связано с длиной микроРНК, потому что для отбора сайтов для микроРНК длиной 17 нуклеотид энергия гибридизации должна составлять 82,5% от максимальной энергии гибридизации, а для микроРНК длиной 27 нуклеотид 70%. Для длинных микроРНК критерий отбора были выше, так как основной задачей исследования было определение сайтов с высокой комплементарностью. Поэтому микроРНК с длиной выше 22 нуклеотид при установленных критериях имеют ограниченное количество сайтов. Только 10% сайтов составляют микроРНК с длиной от 23 до 27 нуклеотидов. Максимальное количество сайтов приходится на микроРНК длиной 22 нуклеотида, что соответствует отношению количества межгенных микроРНК.
Рисунок 12 - Распределение сайтов связывания в зависимости от длины микроРНК
3.5 Изучения различий между сайтами, предсказанных с помощью программ RNAhybrid и TargetScan
В следующем этапе исследования сайты, которые были найдены при помощи программы RNAhybrid, были сравнены с сайтами, которые предсказывает программа TargetScan 6.2 (www.targetscan.org). Отличительной особенностью сайтов отобранных нами по программе RNAhybrid является их высокая комплементарность во всей области взаимодействия, ранее ни в одной исследовательской работе не было показано наличие таких сайтов. Поэтому мы хотим проверить эффективность предсказывания сайтов с высокой комплементарностью с помощью программы TargetScan. Программа TargetScan разработана группой ученых под руководством Давида Бартела из Howard Hughes медицинского университета Америки и признана одной из широко используемых программ с низким уровнем предсказания ложно позитивных сайтов взаимодействия микроРНК [15]. Сравнения проведено для сайтов связывания микроРНК с мРНК генов CDH1, GSK3B, MLH3, MTHFR, PTPN12, SMAD4, SRC, TP53, ZEB1. В таблице 14 представлены сайты связывания микроРНК предсказанные программой RNAhybrid и TargetScan. Все сайты, которые имеют хоть одну Г:У пару в сайте связывания не предсказываются программой TargetScan. В таблице жирным шрифтов помечены сайты без Г:У пар в 'seed' районе, которые определены в одной области мРНК мишеней, но за счет специфических свойств алгоритма программы TargetScan не определена биологическая значимость этих сайтов. То есть комплементарность сайтов взаимодействия, которая в описанных сайтах близка к полной. Для сайтов между miR-1285:TP53, miR-4663:ZEB1, miR-4732-3p:GSK3B, miR-4710:GSK3B, miR-4711-3p:PTPN12 программа TargetScan не определила комплементарные пары в 3'конце микроРНК. Определение сайта микроРНК в мРНК гена TP53, во всех остальных сайтах, представленных в таблице 14, программа TargetScan не нашла сайты, которые ранее были предсказаны программой RNAhybrid и предлагает свои варианты сайтов в другой области мРНК. В базе TargetScan все сайты в зависимости от филогенетической консервативности подразделены на три группы: сайты консервативные у позвоночных, сайты консервативные у млекопитающих, сайты с низкой консервативностью. Все сайты, представленные в таблице 14, получены из он-лайн базы TargetScan, определены как сайты с низкой консервативностью. То есть экспериментально биологическая значимость этих сайтов в регуляции генов мишеней будет определяться в последнюю очередь, так как первый критерий для отбора сайтов для экспериментальных исследований основан на филогенетической консервативности сайтов.
Некоторые канонические сайты с высокой комплементарностью не предсказываются с помощью программы TargetScan. В таблице 15 представлены несколько сайтов, которые не были найдены при помощи программы TargetScan. Анализ структуры канонических сайтов выявил, что сайты с некомплементарными нуклеотидами мишени ко второй и третьей позиции 5'конца микроРНК (SMAD4:miR-1972; TP53:miR-2392) не определяются данной программой. Программа находит только канонические сайты: 5'-доминантный канонический сайт, сайт с 5'-доминантной seed областью и 3'-компенсаторным сайт (рисунок 6). Можно сделать вывод, что локализация seed является одним из основных критериев отбора сайтов в алгоритме программы TargetScan. Во вторых, сайты с очень высокой уровенью комплементарности, но с Г:У парами в seed области не определяются данной программой (SMAD4:miR-1268, SRC:miR-302f). Исходя из этого можно сделать вывод, что наличие Г:У пар в seed области также является критерием отбора. Все эти данные свидетельствуют о преимуществе разработанной в нашей лаборатории методики отбора сайтов связывания. Методика позволяет отобрать сайты взаимодействия микроРНК с высоким уровнем комплементарности, то есть близких по свойствам к siRNA. Таблица 14 - Сайты предсказанные RNAhybrid и TargetScan
RNAhybridTargetScan (Poorly conserved miRNA Families)CCND1:hsa-miR-4487
target 5' G G A 3'
GCCCU CAGCCAGCUC CGGGA GUCGGUCGAG miRNA 3' GA A A 5'5' ...CCAACGGCCCUGCAGCCAGCUCA...
||||| ||||||| 3' GACGGGAAGUCGGUCGAGA3-utr,2022ΔG = -37.6kcal/mol 8mer, 3-utr,937CCND1:hsa-miR-3180-5p
target5'U A A G3'
GGC GUGG GGUGGGGUGUUUGGGAG CUG CACC CCGCCUCGCAGACCUUC miRNA 3'G 5'5' ...AUGAUUGGAAUAGCUUCUGGAAU...
||||||| 3' GCUGCACCCCGCCUCGCAGACCUUC 5' ...GUGAGAAAAAAACAAUCUGGAAG...
||||||| 3' GCUGCACCCCGCCUCGCAGACCUUC3-utr,2250ΔG = -45.1kcal/mol3-utr,2578; 3-utr,1602CDH1:hsa-miR-1285
target 5' G A A 3'
GGGUCUUGCU UGUUGCCCA UCCAGAGUGA ACAACGGGU miRNA 3' A CU 5'5' ...AUGAGCCACUGCACCUGCCCAGC...
|||| ||||||| 3' UCCAGAGUGAAACA-ACGGGUCU
5' ...GGGCAUGAGCUGCUGUGCCCAGC...
||||||| 3' UCCAGAGUGAAACAACGGGUCU3-utr,3677ΔG = -36.7kcal/mol 750, 1009MLH3:hsa-miR-378b
target 5' C C G 3'
UCUGCCUCCAGG CCAGU AGACGGAGGUUC GGUCA miRNA 3' A A 5'5' ...AUGGCAAAAAGGUGGGUCCAGAA...
|||||| 3' AAGACGGAGGUUCAGGUCA3-utr,6094ΔG = -37.6kcal/mol3-utr,3228MTHFR:hsa-miR-1260
target 5' A U G 3'
GGUGGC GAGGUGGGA CCACCG CUCCACCCU miRNA 3' A U A 5'5' ...UACUCAGGUGGCUGAGGUGGGAG...
|||||| ||||||| 3' ACCACCGUCUCCACCCUA
3-utr,6314ΔG = -38.7kcal/mol 7mer-m8, 3-utr,4130MTHFR:hsa-miR-4665-5p
target 5' U C 3'
CUUGUGCUCACGC UCCCCCG GAGCGCGAGUGCG AGGGGGU miRNA 3' C C C 55' ...AGAUUCCUGGGCCUGUCCCCCAA...
||||||| 3' CGAGCGCGAGUGCGCAGGGGGUC
5' ...CACCCCGGCCUCCAC--UCCCCCAC...
||| ||||||| 3' CGAGCGCGAGUGCGCAGGGGGUC3-utr,4252ΔG = -43.1kcal/mol 3-utr, 2188; 3-utr,116TP53:hsa-miR-1285
target 5' U C 3'
GGGUCUCGCUUUGUUGCCCAGG UCCAGAGUGAAACAACGGGUCU miRNA 3' 5'5' ...UGGGUCUCGCUUUGUUGCCCAGG...
||||||||||||| 3' UCCAGAGUGAAACAACGGGUCU
3-utr,2298ΔG = -46.0kcal/mol 7mer-m8,3-utr,1004
Продолжение таблицы 14
RNAhybridTargetScan (Poorly conserved miRNA Families)ZEB1:hsa-miR-4663
target 5' U A 3'
UUGCAUGUUUAUGGAGCUCAGCU GACGUGCAGGUACCUCGAGUCGA miRNA 3' U 5'5' ...UUGCAUGUUUAUGGAGCUCAGCU...
|||||||||||| 3' UGACGUGCAGGUACCUCGAGUCGA3-utr,6103ΔG = -46.1kcal/mol 7mer-m8, 3-utr, 2407 GSK3B:hsa-miR-4710
target 5' A U 3'
ACUUGCCCUCACCC UGGACGGGAGUGGG miRNA 3' UUGG 5' 5' ...UAAUAAUAAAAAGCUCCUCACCA...
||||||| 3' UUGGUGGACGGGAGUGGG 5' ...UUGUGUGUAACUUGCCCUCACCC...
||||||| 3' UUGGUGGACGGGAGUGGG3-utr,4046ΔG = -34.6kcal/mol 3-utr, 2573; 7mer-m8, 3-utr,1772 GSK3B:hsa-miR-4732-3p
target 5' A G A 3'
GGAA GGGACAGGUCAGGG UCUU UCCUGUCCAGUCCC miRNA 3' G G G 5'5' ...AGAGGAAGGGGACAGGUCAGGGA...
||||||||||||| 3' GUCUUGUCCUGUCCAGUCCCG3-utr,3170ΔG =-41.0kcal/mol8mer,3-utr,901 PTPN12:hsa-miR-4711-3p
target 5' G U 3'
GAGCUAGAAGACAC UUCGGUCUUCUGUG miRNA 3' UAG C 5'5' ...NNNUUCAGGGAGCUAGAAGACACU...
||||||| 3' UAGUUCGGUCUUCUGUGC3-utr,2438ΔG =-28.9 kcal/mol7mer-m8, 3-utr,14 Жирным шрифтов обозначены сайты обнаруженные в одной области мРНК.
Таблица 15 - Потенциальные сайта не найденные программой TargetScan
Сайты с высокой комплементарностью Сайты без Г:У пар в 'seed' областиSMAD4hsa-miR-12683-utr,4413ΔG = -39.3kcal/mol target 5' G G 3'
CCCGCCACCAUGCCUG GGGUGGUGGUGCGGGC miRNA 3' GG 5'SMAD4hsa-miR-513b3-utr,6663ΔG = -25.7 kcal/mol target 5' A C G 3'
GACACUUUC UGUGAA CUGUGGAGG ACACUU miRNA 3' UAUUUA A 5'SRChsa-miR-302f3-utr,2950ΔG = -24.4kcal/mol target 5' C A 3'
AGCAUGGAGGCAG UUGUACCUUCGUU miRNA 3' U AAU 5'SMAD4hsa-miR-19723-utr,4547ΔG = -43.1kcal/mol target 5' G C C 3'
UGAGCCACUGU CCUGGCCU ACUCGGUGACA GGACCGGA miRNA 3' C CU 5'VDRhsa-miR-45073-utr, 3066ΔG = -41.6 kcal/mol
target 5' G G 3'
CCAGCCCAGCCCAGCU GGUCGGGUCGGGUUGG miRNA 3' G GUC 5'TP53hsa-miR-23923-utr,1540ΔG = -36.5kcal/mol target 5' A C C 3'
GCCUC CACCCCCAUCU UGGAG GUGGGGGUAGG miRNA 3' G A AU 5'GSK3Bhsa-miR-42653-utr, 4020ΔG =-38.2kcal/mol 83.22
target 5' G U 3'
CAGAGCUGAGCCCAUGG GUCUCGACUCGGGUGUC miRNA 3' GG 5'GSK3Bhsa-let-7astar3-utr,6823ΔG = -26.6 kcal/mol75.56
target 5' A U C 3'
AAGGAC GUGGGUUGUAUA UUUCUG CAUCUAACAUAU miRNA 3' C U C 5' Используя выравнивание 3'UTR мРНК разных организмов, представленной в базе TargetScan, изучена филогенетическая консервативность сайтов связывания микроРНК локализованных в 3'UTR. Для семи мРНК были обнаружены сайты, предсказанные обеими программами в одной области мРНК мишени, но программа TargetScan во всех случаях не смогла показать все комплементарные пары в сайте взаимодействия. Для всех этих сайтов была изучена консервативность сайтов микроРНК среди различных видов. Если программой TargetScan определяется консервативность "seed" области (от 2 по 8 нуклеотид 5'конца микроРНК), мы изучили консервативность всей последовательности сайта, чтобы проверить уникальность таких сайтов для человека. В таблице 16 представлены данные по консервативности сайтов в 3'UTR. Для трех изученных сайтов выявлена консервативность в одном геноме, во всех случаях для Pаn troglodytes (шимпанзе): GSK3B - miR-4732-3p, MTHFR - miR-1260, TP53 - miR-1285. Другие три сайта консервативны в двух геномах (у шимпанзе и кролика или у шимпанзе и галаго: CCND1 - miR-4487, PTPN12 - miR-4711-3p, ZEB1 - miR-4663. Сайт для miR-4710 в гене GSK3B был консервативен у шимпанзе, макаки-резуса и кролика. То есть, все эти сайты имеют низкую консервативность и не уникальны для генома человека. Таблица 16 - Консервативность сайтов в 3'UTR
Локализация сайтаНуклеотидная последовательность сайта взязыванияСайт в 3'UTR CCND1 для miR-4487 ......930........940.......950.......960..
hsa AACGGCCCUGCAGCCAGCUCACGUCCAGGUUCAACCCACAG
ptr AACGGCCCUGCAGCCAGCUCACGUCCAGGUUCAACCCACAG
oga AGUGGCCCUGCAGCCAGCUCACGUCCCGGUUCAACCCACAGСайт в 3'UTR ZEB1 для miR-4663 .....2380......2390......2400......2410..
hsa UUGAAUAAAAAUAUAAUUUGCAUGUUUAUGGAGCUCAGCUA
ptr UUGAAUAAAAAUAUAAUUUGCAUGUUUAUGGAGCUCAGCUA
ocu UAGAAUGACAUUACAAUUUGCAUGUUUAUGGAGCUCAGCUGСайт в 3'UTR PTPN12 для miR-4711-3p 1.......10.........20
hsa UUCAGGGAGCUAGAAGACACU
ptr UUCAGGGAGCUAAAAGACACU
ocu UUCAGGGAGCUAAAAGACACU
Сайт в 3'UTR GSK3B для miR-4710 .....1770......1780......1790. hsa AACUUGCCCUCACCCUCCUCAUUGCCACC
ptr AACUUGCCCUCACCCUCCUCAUUGCCACC
mml AACUUGCCCUCACCCUCCUCAUUGCCACC
ocu AACUUGCCCUCACCCUCCUCAUUGCCACCСайт в 3'UTR GSK3B для miR-4732-3p .......890.......900.....
hsa CCCAGAGGAAGGGGACAGGUCAGGG
ptr CCCAGAGGAAGGGGACAGGUCAGGGСайт в 3'UTR TP53 для miR-1285 980.......990.......1000......1010.
hsa CUUUGAGACUGGGUCUCGCUUUGUUGCCCAGGCUG
ptr CUUUGAGACUGGGUCUCGCUUUGUUGCCCAGGCUGСайт в 3'UTR MTHFR для miR-1260 4110......4120......4130......4140
hsa UCAGCUACUCAGGUGGCUGAGGUGGGAGGAUCGU
prt UCAGCUACUGAGGUGGCUGAGGUGGGAGGAUCGU
3.6 Изучения различий между сайтами, предсказанных с помощью программ RNAhybrid и miRanda На следующем этапе исследования сайты, предсказанные программой RNAhybrid, были сравнены с сайтами, которые предсказывает программа miRanda v3.3a. Как было показано в обзоре, miRanda v3.3a является программой, основанной на уровне комплементарности в "seed" области. Сайты предсказанные этой программой представлены в базе данных www.microrna.org. Сайты, предсказанные miRanda v3.3a отбираются по параметру score, минимальное требование 120. Далее сайты отбираются по скору, вычисленному по алгоритму mirSVR (support vector regression). Минимальное требование для отбора 6mer (2-7 нуклеотиды) seed с одной Г:У парой или одним мисматчем. Таблица 17 - Сайты, предсказанные RNAhybrid и miRanda с лучшим параметром score
RNAhybrid miRandaAPC 5' G G 3'
GGACAUGGGGGCAGUUA UUUGUACCUUCGUUAAU miR-302f 3' 5'
CDS,2287-27.6 kCal/MolmiR-302f: 3' uuUGUACCUUCGUUAAu 5'
||||||::|||:|| APC: 5' ggACATGGGGGCAGTTa 3'
Score: 139.00-23.11 kCal/MolBAD 5' G C3'
GGAAGCUCCGCCCC CCUUCGAGGCGGGG miR-3180-3p 3'CCGGAGG U5'
14mer,CDS,565-38.1 kCal/MolmiR-3180-3p:3'ccggaggCCUUCGAGGCGGGGu 5'
|||||||||||||| BAD: 5'gggcaggGGAAGCTCCGCCCCc 3'
Score:175.00-38.32 kCal/MolDLC1 5' U A 3'
GGACGACAUCCUCUACC UUUGUUGUGGGGGGUGG miR-4472 3' U 5'
5mer,CDS,3158-31.4 kCal/MolmiR-4472: 3' uuUUGUUGUGGGGGGUGg 5'
:||:|||:||:|:|| DLC1: 5' tgGACGACATCCTCTACc 3'
Score:136.00-27.76 kCal/MolFLCN 5' G A A 3'
CGUGCGC CAGCCCCGC GCGCGCG GUCGGGGCG miR-4508 3' G 5'
9mer,CDS,678-40.3 kCal/MolmiR-4508: 3' gcGCGCGGGUCGGGGCg 5'
:|||| |||||||| FLCN: 5' cgTGCGCACAGCCCCGc 3'
Score:163.00-36.41 kCal/MolFLCN 5' G C 3'
GCUGUGGGAGCUGGCAG UGACACCUUCGACCGUC miR-4727-5p 3' GG UA5'
9mer,CDS,1503-39.3 kCal/MolmiR-4727-5p:3' ggUGACACCUUCGACCGUCua5'
:||||||:||||||||| FLCN: 5' agGCTGTGGGAGCTGGCAGcc3'
Score:167.00 -34.69 kCal/MolFZD7 5' A C 3'
GGCGGCGGCCCCACUG UUGUCGUCGGGGUGAC miR-194* 3' GUCUA C 5'
9mer,CDS,577-36.9kCal/MolmiR-194*: 3' gtctaTTGTCGTCGGGGTGACc 5'
::|:||:||||||||| FZD7: 5' gcccaGGCGGCGGCCCCACTGc 3'
Score:169.00 -33.48 kCal/Mol KIT 5' U G U3'
GUGGACCAGGA GGCAAG CACCUGGUCCU CCGUUC miR-4776-3p3'UACGU A 5'
6mer,CDS,648-37.9 kCal/MolmiR-4776-3p:3'uacGUCACCUGGUCCUACCGUUc5'
| ||||||||||| ||||| KIT: 5'gttCTGTGGACCAGGAGGGCAAg3'
Score:160.00-36.48 kCal/MolMLH3 5' G C G 3'
GAGCAAUUUC AGGAA CUUGUUAAAG UCCUU miR-384 3'AUA A A 5'
5mer, CDS,1375-24.2 kCal/MolmiR-384: 3' auaCUUGUUAAAGAUCCUUa 5'
||:||||||| ||||| MLH3: 5' gagGAGCAATTTCCAGGAAg 3' Score:149.00-19.39 kCal/MolMLH3 5' A G C 3'
CAAGGCAGA CCUGCAG GUUUCGUUU GGACGUC miR-1205 3' GA G U 5'
7mer,CDS, 4527-31.3 kCal/MolmiR-1205: 3' gaGUUUCGUUUGGGACGUCu 5'
|||:|||:| ||||||| MLH3: 5' taCAAGGCAGAGCCTGCAGc 3'
Score:174.00-28.29 kCal/MolMMP2 5' G G G 3'
CGCGCUCACG GUCCCCU GCGCGAGUGC CAGGGGG miR-4665-5p3'CGA G UC5' 7mer,CDS,334-43.7 kCal/MolmiR-4665-5p:3'cgaGCGCGAGUGCGCAGGGGGUc5'
|||||||||| ||||||:: MMP2: 5'gggCGCGCTCACGGGTCCCCTGa3'
Score:160.00-42.10 kCal/MolMMP9 5' G U 3'
GCUCCCGUCCUGCU CGAGGGCAGGACGA miR-4530 3'G CCC 5'
14mer,CDS,2142-36.6 kCal/MolmiR-4530: 3' gcGAGGGCAGGACGAccc 5'
||||||||||||| MMP9: 5' ggCTCCCGTCCTGCTttg 3'
Score:140.00-33.65 kCal/Mol Для сравнения сайтов была использованы сайты, локализованные в кодирующей области. На он-лайн ресурсе представлены только сайты, расположенные в 3'нетранслируемой области мРНК. Для поиска сайтов была использована локальная программа miRanda v3.3a. Были изучены сайты связывания локализованные в CDS мРНК 14 генов мишеней (ABCC2, APC, AXIN1, BAD, DLC1, FLCN, FZD7, KIT, KLF12, MET, MLH1, MLH3, MMP2, MMP9).
В таблице 17 представлены сайты, которые по программе miRanda имеют лучшее значение score для изученной микроРНК в каждой из мРНК мишеней. Данные свидетельствуют, что обе программы могут предсказывать с одинаковой эффективностью все канонические (6-8mer seed - 2-8 нуклеотиды, без Г:У пар) и неканонические сайты. Таблица 18 - Сайты предсказанные программами RNAhybrid и miRanda RNAhybrid miRanda ABCC2 5' C A 3'
UCUGCUUCGGAAAUCCA GGACGAGGUUUUUAGGU miR-1246 3' AA5'
7mer,CDS,4484-29.1 kCal/MolmiR-1246: 3' ggACGAGGUUUUUAGGUaa 5'
||||:|::||||||| ABCC2: 5' tcTGCTTCGGAAATCCAag 3'
Score:153.00 -24.99 kCal/Mol AXIN1 5' A A 3'
GGGACAGGGAAGGGCAU CUUUGUCCUUUUUUGUA miR-4307 3' C A 5'
CDS,1072-26.0 kCal/MolmiR-4307: 3' ccUUUGUCCUUUUUUGUAa 5'
::|||||:||:::||| AXIN1: 5' agGGACAGGGAAGGGCATa 3'
Score:125.00-22.63 kCal/MolDLC1 5' A U G 3'
GAAGC GGGAAGAACAU CUUUG CCUUUUUUGUA miR-4307 3' C U A 5'
5mer,CDS,466-23.9 kCal/MolmiR-4307: 3' ccUUUGUCCUUUUUUGUAa 5' ||:| ||:||:||||| DLC1: 5' agAAGCTGGGAAGAACATg 3'
Score:153.00-19.52 kCal/MolKLF12 5' A C 3'
CCUGGGAAGGCUG GGACCCUUUUGAC miR-4328 3' UUA C5'
CDS,1269-27.5 kCal/MolmiR-4328: 3' uuaGGACCCUUUUGACc 5'
||||||||::||| KLF12: 5' gtaCCTGGGAAGGCTGc 3'
Score:138.00-24.56 kCal/Mol MET 5'U U 3'
GAAGCAGGAAGGAAC CUUUGUCCUUUUUUG miR-4307 3'C UAA 5'
CDS,2579-24.7 kCal/MolmiR-4307: 3' ccUUUGUCCUUUUUUGUAa 5'
||:||||||::||| | MET: 5' tgAAGCAGGAAGGAACTTt 3'
Score:117.00-20.34 kCal/MolMLH1 5' G G A 3'
ACCCUCUCAG CCAGC UGGGAGAGUU GGUCG miR-320c 3' G AAAA 5'
CDS,2281-34.7 kCal/MolmiR-320c: 3' ugGGAGAGUUGGGUCGaaaa 5'
|||||||: ||||| MLH1: 5' acCCTCTCAGGCCAGCagag 3'
Score:118.00-29.15 kCal/MolMMP9 5' U C 3'
GCCCGCGCCUUCG UGGGUGCGGAGGU miR-4443 3' UUU U 5'
7mer,CDS,442-29.4 kCal/MolmiR-4443: 3' uuuUGGGUGCGGAGGUu 5'
:|||:|||||:|: MMP9: 5' tttGCCCGCGCCTTCGc 3'
Score:130.00-25.10 kCal/Mol Отбор сайтов в программе miRanda основан на значении Score, который зависит от количества комплементарных нуклеотидов в сайте и наличия комплементарных пар в seed области. Поэтому некоторые сайты с высоким значением энергии гибридизации и уровнем комплементарности, но большим количеством Г:У пар и с наличием неспаренных нуклеотидов в "seed" области имеют низкое значение score. Все сайты, представленные в таблице 18, имеют не лучшее значение score для этих микроРНК, то есть существуют сайты с более высоким значением score для этих пар (микроРНК-мРНК), но более низким значением энергии гибридизации и уровнем комплементарности. Как показало исследование, miRanda может находить все потенциальные сайты, которые ранее были предсказаны программой RNAhybrid. Как упоминалось выше сайты, предсказанные программой miRanda, размешены на сайте www.microrna.org Центра Вычислительной Биологии (The Computational Biology Center at Memorial Sloan-Kettering Cancer Center). Все сайты, предсказанные программой miRanda, далее отбираются по алгоритму mirSVR, который вычисляет свой score для каждого сайта в зависимости от экспрессии микроРНК и мРНК мишени. Таблица 19 - Сайты, представленные на сайте www.microrna.org
RNAhybridmiRandaMTHFR:hsa-miR-1260
target 5' A U G 3'
GGUGGC GAGGUGGGA CCACCG CUCCACCCU miRNA 3' A U A 5' 3' acCACCGUCUCCACCCUa 5' miR-1260
||||| ||||||||| 4120:5' agGUGGCUGAGGUGGGAg 3' MTHFR
mirSVR score:-0.0097
PhastCons score:0.51713-utr,6314ΔG = -38.7kcal/mol TP53:hsa-miR-1285
target 5' U C 3'
GGGUCUCGCUUUGUUGCCCAGG UCCAGAGUGAAACAACGGGUCU miRNA 3' 5' 3'ucCAGAGUGAAACAACGGGUCu 5' miR-1285
|||||:||||||||||||| 789:5'ggGUCUCGCUUUGUUGCCCAGg 3' TP53
mirSVR score:-0.0248
PhastCons score:0.51443-utr,2298ΔG = -46.0kcal/mol На следующем этапе изучена доступность сайтов в базе www.microrna.org, предсказанных программой miRanda. Для этого был проведен поиск 11 сайтов, расположенных в 3'UTR. Выявлено, что сайт miR-3180-5p в мРНК CCND1, сайт miR-1285 в мРНК CDH1, miR-378b в мРНК MLH3 не представлены он-лайн базе из-за низкого показателя mirSVR score. Сайты для miR-4487, miR-4665-5p, miR-4663, miR-4710, miR-4732-3p, miR-4711-3p нет в базе, потому что эти микроРНК не включены на данный момент в базу данных. База www.microrna.org предлагает сайты взаимодействия для 1100 микроРНК, некоторые из межгенных микроРНК на данный момент не обработаны по программе miRanda и не входят в базу данных. Из одиннадцати сайтов предсказанных RNAhybrid (таблица 14), только два сайта для miR-1260 в мРНК MTHFR, miR-1285 в мРНК TP53 представлены в базе www.microrna.org (таблица 19). В заключении можно сделать вывод, что miRanda предсказывает сайты с одинаковой эффективностью, но большинство из этих сайтов не доступны в базе данных www.microrna.org. Эти данные свидетельствуют о значимости наших исследований в обнаружении в геноме человека сайтов с высоким уровнем комплементарности.
3.7 Изучение филогенетической консервативности сайтов, предсказанных RNAhybrid
На следующем этапе мы хотим проверить достоверность сайтов на основе консервативности сайта среди близкородственных и филогенетически далеких видов. В предыдущей части исследования мы говорили, что по данным выравнивания TargetScan, сайты микроРНК в 3'UTR сохраняются в 1-2 видах, то есть имеют низкую консервативность. На данном момент появились работы, которые показали эффективность действия сайтов микроРНК с низким уровнем консервативности [347]. То есть консервативность не является абсолютным критерием отбора функциональных сайтов.
В нашем исследовании мы описываем сайты взаимодействия в 5'UTR, CDS, 3'UTR. Поэтому в этой главе будут рассмотрена консервативность сайтов микроРНК, которые находятся в кодирующей части мРНК, что является новизной этой работы. Значимым отличием нашей работы от известных работ является проверка консервативности полной последовательности сайта микроРНК. Тогда как в основном проверяется только консервативность 'seed' области сайта. Второе отличие в методе изучения консервативности. В основном проводят выравнивание мРНК мишеней разных видов. В нашем исследовании мы проводили идентификацию сайта на основе аминокислотной последовательности. Как известно одна микроРНК может действовать на несколько генов мишеней и на один ген несколько микроРНК. На основе филогенетической консервативности генов мы постараемся проверить два этих утверждения.
miR-1279 имеет сайты связывания в мРНК генов PTPN12, ZEB1, MSH6. Сайт связывания в в мРНК гена PTPN12 является каноническим сайтом с полной комплементарностью в 'seed' области. Нуклеотидная последовательность сайта связывания кодирует TKEQYE гексапептид. Сайт в PTPN12 имеет одну Г:У пару, которая находится на дистанции от 'seed' области. Сайт miR-1279 имеет энергию взаимодействия -24,4 kcal/mol и ΔG/ΔGm равную 86.5%. Человеческий ген PTPN12 имеет 23 ортолога у разных животных. Для верификации сайта мы сравнивали нуклеотидную последовательность сайта с аминокислотной последовательностью (таблица 20). Графики вариабельности, полученные с помощью программе WebLogo, показывают, что нуклеотиды первой и второй позиции кодонов консервативные (рисунок 13). Олигонуклеотид в сайте взаимодействия кодирует TKEQYE гексапептид, который идентичный во всех изученных ортологичных белках. Замены в третьей позиции нуклеотидов не влияют на содержание аминокислот в сайте связывания (рисунок 13). Этот гексапептид расположен от 13 до 18 позиции в консервативной области аминокислотной последовательности изученных тирозин-фосфатаз (таблица 20). Замены в одного или нескольких нуклеотидов в третьей позиции приводит к уменьшению энергии взаимодействия, но не влияет на локализацию сайта.
Таблица 20 - Нуклеотидные последовательности мРНК гена PTPN12 в сайтах взаимодействия с miR-1279 и аминокислотные последовательности белка PTPN12 в области содержащей пентапептид TKEQYE [348] 12 345678Вариабельность нуклеотидов в сайте связывания miR-1279 с мРНК генов PTPN12 (1), MSH6 (3), ZEB1 (5) и вариабельность аминокислот в области белка PTPN12 (2), MSH6 (4), ZEB1 (6) кодирующие TKEQYE , EGSSDE , GEKPYE олигопептиды ортологов, вариабельность нуклеотидов в сайте miR-548m c мРНК PTPN12 (7) и аминокислот в области белка PTPN12 (8) кодирующие EATDI ортологов Рисунок 13 - Вариабельность нуклеотидной и аминокислотной последовательности сайтов ортологов [348]
Сайты связывания в ортологах имеют уровень достоверности от p<0.01 до p<0.0002 (таблица 21). Сайт взаимодействия идентичный у 11 видов от млекопитающих до земноводных, в других видах сайт имеет изменения, но не теряет своей эффективности. Полученные данные свидетельствуют, что сайт связывания существовал на ранних этапах эволюции и не менялся сотни миллионов лет. Таблица 21 - Характеристики взаимодействия hsa-miR-1279 с ортологами гена PTPN12 ОбъектПозиция , нтΔG, kcal/molΔG/ΔGm, %p<Rno836-24,887,90.0002Cgr788-24,486,50.0002Gga, Hsa, Laf, Mmu, Ptr, Xtr 836-24,486,50.0002Mga677-24,486,50.0002Nle, Pab479-24,486,50.0002Ocu 815-24,486,50.0002Tgu1111-24,486,50.0002Oan479-24.887.90.0002Ame, Bta837-23,483,00.0003Clu447-23,483,00.0003Eca765-23,483,00.0003Oni840-23,583,30.0003Aca 836-21,074,50.001Dre828-20,271,60.002Xla836-20,171,30.002Mdo908-17,863,10.01Cja836-17,863,10.01 Таблица 22 - Характеристики взаимодействия hsa-miR-1279 с мРНК гена PTPN12 разных видов животных [348]
мРНК PTPN12 5' C A 3'
AAAGGAGCAAUAUGA
UUUCUUCGUUAUACU miR-1279 3' UC 5'мРНК PTPN12 5' C A 3'
AAAGGAGCAGUAUGA
UUUCUUCGUUAUACU miR-1279 3' UC 5' Cgr CDS,788 ΔG = -24,4 ΔG/ΔGm = 86,5Gga CDS,836 ΔG = -24,4 ΔG/ΔGm = 86,5 Hsa CDS,836 ΔG = -24,4 ΔG/ΔGm = 86,5Mga CDS,677 ΔG = -24,4 ΔG/ΔGm = 86,5 Mmu CDS,836 ΔG = -24,4 ΔG/ΔGm = 86,5Tgu CDS,1108 ΔG = -24,4 ΔG/ΔGm = 86,5 Ptr CDS,836 ΔG = -24,4 ΔG/ΔGm = 86,5Xtr CDS,677 ΔG = -24,4 ΔG/ΔGm = 86,5 мРНК PTPN12 5' C G 3'
AAAGGAGCAAUAUGA
UUUCUUCGUUAUACU miR-1279 3' UC 5'мРНК PTPN12 5' U G 3'
AAGGAGCAGUAUGA
UUCUUCGUUAUACU miR-1279 3' UCU 5' Laf CDS,836 ΔG = -24,4 ΔG/ΔGm = 86,5Ame CDS,837 ΔG = -23,4 ΔG/ΔGm = 83,0 Nle CDS,479 ΔG = -24,4 ΔG/ΔGm = 86,5Bta CDS,837 ΔG = -23,4 ΔG/ΔGm = 83,0 Ocu CDS,815 ΔG = -24,4 ΔG/ΔGm = 86,5Clu CDS,447 ΔG = -23,4 ΔG/ΔGm = 83,0 Pab CDS,479 ΔG = -24,4 ΔG/ΔGm = 86,5Eca CDS,765 ΔG = -23,4 ΔG/ΔGm = 83,0 мРНК PTPN12 5' C A 3'
AAAGGAGCAAUAUGA
UUUCUUCGUUAUACU miR-1279 3' UC 5'мРНК PTPN12 5' C G 3'
AAGGAGCAGUAUGA
UUCUUCGUUAUACU miR-1279 3' UCU 5' Rno CDS,836 ΔG = -24,8 ΔG/ΔGm = 87,9Oni CDS,840 ΔG = -23,4 ΔG/ΔGm = 83,3Начало 5'-участка сайтов связывания в мРНК указано в нуклеотидах начиная от первого нуклеотида CDS; энергия взаимодействия (ΔG) - в kcal/mol; величина ΔG/ΔGm - в процентах. Данные таблицы 22 свидетельствуют, что miR-1279 связывается 5'-частью с мРНК гена PTPN12 всех видов животных. Следовательно, вероятность взаимодействия miR-1279 с мРНК ортологичных генов PTPN12 высокая. В таблице 22 приведены характеристики взаимодействия miR-1279 с мРНК ортологичных генов PTPN12 18 видов животных. Соответствующие сайты связывания определены с уровнем достоверности от p<0,0003 до p<0,0002.
Вторая miRNA (miR-548m), взаимодействующая с CDS мРНК ортологичных генов PTPN12, имеет сайты связывания менее консервативные, чем сайты связывания для miR-1279. miR-548m связывается с CDS мРНК ортологичных генов PTPN12 в сайтах, кодирующих пентапептид EATDI у девяти видов животных (таблица 23).
В олигопептидах гомологичных белков PTPN12 разных видов животных имеются точечные замены одной или двух аминокислот, однако гексапептиды расположены в той же позиции консервативной области белка. Характеристики сайтов связывания miR-548m приведены в таблице 24 и свидетельствуют о меньшей степени взаимодействия miR-548m с CDS мРНК ортологичных генов PTPN12. Таблица 23 - Нуклеотидные последовательности мРНК гена PTPN12 в сайтах взаимодействия с miR-548m и аминокислотные последовательности белка PTPN12 в области содержащей пентапептид EATDI [348]
ОбъектУчасток мРНК гена PTPN12Фрагмент белка PTPN12 с EATDICgr
Clu
Eca
Hsa
Laf
Nle
Ptr
Ocu
Ame
Mdo
Mga
Mmu
Gga
Rno
Tgu
AcaCTAACAGAAGCCACGGATATTGGT
CCAACAGAGGCCACAGATATTGGT
CCAACAGAAGCCACAGATATTGGT
CCAACAGAAGCCACAGATATTGGT
CCGACAGAAGCCACAGATATTGGT
CCAACAGAAGCCACAGATATTGGT
CCAACAGAAGCCACAGATATTGGT
CCATCAGAAGCCACAGATATCGGT
CCAACAGAGGCCACAGATATTGGT
CCATCAGAAATCACAGATATTGGT
CCCGCAGAAATAACAGATATTGGT
CCAGCAGAAGTCACAGATATTGGT
CCAACAGAAGTAACAGATATTGGT
CTAACAGAAGTCACAGACATTGGT
CCTGCAGAAGTAACAGATATTGGT
CCAGTTGAGACTACAGATATTGGTLTEATDIGFGNRCGKPKGPR
PTEATDIGFGNRCGKPKGPR
PTEATDIGFGNRCGKPKGPR
PTEATDIGFGNRCGKPKGPR
PTEATDIGFGNRCGKPKGPR
PTEATDIGFGNRCGKPKGPR
PTEATDIGFGNRCGKPKGPR
PSEATDIGFGNRCGRPKGPR
SPEATDIGFRNRCGKPKGPR
PSEITDIGFGNRCGKPKGPR
PAEITDIGFGNRCGKPRGPR
PAEVTDIGFGNRCGKPKGPR
PTEVTDIGFGNRCGKPRGPR
LTEVTDIGFGNRCGKPKGPR
PAEVTDIGFGNRCAKPRGPR
PVETTDIGFGNRCGKPRGPR Величина ΔG/ΔGm изменялась от 42,6% до 80,8% для 19 животных (p<0,96 до p<0,0003). У четырех животных сайт в изученной области не сохранился (Dre, Oan, Xla, Xtr). В девяти геномах сайт имеет высокую консервативность. Следовательно, влияние miR-548m на экспрессию гена PTPN12 слабее, чем miR-1279. Соответственно степень гомологии нуклеотидных последовательностей сайтов связывания в мРНК и степень гомологии пентапептидов ортологичных белков PTPN12 у разных животных меньше (рисунок 13). По данным таблицы 24, miR-548m связывается с мРНК ортологичных генов PTPN12 преимущественно 3'-частью или центральной частью (A. carolinensis, C. jacchus, Galus galus, Meleagris gallopavo, O. niloticus, P. abelii). Эти и приведенные выше данные свидетельствуют о возможности связывания мРНК с любой частью нуклеотидной последовательности miRNA.
Полученные данные о свойствах сайтов связывания двух miRNA в белок-кодирующей области мРНК гена PTPN12 свидетельствуют о локализации сайтов в участках мРНК, кодирующих консервативные аминокислотные последовательности тирозин-фосфатазы. Несмотря на дивергенцию, произошедшую сотни миллионов лет назад для некоторых из 24 видов животных, взаимодействие мРНК ортологичных генов PTPN12 с изученными miRNA сохранилось. Этому способствовало расположение сайтов связывания в консервативных участках мРНК, которые определяют сохранение функции тирозин-фосфатазы. Благодаря этому сохранилась возможность регуляции экспрессии гена PTPN12 с помощью miRNA. Таблица 24 - Характеристики взаимодействия hsa-miR-548m с мРНК ортологичных генов PTPN12 разных видов животных [348]
мРНК 5' A G 3'
CAGAAGCCACAGAUAUU
GUUUUUGGUGUUUAUGG miRNA 3' AAAC 5'мРНК 5' A G 3'
CAGAAGCCACAGAUAUU
GUUUUUGGUGUUUAUGG miRNA 3' AAAC 5' Eca CDS,2195 ΔG = -25,4 ΔG/ΔGm = 76,3Nle CDS,1905 ΔG = -25,4 ΔG/ΔGm = 76,3 Hsa CDS,2261 ΔG = -25,4 ΔG/ΔGm = 76,3Ptr CDS,2261 ΔG = -25,4 ΔG/ΔGm = 76,3 Laf CDS,2336 ΔG = -25,4 ΔG/ΔGm = 76,3 мРНК 5' U G 3'
CAGAAGCCACAGAUAUC
GUUUUUGGUGUUUAUGG miRNA 3' AAAC 5'мРНК 5' A G 3'
CAGAGGCCACAGAUAUU
GUUUUUGGUGUUUAUGG miRNA 3' AAAC 5' Ocu CDS,2243 ΔG = -26,9 ΔG/ΔGm = 80,8Clu CDS,1878 ΔG = -25,0 ΔG/ΔGm = 75,1Ame CDS,2264 ΔG = -25,0 ΔG/ΔGm = 75,1 мРНК 5' A G 3'
CAGAAGCCACGGAUAUU
GUUUUUGGUGUUUAUGG miRNA 3' AAAC 5'мРНК 5' C A 3'
AACCGCAAGUGCC UUGGUGUUUAUGG miRNA 3' GUUU AAAC 5' Cgr CDS,2201 ΔG = -24,6 ΔG/ΔGm = 73,9Tgu CDS,2142 ΔG = -24,4 ΔG/ΔGm = 73,3
Далее для того, чтобы проверить действие одной микроРНК на несколько генов будут рассмотрены сайты miR-1279 с мРНК генов MSH6 и ZEB1. Сайт связывания в мРНК гена MSH6 имеет однонуклеодный пузырь и четыре Г:У пары. Несмотря на это сайт имеет высокие параметры ΔG/ΔGm (89.4%) и энергию взаимодействия -25,2 kcal/mol. Таблица 25 - Нуклеотидные последовательности мРНК гена MSH6 в сайтах взаимодействия с miR-1279 и аминокислотные последовательности белка MSH6 в области содержащей пентапептид EGSSDE ОбъектУчасток мРНК гена MSH6 Фрагмент белка MSH6 с EGSSDEAme
Cgr
Cpo
Cfa
Eca
Hsa
Laf
Mdo
Nle
Mml
Ocu
Pab
Ptr
Ssc
Bta
MmuAAGGAGGAAGGAAGUAGUGAUGAACUA
AAGGGUGCUCCAAAGCGCAAGAGAACA
AAGGAGGAAGGAAGCAGUGAUGAGAUA
AAGGAGGAAGGAAGCAGUGAUGAAAUA AAGGAGGAAGGAAGCAGUGAUGAAAUA AAGGAGGAAGGAAGCAGUGAUGAAAUA AAGGAGGAAGGAAGCAGUGAUGAAAUA
AAGGAGGAAGGGAGCAGUGAUGAAGCA AAGGAGGAAGGAAGCAGUGAUGAAAUA AAGGAGGAAGGAAGCAGUGAUGAAAUA
AAGGAGGAAGGAAGCAGUGAUGAAGUU
AAGGAGGAAGGAAGCAGUGAUGAAAUA AAGGAGGAAGGAAGCAGUGAUGAAAUA
AAGGAGGAAGGAAGCAGUGAUGAAAUG
AAGGAGGAAGCAAGCAGUGAUGAAAUA
AAGCAGGAAGGAAGCAGUGAUGACGCG GGSDVEFKPDAKEEGSSDELSSGVGDSDS DGSDVEFKPDTKQEGSSDEMSSGVGDSDS GGSDVEFKPDTKEEGSSDEISSGAGDSES
GGSDVEFKPDAKEEGSSDEISSGVGDSDS GGSDVEFKPDAKEEGSSDEISSGVGDSDS GGSDVEFKPDTKEEGSSDEISSGVGDSES GGSDVEFKPDAKEEGSSDEISSGVGDSES GGSDVEFKPDTKEEGSSDEASSGMGESDS
GGSDVEFKPDTKEEGSSDEISSGVGDSES GGSDVEFKPDTKEEGSSDEISSGVGDSES
GGSDVEFKPDAKEEGSSDEVSSAVGDSES
GGSDVEFKPDTKEEGSSDEISSGVGDSES GGSDVEFKPDTKEEGSSDEISSGVGDSES
GGSDVEFKPDTKEEGSSDEMSSGVGDSDS
GGSDVEFKPDTKEEASSDEISSGVGDSDS
GGSDVEFKPDTKQEGSSDDASSGVGDSDS
Таблица 26 - Характеристики взаимодействия hsa-miR-1279 с ортологами гена MSH6 ОбъектПозиция, нтΔG, kJ/molΔG/ΔGm, %p<Cfa 578-25,289.40.00016Cpo 806-25,289.40.00016Ecu 758-25,289.40.00016Hsa , Mml 812-25,289.40.00016Nle 602-25,289.40.00016Ocu 809-25,289.40.00016Pon 818-25,289.40.00016Ptr 929-25,289.40.00016Ssc 815-25,289.40.00016Mmu 812-24,988.30.00018Dre797-24,787.60.00020Mdo1019-24,787.60.00020Cgr623-23,483.00.00033Ame815-23,282.30.00036Bta 808-21,375.50.0009Laf 578-21,174.80.001
Олигонуклеотид в сайте связывания кодирует гексапептид EGSSDE в белке MSH6. Мы изучили 34 ортолога человеческого гена MSH6. Эффективность miR-1279 сайта сохраняется в 16 ортологах.
Олигонуклеотиды сайта и соответственный олигопептид представлены в таблице 25. MSH6 белок 13 млекопитающих и человека имеют идентичных EGSSDE гексапептид и нуклеотидная последовательность сайта также у этих видов является высоко гомологичной. В первой аминокислоте олигопептида есть вариабельность по первому кодону кодирующий глутаминовую кислоту. EGSSDE олигопептид расположен с 13 по 18 позиции консервативного участка белка MSH6 (таблица 25). Вариабельность нуклеотидов и аминокислот представлена на рисунке 13. Все сайты связывания в мРНК гена MSH6 соответствуют одной рамке считывания. Достоверность сайтов связывания составляет от p<0.001 до p<0.00016 (таблица 26). У девяти ортологов сайт имеет полную идентичность (от шимпанзе до морской свинки). мРНК гена MSH6 у 11 животных имеет 3'-доминантный сайт miR-1279 и во всех этих видах высокую гомологию. В мРНК гена Bos Taurus и Loxodonta Africana сайт также имеет 3'-доминантный тип, но слабо взаимодействующий 5'-конец микроРНК (таблица 29).
мРНК гена ZEB1 имеет сайт связывания с miR-1279, энергия взаимодействия составляет 90% от максимальной величины, потому что 16 нуклеотидов микроРНК из 17 комплементарны мРНК мишени. Сайт имеет две Г:У пары и однонуклеодный пузырь на обеих нитях. Для проверки доставерности сайта были изучены сайты в мРНК ортологов 16 организмов. 12 из них сохранили сайт miR-1279 и консервативные аминокислоты в сайте связывания (таблица 27). Нуклеотидная последовательность сайта взаимодействия имеет высокую гомологию (Рисунок 13). Таблица 27 - Нуклеотидные последовательности мРНК гена ZEB1 в сайтах взаимодействия с miR-1279 и аминокислотные последовательности белка ZEB1 в области содержащей пентапептид GEKPYE Третий нуклеотид кодонов кодирующих тирозин и глутаминовую кислоту изменяется у разных организмов. Хотя это событие не влияет на аминокислотную последовательность и все 12 видов имеют в белке гексапептид GEKPYE. Этот олигопептид расположен в консервативной области белка (таблица 27). Характеристики сайтов связывания у ортологичных мРНК представлены в таблице 28. Сайт miR-1279 имеет хорошую консервативность среди млекопитающих и птиц, у земноводных сайт сохранился с меньшей точностью. Если рассматривать вид взаимодействия, то мРНК 9 видов имеет 3'-доминантный тип сайта с miR-1279. мРНК гена ZEB1 у M. musculus, X. laevis, X. tropicalis взаимодействует с 9-11 нуклеотидами с 3'-концом miR-1279, то есть также является 3'-доминантным сайтом (таблица 29). Таблица 28 - Характеристики взаимодействия hsa-miR-1279 с ортологами гена ZEB1 ОбъектПозиция, нтΔG, kJ/molΔG/ΔGm, %p<Ame 810-105.489.40.00016Bta, Cja, Pab792-105.489.40.00016Cfa588-105.489.40.00016Gga789-105.489.40.00016Hsa, Nle, Ptr 741-105.489.40.00016Mml750-105.489.40.00016Mmu730-87.474.10.0011Xtr732-87.474.10.0011Xla798-87.474.10.0011
Исследованные сайты генов PTPN12, MSH6, ZEB1 показывает стабильную консервативность сайтов микроРНК среди млекопитающих и позвоночных, что свидетельствует о значимости данных сайтов в регуляции генов мишеней.
Таблица 29 - Схемы взаимодействия нуклеотидных последовательностей в сайтах связывания hsa-miR-1279 с мРНК генов MSH6, ZEB1 разных животных
Сайты связывания Виды с идентичным сайтом мРНК MSH6 5' N A N 3'
GGAAGGAAGCAGUG UGA UCUUUCUUCGUUAU ACU miR-1279 3' 5'Clu, Cpo, Eca, Hsa, Mdo, Mml, Mmu, Nle, Pab, Ptr, Ssc мРНК ZEB1 5' N C N 3'
GGAGAGAAGC AUAUGA UCUUUCUUCG UAUACU miR-1279 3' U 5'Ame, Cja, Clu, Bta, Gga, Hsa, Mml, Nle, Pab, Ptr N - может быть любым нуклеотидом (А, Г, У, С).
Полученные результаты свидетельствуют, что сайты связывания с высокой комплементарностью, локализованные в кодирующей области мРНК, высоко консервативны среди позвоночных.
В результате исследования филогенетической консервативности сайтов связывания микроРНК c мРНК были опубликованы ряд публикаций [348-350]. ЗАКЛЮЧЕНИЕ
Настоящая диссертация посвящена идентификации важных генов и микроРНК, которые участвуют в развитии рака толстой кишки. Для этого были созданы база данных по генам с наличием мутаций при этом заболевании и база данных по микроРНК, у которых обнаружено изменение экспрессии при РТК. Из базы отобраны 54 белок кодирующих гена, которые имеют важную функциональную роль и наибольшее количество исследований и на их основе проведен поиск микроРНК с помощью программы RNAhybrid, которые регулируют эти гены. Для этого была разработана методика отбора сайтов микроРНК на основе введенного нами параметра score (ΔG/ΔGm). В результате исследования были идентифицированы 120 микроРНК, которые могут быть ключевыми молекулами в регуляции 47 генов мишеней. Найденные сайты микроРНК имеют почти полную комплементарность и ранее не описаны в других исследованиях. Как показано в работе Brennecke с соавторами (таблица 6) [146] многие не канонические сайты могут иметь очень высокую регуляторную эффективность. Большинство описанных нами сайтов относятся к неканоническим сайтам, так как имеют Г:У пары и неспаренные нуклеотиды в 5'конце микроРНК. При сравнении сайтов предсказанных с помощью программ RNAhybrid, TargetScan и miRanda было установлено, что программа TargetScan предсказывает только канонические сайты связывания микроРНК и не находит всех комплементарных пар в канонических сайтах с высокой комплементарностью. Программа miRanda предсказывает все сайты, найденные с помощью программы RNAhybrid, но большинство этих сайтов не доступны на он-лайн резурсе microrna.org, которая представляет сайты предложенные программой miRanda. Программы TargetScan и miRanda широко используются среди исследователей для поиска значимых микроРНК в регуляции определенных генов. В связи с этим сайты с высокой комплементарностью описанные в нашей работе еще не изучены. Для подтверждения сайтов связывания микроРНК исследована филогенетическая консервативность сайтов микроРНК. Установлено, что сайты в 3'нетранслируемой области имеют низкую консервативность, а сайты, расположенные в кодирующей последовательности мРНК, высоко консервативны среди позвоночных. Мы надеемся, что описанные сайты будут основой для разработки молекулярных маркеров для диагностики и разработки лекарственных средств для лечения рака.
На основе полученных результатов были сделаны следующие выводы: 1. Из 142 генов кандидатов, ответственных за развитие рака толстой кишки, выявлено 54 гена, имеющих ключевую роль в развитии рака, и создана база данных по этим генам.
2. Найдены 185 потенциальных сайта взаимодействия для 120 межгенных микроРНК, которые могут регулировать 47 из 54 генов, ответственных за развитие рака толстой кишки. Все описанные сайты имеют высокий уровень комплементарности. 3. Сайты взаимодействия микроРНК расположены во всех участках мРНК. Установлено, что 23%, 42%, 35% сайтов находятся в 5'UTR, CDS и 3'UTR мРНК, а средняя плотность сайтов связывания микроРНК в 5'UTR в четыре раза выше, чем в CDS и 3'UTR.
4. Установлены три вида сайтов связывания микроРНК с мРНК в зависимости от вклада микроРНК в энергию гибридизации: 5'-доминантный, 3'-доминантный сайты и сайты с центральным доминированием. Неспаренные нуклеотиды во вторичной структуре мРНК служат основой для образования связи между микроРНК и мРНК.
5. Модифицированная программа RNAhybrid позволяет находить большее число достоверных сайтов связывания и лучше определять характеристики взаимодействия микроРНК с мРНК. 6. Сайты взаимодействия микроРНК расположенные в 3'UTR имеют низкую филогенетическую консервативность, а сайты в CDS имеют высокую консервативность.
СПИСОК ИСТОЧНИКОВ
1 Земляной В.П., Трофимова Т.Н., Непомнящая С.Л., Дементьева Т.В. Современные методы диагностики и оценки степени распространенности рака ободочной и прямой кишки // Практическая онкология. - 2005. - Т. 6, № 2. - C. 71-80.
2 Ogino S., Brahmandam M., Kawasaki T., Kirkner G.J., Loda M., Fuchs C.S. Epigenetic profaling of synchronous colorectal neoplasias by quantitative DNA methylation analysis // Mod Pathol. - 2006. - № 19. - P. 1083-1090.
3 Jian-Xin Gao. Cancer stem cells: the lessons from pre-cancerous stem cells // J. Cell. Mol. Med. - 2008. - Vol. 12, № 1. - P. 67-96.
4 Richman S.D., Seymour M.T., Chambers P., Elliott F., Daly C.L., Meade A.M., Taylor G., Barrett J.H., Quirke P. Kras and BRAF mutations in advanced colorectal cancer are associatedwith poor prognosis but do not preclude benefit from oxaliplatin or irinotecan, results from the MRC FOCUS trial // J. Clin. Oncol. - 2009. - Vol. 27. - P. 5931-5937.
5 Sparks A.B., Morin P.J., Vogelstein B., Kinzler K.W. Mutational analysis of the APC/beta-catenin/Tcf pathway in colorectal cancer // Cancer Res. - 1998. - Vol. 58. - P. 1130-1134.
6 Toyota M., Ahuja N., Ohe-Toyota M., Herman J. G., Baylin S. B., Issa J. P. J. CpG island methylator phenotype in colorectal cancer // Proceedings of the National Academy of Sciences of the United States of America. - 1999. Vol. 96, № 15. - P. 8681-8686.
7 Neklason D.W., Kerber R.A., Nilson D.B., Anton-Culver H., Schwartz A.G., et al. Common familial colorectal cancer linked to chromosome 7q31: A genome-wide analysis // Cancer research. - 2008. - Vol. 68, № 21. - P. 8993-8997.
8 Markowitz S. D., Bertagnolli M. M. Molecular origins of cancer: molecular basis of colorectal cancer // New England Journal of Medicine. - 2009. Vol. 361, № 25. P. 2449-2460. 9 Jasperson K. W., Tuohy T. M., Neklason D. W., and Burt R. W. Hereditary and familial colon cancer // Gastroenterology. - 2010. - Vol. 138. - № 6. - P. 2044-2058. 10 Lee R. C., Feinbaum R. L., et al. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14 // Cell. - 1993. - Vol. 75, № 5. - P. 843-854.
11 Garzon R., Calin G.A.,Croce C.M. MicroRNAs in cancer // Annur Rev Med. - 2009. - № 60. - P. 167-179.
12 Aukerman M. J., Sakai H. Regulation of flowering time and floral organ identity by a MicroRNA and its APETALA2-like target genes // Plant Cell. - 2003. - Vol. 15, № 11. - P. 2730-2741.
13 Chen C. Z., Li L., et al. MicroRNAs modulate hematopoietic lineage differentiation // Science. - 2004. - Vol. 303, № 5654. - P. 83-86.
14 Brennecke J., Hipfner D.R., Stark A., Russell R.B., Cohen S.M. Bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila // Cell. - 2003. Vol. 113. - P. 25-36.
15 Lewis Benjamin P., Christopher B. Burge, David P. Bartel. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets // Cell. - 2005. - Vol. 120, № 1. - P. 15-20. 16 Lewis B. P., Shih I-hung, Jones-Rhoades M.W., Bartel D.P., Burge C.B. Prediction of Mammalian MicroRNA Targets // Cell. - 2003. - Vol. 115. - P. 787-798.
17 Griffiths-Jones S., Grocock R.J., Dongen S., Bateman A., Enright A.J. miRBase: microRNA sequences, targets and gene nomenclature // NAR. - 2006. - Vol. 34, № 1. - P. 140-144.
18 Lee I., Ajay S.S., Yook J.I., Kim H.S. et al. New class of microRNA targets containing simultaneous 5'-UTR and 3'UTR interaction sites // Genome Res. - 2009. - Vol. 19, № 7. - P. 1175-83. 19 Ferlay J., et al. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008 // Int J Cancer. - 2010. - 127(12). - p. 2893-2917. 20 Ferlay J., Shin H.R, Bray F., Forman D., Mathers C., Parkin D.M. GLOBOCAN 2008 v. 1.2, Cancer Incidence and Mortality Worldwide: IARC CancerBase № 10 [Internet]. Lyon, France: International Agency for Research on Cancer, 2010. Available from: http: // globocan.iarc.fr.§ Accessed May 2011]
21 Cunningham D., Atkin W., Lenz H.J., et al. Colorectal cancer // The Lancet. - 2010. - Vol. 375, no 9719. - Р. 1030-1047. 22 Садықов М.С. Лучевая диагностика рака толстой кишки // Вестник КазНМУ. - 2012.
23 Турбекова М.Н., Егеубаева С.А. Современные подходы к раннему выявлению колоректального рака // Вестник КазНМУ. - 2012.
24 Lichtenstein P., et al. Environmental and heritable factors in the causation of cancer // New England Journal of Medicine. - 2000. - Vol. 343. - Р. 78-85. 25 Grady W.M. Genetic testing for high-risk colon cancer patients // Gastroenterology. - 2003. - Vol. 124, № 6. - Р. 1574-94. 26 Мартынюк В.В. Рак ободочной кишки (заболеваемость, смертность, факторы риска, скрининг) // Практическая онкология. - 2000. - №1. - С. 3-9.
27 Leggett B., Whitehall V. Role of the Serrated Pathway in Colorectal Cancer Pathogenesis // Gastroenterology. - 2010. - Vol. 138. - P. 2088-2100.
28 Half E., Bercovich D., and Rozen P. Familial adenomatous polyposis // Orphanet Journal of Rare Diseases. - 2009. - Vol. 4, № 1. - Article 22. 29 Lüchtenborg M., Weijenberg M.P., Roemen M. J. M., Bruïne P., Brandt P., Lentjes H. F. M., Brink M., Engeland M., R. Goldbohm A., Goeij A. APC mutation in sporadic colorectal carcinomas from The Netherlands Cohort Study // Carcinogenesis. - 2004. - Vol. 25. - P. 1219-1226.
30 Benchabane H.and Ahmed Y. The adenomatous polyposis coli tumor suppressor and Wnt signaling in the regulation of apoptosis // Advances in Experimental Medicine and Biology. - 2009. - Vol. 656. - P. 75-84.
31 Juhn E. and Khachemoune A. Gardner syndrome: skin manifestations, differential diagnosis and management // American Journal of Clinical Dermatology. - 2010. - Vol. 11, № 2. - P. 117-122.
32 Todor V., Chirila D., Tompa S. Familian colorectal cancer: The Lynch syndrome // Chirurgia. - 1998. - Vol. 93. - P. 427-432.
33 Lynch H. T., Lynch P. M., Lanspa S. J., Snyder C. L., Lynch J. F., and Boland C. R. Review of the Lynch syndrome: history, molecular genetics, screening, differential diagnosis, and medicolegal ramifications // Clinical Genetics. 2009. - Vol. 76, №1. - P. 1-18. 34 Hampel H., et al. Feasibility of screening for Lynch syndrome among patients with colorectal cancer // J Clin Oncol. - 2008. - Vol. 26, № 35. P. 5783-8.
35 Hare H. H., Mahendraker N., Sarwate S., and Tangella K. Muir-Torre syndrome: a rare but important disorder // Cutis. - 2008. Vol. 82, № 4. - P. 252-256. 36 Kopacova M., Tacheci I., Rejchrt S., and Bures J. Peutz-Jeghers syndrome: diagnostic and therapeutic approach // World Journal of Gastroenterology. 2009. - Vol. 15, № 43. P. 5397-5408. 37 Beggs A. D., Latchford A. R., Vasen H. F. A., et al. Peutz-Jeghers syndrome: a systematic review and recommendations for management // Gut. - 2010. - Vol. 59, № 7. - P. 975-986. 38 Jenne D. E., Reimann H., Nezu J. I., et al. Peutz-Jeghers syndrome is caused by mutations in a novel serine threonine kinase // Nature Genetics. - 1998. - Vol. 18, № 1. - P. 38-43.
39 Calva D.and Howe J. R. Hamartomatous polyposis syndromes // Surgical Clinics of North America. - 2008. - Vol. 88, № 4.- P. 779-817.
40 Brosens L. A. A., Van Hattem A., Hylind L. M., et al. Risk of colorectal cancer in juvenile polyposis // Gut. - 2007. - Vol. 56, № 7. P. 965-967.
41 Rubio C. A., Stemme S., Jaramillo E., Lindblom A. Hyperplastic polyposis coli syndrome and colorectal carcinoma // Endoscopy. - 2006. - Vol. 38, № 3. - P. 266-270.
42 Jass J. Hamilton S. R., Aaltonen L. A., Eds. "Hyperplastic polyposis" in Pathology and Genetics of Tumors of the Digestive System // International Agency for Research on Cancer, Lyon, France. - 2000. - P. 135-136. 43 Michor F., Iwasa Y., Lengauer C., Nowak M.A. Dynamics of colorectal cancer // Seminars in cancer biology. - 2005. - Vol. 15, № 6. - P. 484-493.
44 Muleris M., Chalastanis A., Meyer N., et al. Chromosomal instability in near-diploid colorectal cancer: a link between numbers and structure // PLoS ONE. - 2008. - Vol. 3, № 2. - Article ID e1. 632. 45 Camps J., Armengol G., del Rey J., et al. Genome-wide differences between microsatellite stable and unstable colorectal tumors // Carcinogenesis. - 2006. - Vol. 27, № 3. P. 419-428.
46 Grady W. M., Carethers J. M. Genomic and epigenetic instability in colorectal cancer pathogenesis // Gastroenterology. - 2008. Vol. 135, № 4. P. 1079-1099.
47 Lengauer C., Kinzler K. W., Vogelstein B. Genetic instability in colorectal cancers // Nature. - 1997. Vol. 386, № 6625. P. 623-627.
48 Hermsen M., Postma C., Baak J., et al. Colorectal adenoma to carcinoma progression follows multiple pathways of chromosomal instability // Gastroenterology. - 2002. - Vol. 123, № 4. P. 1109-1119.
49 Diep C. B., Kleivi K., Ribeiro F. R., Teixeira M. R., Lindgjærde O. C., Lothe R. A. The order of genetic events associated with colorectal cancer progression inferred from meta-analysis of copy number changes // Genes Chromosomes and Cancer. - 2006. - Vol. 45, № 1. P. 31-41.
50 Martinez-Lopez E., Abad A., Font A., et al. Allelic loss on chromosome 18q as a prognostic marker in stage II colorectal cancer // Gastroenterology. 1998. - Vol. 114, № 6. P. 1180-1187.
51 Goto T., Mizukami H., Shirahata A., et al. Aberrant methy-lation of the p16 gene is frequently detected in advanced colorectal cancer // Anticancer Research. - 2009. -Vol. 29, № 1. P.275-277.
52 Bernet A., Mazelin L., Coissieux M. M., et al. Inactivation of the UNC5C netrin-1 receptor is associated with tumor progression in colorectal malignancies // Gastroenterology. - 2007. - Vol. 133, № 6. P. 1840-1848.
53 Hibi K., Nakao A. Highly-methylated colorectal cancers show poorly-differentiated phenotype // Anticancer Research. - 2006. - Vol. 26, № 6 B. P. 4263-4266. 54 Kamiyama H., Noda H., Takata O., Suzuki K., Kawamura Y., Konishi F. Promoter hypermethylation of tumor-related genes in peritoneal lavage and the prognosis of patients with colorectal cancer // Journal of Surgical Oncology. - 2009. -Vol. 100, № 1. - P. 69-74.
55 Xu X. L., Yu J., Zhang H. Y., et al. Methylation profile of the promoter CpG islands of 31 genes that may contribute to colorectal carcinogenesis // World Journal of Gastroenterology. - 2004. - Vol. 10, № 23. - P. 3441-3454. 56 Mulero-Navarro S., Esteller M. Chromatin remodeling factor CHD5 is silenced by promoter CpG island hyperme-thylation in human cancer // Epigenetics. - 2008. - Vol. 3, № 4. - P. 210-215. 57 Vlaicu S. I., Tegla C. A., Cudrici C. D., et al. Epigenetic modifications induced by RGC-32 in colon cancer," Experimental and Molecular Pathology, vol. 88, № 1, pp. 67-76, 2010.
58 Chen J., Rocken C., Lofton-Day C., Schulz H-U., Muller O., Kutzner N., Malfertheiner P., Ebert M. Molecular analysis of APC promoter methylation and protein expression in colorectal cancer metastasis // Cancirogenesis. - 2005. Vol. 26, № 1. - P. 37-43.
59 Takano Y., Shiota G., Kawasaki H. Analysis of genomic imprinting of insulin-like growth factor 2 in colorectal cancer // Oncology. - 2000. - № 59. - P. 210-216. 60 Huang K., et al. GSTM1 and GSTT1 polymorphisms, cigarette smoking, and risk of colon cancer: a population-based case-control study in North Carolina (United States) // Cancer Causes Control. - 2006. - Vol. 17, № 4. P. 385-94. 61 Ritchie K.J., et al. Markedly enhanced colon tumorigenesis in ApcMin mice lacking glutathione S-transferase Pi // Proc Natl Acad Sci U S A. - 2009.
62 Lucia Migliore, Francesca Migheli, Roberto Spisni, Fabio Copped. Genetics, Cytogenetics, and Epigenetics of Colorectal Cancer // Journal of Biomedicine and Biotechnology. - 2011. - Vol. 2011, Article ID 792362. - P. 19. 63 Morimoto L.M., et al. Insulin-like growth factor polymorphisms and colorectal cancer risk // Cancer Epidemiol Biomarkers Prev. - 2005. - Vol. 14, № 5. - P. 1204 -11. 64 Xu Y., Pasche B. TGF-beta signaling alterations and susceptibility to colorectal cancer // Hum Mol Genet. - 2007. - Vol. 16, № 1. - P. 14-20. 65 Broderick P., et al. A genome-wide association study shows that common alleles of SMAD7 influence colorectal cancer risk // Nat Genet. - 2007. - Vol. 39, № 11. - P. 1315-1317. 66 Rennert G., et al. Colorectal polyps in carriers of the APC I1307K polymorphism // Dis Colon Rectum. - 2005. - Vol. 48, № 12. - P. 2317-21. 67 Zauber N.P., et al. The characterization of somatic APC mutations in colonic adenomas and carcinomas in Ashkenazi Jews with the APC I1307K variant using linkage disequilibrium // J Pathol. - 2003. - Vol. 199, № 2. P. 146-51. 68 Tranah G.J., et al. APC Asp1822Val and Gly2502Ser polymorphisms and risk of colorectal cancer and adenoma // Cancer Epidemiol Biomarkers Prev. - 2005. - Vol. 14, № 4. - P. 863-70. 69 Merlos-Suarez Anna, Francisco M. Barriga, Peter Jung, Mar Iglesias, Marıa Virtudes Cespedes et al. The Intestinal Stem Cell Signature Identifies Colorectal Cancer Stem Cells and Predicts Disease Relapse // Cell Stem Cell. - 2011. -doi:10.1016/j.stem.2011.02.020
70 Brittan M., Wright N.A. Gastrointestinal stem cells // J Pathol. - 2002. - Vol. 197. - P. 492-509.
71 Thomas Klonisch, Emilia Wiechec, Sabine Hombach-Klonisch, Sudharsana R. Ande, Sebastian Wesselborg, Klaus Schulze-Osthoff, Marek Los. Cancer stem cell markers in common cancers - therapeutic implications // Trends in Molecular Medicine. - 2008. - Vol.14, № 10. - P. 450-460.
72 Croker A.K., Allan A.L. Cancer stem cells: implications for the progression and treatment of metastatic disease // J. Cell. Mol. Med. - 2008. - Vol 12, №2. - P. 374-390.
73 O'Brien CA, Pollett A., Gallinger S., et al. A human colon cancer cell capable of initiating tumour growth in immunodeficient mice // Nature. - 2007. - Vol. 445. - P. 106-110.
74 Ricci-Vitiani L., et al. Identification and expansion of human colon-cancer-initiating cells // Nature. - 2007. - Vol. 445. - P. 111-115. 75 Dalerba P., et al. Phenotypic characterization of human colorectal cancer stem cells // Proc. Natl. Acad. Sci. U. S. A. - 2007. - Vol. 104. - P. 10158-10163.
76 O'Brien C.A., Kreso A., Jamieson C.H. Cancer stem cells and self-renewal // Clin. Cancer Res. - 2010. - Vol. 16. - P. 3113-3120.
77 Todaro M., Francipane M.G., Medema, J.P., Stassi G. Colon cancer stem cells: Promise of targeted therapy // Gastroenterology. - 2010. - Vol. 138. P. 2151-2162.
78 Kosinski C., Li V.S., Chan A.S., Zhang J., Ho C., Tsui W.Y., Chan T.L., Mifflin R.C., Powell D.W., Yuen S.T., Leung S.Y., Chen X. Gene expression patterns of human colon tops and basal crypts and bmp antagonists as intestinal stem cell niche factors // Proc. Natl. Acad. Sci. USA. - 2007. - Vol. 104. - P. 15418-15423.
79 Veronica Catalano, Miriam Gaggianesi, Valentina Spina, Flora Iovino, Francesco Dieli, Giorgio Stassi, Matilde Todaro. Colorectal Cancer Stem Cells and Cell Death // Cancers. - 2011. - Vol. 3. - P. 1929-1946. 80 Joanna Papailiou, Konstaninos J. Bramis, Maria Gazouli, George Theodoropoulos. Stem cells in colon cancer. A new era in cancer theory begins // Int J Colorectal Dis. - 2011. - Vol. 26. - P. 1-11. 81 Marzouk O., Schofield J. Review of histopathological and molecular prognostic features in colorectal cancer // Cancers. - 2011. - Vol. 3. - P. 2767-2810
82 Greene F.L. Current TNM staging of colorectal cancer // Lancet Oncol. - 2007. - Vol. 8. - P. 572-573.
83 Gunderson L.L., Jessup J.M., Sargent D.J., Greene F.L. Stewart A.K. Revised TN categorization for colon cancer based on national survival outcomes data // J. Clin. Oncol. - 2010. - Vol. 28. P. 264-271. 84 Marzouk O., Schofield J. Review of histopathological and molecular prognostic features in colorectal cancer // Cancers. - 2011. - Vol. 3. - P. 2767-2810.
85 Стенина М.Б. Рак ободочной кишки: стандартное обследование для оценки степени распространения и выбор лечебной тактики с учетом предоперационной стадии заболевания // Практическая онкология. - 2000. - № 1. С. 10-13.
86 Vogelstein B., Fearson E.R., Hamilton S.R., Kern S.E., Preisinger AC., Leppert M., Nakamura Y., White R., Smits A.M., Bos J.L. Genetic alterations during colorectal-tumor devepopment // N. Engl. J. Med. - 1988. - Vol. 319. - P. 525-532.
87 Peyssonnaux C., Eychene A. The Raf/MEK/ERK pathway: New concept of of activation // Biol. Cell. - 2001. - Vol. 93. - P. 53-62.
88 Garnet M.J., Rana S., Paterson H., Barford D., Marais R. Wild-type and mutant B-RAF activate C-RAF through distinct mechanisms involving heterodimerization // Mol. Cell. - 2005. - Vol. 20. - P. 963-969.
89 Andreyev H.J.N., Norman A.R., Cunningham D., et al. Kirsten ras mutations in patients with colorectal cancer, the 'RASCAL II' study // British Journal of cancer. - 2001. - Vol. 86, № 5. - P. 692-696.
90 Souglakos J., Philips J., Wang R., Marwash S., Silver M., Tzardi M., Silver J., Ogino S., Hooshmand S., Kwak E., et al. Prognostic and predictive value of common mutatins for treatment response and survival in patients with metastatic colorectal cancer // J. Cancer. - 2009. - Vol. 101. - P. 465-472. 91 Bardelli A., Siena S. Molecular mechanisms of resistance to cetuximab and panitumumab in colorectal cancer // J. Clin. Oncol. - 2010. - Vol. 28. - P. 1254-1261.
92 Sartore-Bianchi A., Di Nicolantonio F., Nichelatti M., Molinari F., De Dosso S., Saletti P., Martini M., Cipani T., Marrapese G., Mazzucchelli L., et al. Multi-determinants analysis of molecular alterations for predicting clinical benefit to EGFR-targeted monoclonal antibodies in colorectal cancer // PloS One. - 2009. - Vol. 4. - e. 7287. 93 Pinto D., Clevers H. Wnt, stem cells and cancer in the intestine // Biol. Cell. - 2005. - Vol. 97. P. 185-196.
94 Scoville D.H., Sato, T., He, X.C., Li L. Current view: Intestinal stem cells and signaling // Gastroenterology. - 2008. - Vol. 134. P. 849-864.
95 Korinek V., Barker N., Moerer P., van Donselaar E., Huls G., Peters P.J., Clevers H. Depletion of epithelial stem-cell compartments in the small intestine of mice lacking Tcf-4 // Nat. Genet. - 1998. - Vol. 19. - P. 379-383.
96 Fevr T., Robine S., Louvard D., Huelsken J. Wnt/beta-catenin is essential for intestinal homeostasis and maintenance of intestinal stem cells // Mol. Cell Biol. - 2007. - Vol. 27. - P. 7551-7559.
97 Nishisho I., Nakamura Y. Miyoshi Y., Miki Y., Ando H., Horii A., Koyama K., Utsunomiya J., Baba S., Hedge P. Mutations of chromosome 5q21 genes in FAP and colorectal cancer patients // Science. - 1991. - Vol. 253, - P. 665-669.
98 Liu C., Li Y., Semenov M., Han C., Baeg G.H., Tan Y., Zhang Z., Lin X., He X. Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism // Cell. - 2002. - Vol. 108. - P. 837-847.
99 Wu X., Tu X., Joeng K.S., Hilton M.J., Williams D.A., Long F. Rac1 activation controls nuclear localization of beta-catenin during canonical Wnt signaling // Cell. - 2008. - Vol. 133. - P. 340-353.
100 Clevers H., van de Wetering M. Tcf/lef factor earn their wings // Trends Genet. - 1997. - Vol. 13. - P. 485-489.
101 Mosimann C., Hausmann G., Basler K. Beta-catenin hits chromatin: Regulation of Wnt target gene activation // Nat. Rev. Mol. Cell Biol. - 2009. - Vol. 10. - P. 276-286.
102 Inoki K., Ouyang H., Zhu T., Lindvall C., Wang Y. et al. TSC2 integrates Wnt and energy signals via a coordinated phosphorylation by AMPK and GSK3 to regulate cell growth // Cell. - 2006. - Vol. 126. - P. 955-968.
103 Zeilstra J., Joosten S.P., Dokter M., Verwiel E., Spaargaren M., Pals S.T. Deletion of the Wnt target and cancer stem cell marker CD44 in Apc(Min/+) mice attenuates intestinal tumorigenesis // Cancer Res. - 2008. - Vol. 68. - P. 3655-3661.
104 Tetsu O., McCormick F. Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells // Nature. - 1999. - Vol. 398. - P. 422-426.
105 van de Wetering M., Sancho E., Verweij C., de Lau W., Oving I. et al. The beta-catenin/TCF-4 complex imposes a crypt progenitor phenotype on colorectal cancer cells // Cell. - 2002. - Vol. 111. - P. 241-250.
106 Kenneth C. Valkenburg, Carrie R. Graveel, Cassandra R. Zylstra-Diegel, Zhendong Zhong and Bart O. Williams. Wnt/β-catenin Signaling in Normal and Cancer Stem Cells // Cancers. - 2011. - Vol. 3. - P. 2050-2079. 107 Исабекова А.С., Иващенко А.Т. Роль генов белков и микроРНК в развитии рака толстой кишки // Известия НАН РК. Серия биологическая и медицинская. 2010. - № 2 (278). - C. 56-62.
108 Russo A., Bazan V., Iacopetta B., Kerr D., Soussi T., Gebbia N. The TP53 colorectal cancer international collaborative study on the prognostic and predictive significance of p53 mutation: influence of tumor site, type of mutation, and adjuvant treatment // Journal of Clinical Oncology. - 2005. - Vol. 23, № 30. - P. 7518-7528.
109 Iacopetta B., Russo A., Bazan V., et al. Functional categories of TP53 mutation in colorectal cancer: results of an International Collaborative Study // Annals of Oncology. - 2006. - Vol. 17, №5. - P. 842-847.
110 Berg M. Genomics of Colorectal Carcinomas from Young and Elderly Patients // Ph.D. Thesis, University of Oslo, Oslo, Norway. - 2010.
111 Berg M., Søreide K. Genetic and Epigenetic Traits as Biomarkers in Colorectal Cancer // Int. J. Mol. Sci. - 2011. - Vol. 12. - P. 9426-9439. 112 Sjoblom T., Sian J., Laura D.W., Williams Parsons D., Jimmy L., et al. The consensus coding sequences of human breast and colorectal cancers // Science. - Vol. 314. - P. 268-274.
113 Kulendran M., Stebbing J.F., Marks C.G., Rockall T.A. Predictive and Prognostic Factors in Colorectal Cancer: A Personalized Approach // Cancers. - 2011. - Vol. 3. - P. 1622-1638. 114 American College of Physicians. Suggested technique for fecal occult blood testing and interpretation in colorectal cancer screening // Ann. Int. Med. - 1997. - Vol. 126. - P. 808-810.
115 Mandel J.S., Bond J.H., Church T.R., Snover D.C., Bradley G.M., Schuman L.M., Ederer F. Reducing mortality from colorectal cancer by screening for fecal occult blood // N. Engl. J. Med. - 1993. - Vol. 328. - P. 1365-1371.
116 Mandel J.S., Church T.R., Ederer F., Bond J.H. Colorectal cancer mortality: Effectiveness of biennial screening for fecal occult blood // J. Nat. Cancer Inst. - 1999. - Vol. 91. - P. 434-437.
117 Brenner D.E., Rennert G. Fecal DNA biomarkers for the detection of colorectal neoplasia: Attractive, but is it feasible // J. Nat. Cancer Inst. - 2005. -Vol. 97. - P. 1107-1109.
118 Ned R.M., Melillo S., Marrone M. Fecal DNA testing for colorectal cancer screening: The colosure test // PLoS Curr. - 2011. Vol. 3. - doi:10.1371/currents.RRN1220.
119 Azuara D., Rodriguez-Moranta F., de O.J., Soriano-Izquierdo A., Mora J., Guardiola J., Biondo S., Blanco I., Peinado M.A., Moreno V., et al. Novel methylation panel for the early detection of colorectal tumors in stool DNA. Clin // Colorectal Cancer. - 2010. - Vol. 9. - P. 168-176.
120 Model F., Osborn N., Ahlquist D., Gruetzmann R., Molnar B., Sipos F., Galamb O., Pilarsky C., Saeger H.D., Tulassay Z., et al. Identification and validation of colorectal neoplasia-specific methylation markers for accurate classification of disease // Mol. Cancer Res. - 2007. - Vol. 5. - P. 153-163.
121 Carlson M.R. Previstage gcc colorectal cancer staging test: A new molecular test to identify lymph node metastases and provide more accurate information about the stage of patients with colorectal cancer // Mol. Diagn. Ther. - 2009. - Vol. 13. - P. 11-14.
122 Tan, I.B.; Tan P. Genetics: An 18-gene signature (coloprint(r)) for colon cancer prognosis // Nat.Rev. Clin. Oncol. - 2011. - Vol. 8. - P. 131-133.
123 Clark-Langone K.M., Sangli C., Krishnakumar J., Watson D. Translating tumor biology into personalized treatment planning: Analytical performance characteristics of the oncotype dx colon cancer assay // BMC Cancer. - 2010. - Vol. 10. - P. 691.
124 Bosch L.J., Carvalho B., Fijneman R.J., Jimenez C.R., PinedoH.M., van E.M., Meijer G.A. Molecular tests for colorectal cancer screening // Clin. Colorectal Cancer. - 2011. - Vol. 10. - P. 8-23.
125 Slaby O., Svoboda M., Michalek J., Vyzula R. MicroRNAs in colorectal cancer: translation of molecular biology into clinical application // Molecular Cancer. - 2009. - Vol. 8, № 102. - P. 1-13.
126 Wightman B., Ha I., et al. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans // Cell. - 1993. - Vol. 75, № 5. - P. 855-862.
127 Reinhart B. J., Slack F. J., et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans // Nature. - 2000. - Vol. 403, № 6772. - P. 901-906.
128 Pasquinelli A. E., Reinhart B. J., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA // Nature. - 2000. - Vol. 408, № 6808. - P. 86-89.
129 Baulcombe D. C. RNA as a target and an initiator of post-transcriptional gene silencing in transgenic plants // Plant Mol Biol. - 1996. - Vol. 32. - P. 79-88.
130 Fire A., et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans // Nature. 1998. - Vol. 391. - P. 806-811.
131 Brennecke J., Cohen S. M. Towards a complete description of the microRNA complement of animal genomes // Genome Biol. - 2003. - Vol. 4, № 9. - P. 228.
132 Xu P., Vernooy S. Y., et al. The Drosophila microRNA Mir-14 suppresses cell death and is required for normal fat metabolism // Curr Biol. - 2003. - Vol. 13, № 9. - P. 790-795.
133 Emery J. F., Floyd S. K., et al. Radial patterning of Arabidopsis shoots by class III HD-ZIP and KANADI genes // Curr Biol. - 2003. - Vol. 13, № 20. - P. 1768-1774.
134 Vasudevan S., Tong Y., Steitz J.A. Switching from repression to activation: microRNAs can up-regulate translation // Science. - 2007. - № 318. - P. 1931-4.
135 Mattaj I.W., Tollervey D., Seraphin B. Small nuclear RNAs in messenger RNA and ribosomal RNA processing/ The FASEB Journal. - 1993. - № 7. - P. 47-53.
136 Bachellerie J.P., Cavaille J., Huttenhoffer A. The expanding snoRNA world // Biochimie. - 2002. - № 84. - P. 775-90. 137 Ambros V., Lee R.C., Lavanway A., Williams P.T., Jewell D. MicroRNA and other tiny endogenous RNAs in C.elegans // Curr Biol. - 2003. - № 13. - P. 807-18.
138 Stower H. Small RNAs: piRNA surveillance in the C. elegans germline // Nature Reviews Genetics. - 2012. - Vol. 13. - P. 518-519.
139 Lagos-Quintana M., Rauhut R., et al. Identification of novel genes coding for small expressed RNAs // Science. - 2001. - Vol. 294, № 5543. - P. 853-858.
140 Lau N. C., Lim L. P., et al. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans // Science. - 2001. - Vol. 294, № 5543. - P. 858-862.
141 Lin S. L., Miller J. D., et al. Intronic microRNA (miRNA) // J Biomed Biotechnol. - 2006. - Vol. 4. - P. 26818.
142 Li S. C., Tang P., et al. Intronic microRNA: discovery and biological implications // DNA Cell Biol. - 2007. - Vol. 26, № 4. - P. 195-207.
143 Issabekova A.S., Berillo O.A., Khailenko V., Atambayeba S.A., Regnier M., Ivachshenko A.T. Characteristics of intronic and intergenic human miRNAs and features of their interaction with mRNA // Conference Proceeding "International Conference on Bioinformatics, Computational Biology and Biomedical Engineering". Paris. France. - 2011. - P.63-66. 144 Aravin A. A., Lagos-Quintana M., et al. The small RNA profile during Drosophila melanogaster development // Dev Cell. - 2003. - Vol. 5, № 2. - P. 337-350.
145 Lee Y., Kim M., Han J., Yeom K. H. H., Lee, S., Baek, S. H. H., Kim, V. N. MicroRNA genes are transcribed by RNA polymerase II // The EMBO journal. - 2004. - Vol. 23. - P. 4051-4060
146 Zeng Y., Wagner E. J., et al. Both natural and designed micro RNAs can inhibit the expression of cognate мРНКs when expressed in human cells // Mol Cell. - 2002. - Vol. 9, № 6. - P. 1327-1333.
147 Borchert G. M., Lanier W., et al. RNA polymerase III transcribes human microRNAs // Nat Struct Mol Biol. - 2006. - Vol. 13, № 12. - P. 1097-1101.
148 Lee Y., Ahn C., et al. The nuclear RNase III Drosha initiates microRNA processing // Nature. - 2003. - Vol. 425, № 6956. - P. 415-419.
149 Lund E., Guttinger S., et al. Nuclear export of microRNA precursors // Science. - 2004. - Vol. 303, № 5654. - P. 95-98.
150 Hammond S. M., Boettcher S., et al. Argonaute2, a link between genetic and biochemical analyses of RNAi // Science. - 2001. - Vol. 293, № 5532. - P. 1146-1150.
151 Ishizuka A., Siomi M. C., et al. A Drosophila fragile X protein interacts with components of RNAi and ribosomal proteins // Genes Dev. -2002. -Vol. 16, № 19. -P. 2497-2508.
152 Tabara H., Yigit E., et al. The dsRNA binding protein RDE-4 interacts with RDE-1, DCR-1, and a DExH-box helicase to direct RNAi in C. elegans // Cell. - 2002. - Vol. 109, № 7. - P. 861-871.
153 Kim V. N., Han J., et al. Biogenesis of small RNAs in animals // Nat Rev Mol Cell Biol. - 2009. - Vol. 10, № 2. - P. 126-139.
154 Denli A. M., Tops B. B., Plasterk R. H., Ketting R. F., Hannon G. J. Processing of primary microRNAs by the Microprocessor complex // Nature. - 2004. - Vol. 432. - P. 231-235 155 Gregory R. I., Yan K.P., Amuthan G., Chendrimada T., Doratotaj B., Cooch N., Shiekhattar R. The Microprocessor complex mediates the genesis of microRNAs // Nature. - 2004. - Vol. 432. - P. 235-240.
156 Wang Y., Medvid R., Melton C., Jaenisch R., Blelloch R. DGCR8 is essential for microRNA biogenesis and silencing of embryonic stem cell self-renewal // Nature genetics. - 2007. - Vol. 39. - P. 380-385.
157 Han J., Lee Y., Yeom K.H.H., Nam J.W.W., Heo I., Rhee J.K.K., Sohn S. Y. Y., Cho Y., Zhang B.T. T., Kim, V. N. Molecular basis for the recognition of primary microRNAs by the Drosha-DGCR8 complex // Cell. - 2006. - Vol. 125. - P. 887-901.
158 Lund E., G¨uttinger S., Calado A., Dahlberg J. E., Kutay U. Nuclear export of microRNA precursors // Science (New York, N.Y.). - 2004. - Vol. 303. - P. 95-98.
159 Meister G., Tuschl T. Mechanisms of gene silencing by double-stranded RNA // Nature. - 2004. - Vol. 431. - P. 343-349.
160 Forstemann K., Tomari Y., et al. Normal microRNA maturation and germ-line stem cell maintenance requires Loquacious, a double-stranded RNA-binding domain protein // PLoS Biol. - 2005. - Vol. 3, № 7. - e. 236.
161 Chendrimada T. P., Gregory R. I., et al. TRBP recruits the DICER complex to Ago2 for microRNA processing and gene silencing // Nature. - 2005. - Vol. 436, № 7051. - P. 740-744.
162 Gregory R. I., Yan K. P., et al. The Microprocessor complex mediates the genesis of microRNAs // Nature. - 2004. - Vol. 432, No, 7014. - P. 235-240.
163 Carthew R.W., Sontheimer E.J. Origins and mechanisms of miRNAs and siRNAs // Cell. - 2009. - Vol. 136. - P.642-655. 164 Hammond S. M., Boettcher S., et al. Argonaute2, a link between genetic and biochemical analyses of RNAi // Science. - 2001. - Vol. 293, № 5532. - P. 1146-1150.
165 Elbashir S. M., Harborth J., et al. Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells // Nature. - 2001. - Vol. 411, № 6836. - P. 494-498.
166 Yan K. S., Yan S., et al. Structure and conserved RNA binding of the PAZ domain // Nature. - 2003. - Vol. 426, № 6965. - P. 468-474.
167 Hutvagner G. Small RNA asymmetry in RNAi: function in RISC assembly and gene regulation // FEBS Lett. - 2005. - Vol. 579, № 26. - P. 5850-5857.
168 Rajewsky Nikolaus. microRNA target predictions in animals // Nat Genet. 38 Suppl (2006a): S8-13
169 Baek D., Villen J., Shin C., Camargo F.D., Gygi S.P., Bartel D.P. The impact of microRNAs on protein output // Nature. - 2008. - Vol. 455. - P. 64-71.
170 Huang T.H., Fan B., Rothschild M.F., Hu Z.L., Li K., Zhao S.H. miRFinder: an improved approach and software implementation for genome-wide fast microRNA precursor scans // BMC Bioinformatics. - 2007. - Vol. 8. - P. 341.
171 Zhang Y., Fons J. Verbeek. Comparison and integration of target prediction algoritms for microRNA studies // J. of Integrative Bioinformatics. - 2010. - Vol. 7, № 3. - P. 127. 172 Wilson P.A., Plucinski M. A simple Bayesian estimate of direct RNAi gene regulation events from different gene expression profiles // BMC Genomics. - 2011. - Vol. 12, No 250. 173 Krek Azra, et al. Combinatorial microRNA target predictions // Nat Genet. - 2005. - Vol. 37, № 5. - P. 495-500.
174 Grun D., Wang Y.L., Langenberger D., Gunsalus K.C., Rajewsky N. microRNA target predictions across seven Drosophila species and comparison to mammalian targets // PLoS Comp Biol. - 2005. - Vol. 1, № 1. - e. 13.
175 Nikolaus Rajewsky. microRNA target predictions in animals // NATURE GENETICS SUPPLEMENT. - 2006. - Vol. 38. - P. 1-6.
176 Kiriakidou, Marianthi, et al. A combined computational-experimental approach predicts human microRNA targets // Genes Dev. - 2004. - Vol. 18, № 10. - P. 1165-1178. 177 Min, Hyeyoung, Sungroh Yoon. Got target? Computational methods for microRNA target prediction and their extension // Exp Mol Med. - 2010. - Vol. 42, № 4. - P. 233-244
178 Selbach M., Schwanhäusser B., Thierfelder N., Fang Z., Khanin R., Rajewsky N. Widespread changes in protein synthesis induced by microRNAs // Nature. - 2008. - Vol. 455. - P. 58-63. 179 Enright, Anton J., Bino John, Ulrike Gaul, Thomas Tuschl, Chris Sander, Debora S. Marks. MicroRNA targets in Drosophila // Genome Biol. - 2003. - Vol. 5, № 1. - R 1.
180 Wuchty S., Fontana W., Hofacker I.L., Schuster P. Complete suboptimal folding of rna and the stability of secondary structures // Biopolymers. - 1999. - Vol. 49. - P. 145-165. 181 John, Bino, Anton J. Enright, Alexei Aravin, Thomas Tuschl, Chris Sander, Debora S. Marks. Human MicroRNA targets // PLoS Biol. - 2004. - Vol. 2, № 11. - e. 363.
182 Stark A., Brennecke J., Russell R.B., Cohen S.M. Identification of Drosophila MicroRNA targets // PloS Biol. - 2003. - Vol. 1. - E60.
183 Hofacker I.L. Vienna RNA secondary structure server // Nucleic Acid Res. - 2003. - Vol. 31. - P. 3429-3431.
184 Matherws D.H., Sabina J., Zuker M., Turner D.H. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure // J. Mol. Biol. - 1999. - Vol. 288. - P. 911-940.
185 Rehmsmeier M., Steffen P., Hochsmann M., Giegerich R. Fast and effective prediction of microRNA/target duplexes // RNA. - 2004. - Vol. 10. - P. 1507-17.
186 Fang Z., Rajewsky N. The impact of miRNA target sites in coding sequences and in 3'UTRs // PLoS ONE. - 2011. - Vol. 6, № 3. - e. 18067. 187 Schnall-Levin M., Rissland O.S., Johnston W.K., Perrimon N., Bartel D.P., Berger B. Unusually effective microRNA targeting within repeart-rich coding regions of mammalian mRNAs // Genome Rasearch. - 2011. - Vol. 21, № 9. - P. 1395-1403.
188 Maziere P., Enright A.J. Prediction of microRNA targets // Drug Discov. Today. - 2007. - Vol. 12. - P. 452-458.
189 Reinhart B.J., Slack F.J., Basson M., Pasquinelli A.E., Bettinger J.C. et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans // Nature. 2000. - Vol. 403. - P. 901-906. 190 Wightman B., Ha I., Ruvkun G. Posttranscriptional regulation in heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans // Cell. - 1993. - Vol. 75. - P. 855-862.
191 Ha I., Wightman B., Ruvkun G. A buldge lin-4/lin-14 RNA duplex is sufficient for caenorhabditis elegans lin-14 temporal gradient formation // Genes Dev. - 1996. - Vol. 10. - P. 3041-3050.
192 Abrahante J.E., Daul A.L., Li M., Volk M.L., Tennessen J.M., et.al. The Caenorhabditis elegans hunchback-like gene lin-57/hbl-1 controls developmental time and is regulated by microRNAs // Dev Cell. - 2003. - Vol. 4. - P. 625-637.
193 Lin S.Y., Johnson S.M., Abraham M., Vella M.C., Pasquinelli A., Gamberi C., Gottlieb E., Slack F.J. The C. elegans hunchback homolog, hbl-1, controls temporal patterning and is a probable microRNA target // Dev.Cell. - 2003. - Vol. 4. - P. 639-650.
194 Kiriakidou M., Nelson P.T., Kouranov A., Fitziev P., Bouyioukos C., et al. A combined computational-experimental approach predicts human microRNA targets // Genes Dev. - 2004. - Vol. 18. - P. 1165-1178. 195 Doench J.G., Sharp P.A. Specificity of microRNA target selection in translational repression // Genes. Dev. - 2004. - Vol. 18. - P. 504-511. 196 Brennecke J., SterkA., Russell R.B., Cohen S.M. Principles of microRNA-target recognition // Plos Biology. - 2005. - Vol. 3. - P. 0404-0418. e85. 197 Kuhn D.E., Martin M.M., Feldman D.S., Terry A.V. Jr Nuovo G.J., Elton,T.S. // Experimental validation of miRNA targets. Methods. - 2008. - Vol. 44. - P. 47-54.
198 Daniel W. Thomson, Cameron P. Bracken, Gregory J. Goodall. Experimental strategies for microRNA target identification // Nucleic Acids Research. - 2011. - P 1-9. doi:10.1093/nar/gkr330
199 Elmen J., Lindow M., Schutz S., Lawrence M., Petri A., Obad S.,Lindholm M., Hedtjarn M., Hansen H.F., Berger U., et al. LNA-mediated microRNA silencing in non-human primates // Nature. - 2008. - Vol. 452. - P. 896-899.
200 Lim L.P., Lau N.C., Garrett-Engele P., Grimson A., Schelter J.M., Castle J., Bartel D.P., Linsley P.S., Johnson J.M. Microarray analysis shows that some microRNAs downregulate large numbers of target мРНКs // Nature. - 2005. - Vol. 433. - P. 769-773.
201 Park S.M., Gaur A.B., Lengyel E., Peter M.E. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2 // Genes Dev. - 2008. - Vol. 22. - P. 894-907. 202 EasowG., Teleman A.A., Cohen S.M. Isolation of microRNA targets by miRNP immunopurification // RNA. - 2007. - Vol. 13. - P. 1198-1204.
203 Hafner M., Landthaler M., Burger L., Khorshid M., Hausser J., Berninger P., Rothballer A., Ascano M., Jr. Jungkamp A.C., Munschauer M., et al. Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP // Cell. 2010. - Vol. 141. - P. 129-141.
204 Hendrickson D.G., Hogan D.J., Herschlag D., Ferrell J.E., Brown P.O. Systematic identification of мРНКs recruited to argonaute 2 by specific microRNAs and corresponding changes in transcript abundance // PLoS ONE. - 2008. - Vol. 3. - e 2126.
205 Chi S.W., Zang J.B., Mele A., Darnell R.B. Argonaute HITS-CLIP decodes microRNA-мРНК interaction maps // Nature. - 2009. - Vol. 460. - P. 479-486.
206 Zisoulis D.G., Lovci M.T., Wilbert M.L., Hutt K.R., Liang T.Y.,Pasquinelli A.E., Yeo,G.W. Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans // Nat. Struct. Mol. Biol. - -2010. - Vol. 17. - P. 173-179.
207 Hafner M., Landthaler M., Burger L., Khorshid M., Hausser J., Berninger P., Rothballer A., Ascano M., Jungkamp A.C., Munschauer M., Ulrich A., Wardle G.S., Dewell S., Zavolan M., Tuschl T. PAR-CliP - a mothod to identify transcriptome-wide the binding sites of RNA binding proteins // J. Vis. Exp. - 2010. - Vol. 41. - doi: 10.3791/2034.
208 Orom U.A., Lund A.H. Isolation of microRNA targets using biotinylated synthetic microRNAs // Methods. - 2007. - Vol. 43. - P. 162-165.
209 Vatolin S., Navaratne K., Weil R.J. A novel method to detect functional microRNA targets // J. Mol. Biol. - 2006. - Vol. 358. - P. 983-996.
210 Yang Y., Chaerkady R., Kandasamy K., Huang T.C., Selvan L.D., Dwivedi S.B., Kent O.A., Mendell J.T., Pandey A. Identifying targets of miR-143 using a SILAC-based proteomic approach // Mol. Biosyst. - 2010. - Vol. 6. - P. 1873-1882.
211 Thanasis Vergoulis, Ioannis S. Vlachos, Panagiotis Alexiou, George Georgakilas, Manolis Maragkakis, Martin Reczko, et al. TarBase 6.0: capturing the exponential growth of miRNA targets with experimental support // Nucleic Acids Research. - 2011. - P. 1-8. doi:10.1093/nar/gkr1161
212 Lim LP., Glasner ME., Yekta S., Burge CB., Bartel DP. Vertebrate microRNA genes // Science. - 2003. - Vol. 299. - P. 1540.
213 Reinhart BJ., Weinstein EG., Rhoades MW., Bartel B., Bartel DP. MicroRNAs in plants // Genes Dev. - 2002. - Vol. 16. - P. 1616.-1626.
214 Lim L., Lau N., Weinstein E. et al. The microRNAs of C. elegans // Genes Dev. - 2003. - Vol. 17. - P. 991-1008.
215 Pfeffer S., Zavolan M., Grasser FA.,Chein M., Russo JJ., Ju J., John B., Enright AJ., Marks D., Sander C., Tuschl T. Identification of virus-encoded microRNAs // Science. - 2004. - № 304. - P. 734-736.
216 Enquela-Kerscher A., Slack F.J. Oncomirs - microRNAs with a role in cancer // Nat Rev Cancer. - 2006. - № 6. - P. 259-269.
217 Lynam-Lennon N., Staphen G., Reynold M., Reynold J. The role of microRNA in cancer and apoptosis // Biol.Reviews. - 2009. - № 84. - P. 55-71.
218 He L., Thomson J.M., Hemann M.T., Hernando-Monge E., Mu D., Goodson S., Powers S., Cordon-Cardo C., Lowe S.W., Hannon G.J., et al. A microRNA polycistron as a potential human oncogene // Nature. - 2005. - № 435. - P. 828-833.
219 Griffiths-Jones S., Enright A.J., Farazi T.A. et al. MicroRNA research // The 2008 Collection booklet: Exiqon. - 2008. - P. 36.
220 Ryazansky S.S., Gvozdev V.A. Small RNAs and Cancerogenesis // Biochemistry. - 2008. - Vol. 73. - № 5. - P. 514-527.
221 Esquela-Kerscher A., Slack F.J. Oncomirs - microRNA with a role in cancer // Nat Rev Cancer. - 2006. - Vol. 6, No 4. - P. 259-269.
222 Fearon ER., Vogelstein B. A genetic model for colorectal tumorigenesis // Cell. - 1990. - № 61. - P. 759-767.
223 Nagel R., Le Sage C., Diosdado B., Waal M., Oude Vrielink JA., Boligin A., Meijer GA., Agami R. Regulation of the adenomatous polyposis coli gene by the miR-135 family in colorectal cancer // Cancer Res. - 2008. - № 68. - P. 5795-5802.
224 Cierdiello F., Tortora G. EGFR antagonists I cancer treatment // N Engl J Med. - 2008. - № 358. - P. 1160-1174.
225 Kressner U., Bjorheim J., Westring S.,Wahlberg S.S., Pahlman L., Glimelius B., Lindmark G., Lindblom A., Borresen-Dale A.L. Ki-ras mutation and prognosis in colorectal cancer // Eur. J. Cancer. - 1998. - № 34. - P. 518-521.
226 Shields J.M., Pruitt K., McFall A., Shaub A., Der C.J. Understanding ras: 'it ain't over 'til it's over // Trends Cell. Biol. - 2000. - № 10. - P. 147-154.
227 Campbell S.L., Khosravi-Far R., Rossman K.L., Clark G.J., Der C.J. Increasing complexity of Ras signaling // Oncogene. - 1998. - № 17. - P. 1395-1413.
228 Johnson SM., Grosshans H., Shingara J., Byrom M., Jarvis R., Cheng A., Labourier E., Reinert KL., Brown D., Slack FJ. RAS is regulated by the let-7 microRNA family // Cell. - 2005. - № 120. - P. 635-647.
229 Akao Y., Nakagawa Y., Naoe T. let-7 microRNA functions as a potential growh suppressor in human colon cancer cells // Biol Pharm Bull. - 2006. - № 29. - P. 903-906.
230 Chen X., Guo X., Zhang H., Xiang Y., Cheng J., Yin Y., et al. Role of miR-143 targeting KRAS in colorectal tumorigenesis // Oncogene. - 2009. - № 28. - P. 1385-1392.
231 Tsang WP., Kwok TT. The miR-18a* microRNA functions as a potential tumor suppressor by targeting on K-RAS // Carcinogenesis. - 2009. - № 30. - P. 953-959.
232 Guo C., Sah JF., Beard L., Willson JK., Markowitz SD., Guda K. The non-coding RNA, miR-126, suppresses the growth of neoplastic cells by targeting phosphatidylinositol 3-kinase signaling and is frequently lost in colon cancers // Genes Chromosomes Cancer. - 2008. - № 47. - P. 939-946.
233 Meng F., Henson R., Wehbe-Janek H., Groshal K., Jacob ST., Patel T. MicroRNA-21 regulated expression of the PTEN tumor suppressor gene in human hepatocellular cancer // Gastroenterology. - 2007. - № 133. - P. 647-658.
234 Krichevsky AM., Gabriely G. miR-21: a small multi-faceted RNA // J Cell Mol Med. - 2009. - № 13. - P. 39-53.
235 He L., He X., Lowe SW., Hannon GJ. microRNAs join the p53 network-another piece in the tumour-suppression puzzle // Nat Rev Cancer. - 2007. - № 7. - P. 819-822.
236 Hermeking H. p53 enters the microRNA world // Cancer Cell. - 2007. - № 12. - P. 414-418. 237 Chang TC., Wentzel EA., Kent OA., Ramachandran K., Mullendore M., et al. Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis // Mol Cell. - 2007. - № 26. - P. 745-752.
238 Toyota M., Suzuki H., Sasaki Y., Maruyama R., Imai K., Shinomura Y., Tokino T. Epigenetic silencing of microRNA-34b/c and B-cell Tanslocation gene 4 is associated with CpG island methylation in colorectal cancer // Cancer Res. - 2008. - № 68. - P. 4123-4132.
239 Lee E.J., Gusev Y., Jiang J., Nuovo G.J., Lerner M.R., Frankel W.L., Morgan D.L., Postier R.G., Brackett D.J., Schmittgen T.D. Expression profiling identifies microRNA signature in pancreatic cancer // Int. J. Cancer. - 2007. - № 120. - P. 1046-1054. 240 Volinia S., Calin GA., Liu CG., Ambos S., Cimmino A., Petrocca F., et al. A microRNA expression signature of human solid tumors defines cancer gene targets // Proc Nati Acad Sci USA. - 2006. - № 103. - P. 2257-2261.
241 Bandres E., Cubedo E., Agirre X., Malumbres R., Zarate R., Ramirez N., Abajo A., Navarro A., Moreno I., Monzo M., Garcia-Foncillas J. Identification by Real-time PCR of 13 mature microRNAs differentially expressed in colorectal cancer and non-tumoral tissues // Mol. Cancer. - 2006. - № 5. - P. 29.
242 Spizzo R., Nicoloso M.S., Lupini L. et.al. miR-145 participates with TP53 in a death-promoting regulatory loop and targets estrogen receptor-alpha in human breast cancer cells // Cell death differ. - 2010. - Vol. 17, № 2. - P. 246-54.
243 Xia L., Zhang D., Du R., Pan Y., Zhao L., Sun S., Hong L., Liu J., Fan D. MiR-15 and miR-16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells // Int J Cancer. - 2008. - № 123. - P. 372-9. 244 Kumar MS., Lu J., Mercer KL., Golub TR., Jacks T. Impaired microRNA processing enhances cellular transformation and tumorigenesis // Nat Genet. - 2007. - № 39. - P. 673-7. 245 Samowitz W.S., Slattery M.L., Sweeney C., Herrick J.,Wolff R.K., Albertsen H. APC Mutations and Other Genetic and Epigenetic Changes in Colon Cancer // Mol Cancer Res. - 2007. - Vol. 5, №2. - P.165-170.
246 Jin L.H., Shao Q.-J., Luo W., Ye Z.-Y., Li Q., Lin S.-C. Detection of point mutations of the axin1 gene in colorectal cancers // Int. J. Cancer. - 2003. - Vol.107. - P. 696-699.
247 Hughes T.A., Brady H.J. Regulation of axin2 expression at the levels of transcription, translation and protein stability in lung and colon cancer // Cancer Lett. - 2006. Vol. 233, № 2. - P. 338-47.
248 Løvig T., Meling G. I., Diep C. B., Thorstensen L., Andersen S.N., Lothe R. A., Rognum T.O. APC and CTNNB1 Mutations in a Large Series of Sporadic Colorectal Carcinomas Strati ed by the Microsatellite Instability Status // Scand J Gastroenterol. - 2002. - Vol.10. - P. 1184-1193.
249 Ueno K., Hiura M., Suehiro Y., Hazama S., Hirata H., Oka M., Imai K., Dahiya R., Hinoda Y. Frizzled-7 as a potential therapeutic target in colorectal cancer // Neoplasia. - 2008. - Vol.10, №7. - P. 697-705.
250 Caspi M., Zilberberg A., Eldar-Finkelman H., Arbesfeld R.R. Nuclear GSK-3b inhibits the canonical Wnt signalling pathway in a b-catenin phosphorylation-independent manner // Oncogene. - 2008. -P 1-10. doi:10.1038/sj.onc.1211026
251 Fox E.J., Leahy D.T., Geraghty R., Mulcahy H.E., Fennelly D., Hyland J.M., et al. Exclusive Promoter Hypermethylation Patterns of hMLH1 and O6-Methylguanine DNA Methyltransferase in Colorectal Cancer // Journal of Molecular Diagnostics. - 2006. - Vol.8, №1 - P. 68-75.
252 Wu Y., Berends M.J.W., Sijmons R.H., Mensink R.G.J., Verlind E., Kooi K.A., et al. A role for MLH3 in hereditary nonpolyposis colorectal cancer // Nature Genetics. - 2001. - Vol. 29. - P. 137 - 138. doi:10.1038/ng1001-137
253 Hegde M., Blazo M., Chong B., Prior T., Richards C. Assay Validation for Identification of Hereditary Nonpolyposis Colon Cancer-Causing Mutations in Mismatch Repair Genes MLH1, MSH2, and MSH6 // Journal of Molecular Diagnostics. - 2005. - Vol. 7, № 4 - P. 525-534.
254 Takahashi M., Koi M., Balaguer F., Boland C.R., Goel A. MSH3 mediates sensitization of colorectal cancer cells to cisplatin, oxaliplatin, and a poly(ADP-ribose) polymerase inhibitor // J Biol Chem. - 2011. - Vol. 286, № 14. - P. 12157-65.
255 Boxtel R., Toonen P.W., Roekel H.S., Verheul M., Smits B.M.G., Korving J., Bruin A., Cuppen E. Lack of DNA mismatch repair protein MSH6 in the rat results in hereditary non-polyposis colorectal cancer-like tumorigenesis // Carcinogenesis. 2008. - Vol. 29, № 6. - P. 1290-1297. doi:10.1093/carcin/bgn094
256 Filipe B., Baltazar C., Albuquerque C., Fragoso S., Lage P., Vitoriano I., Mão de Ferro S., Claro I., Rodrigues P., Fidalgo P., Chaves P., Cravo M., Nobre Leitão C. APC or MUTYH mutations account for the majority of clinically well-characterized families with FAP and AFAP phenotype and patients with more than 30 adenomas // Clin Genet. - 2009. - Vol. 76, № 3. - P. 242-55.
257 Camps J., Armengol G., Rey J., Lozano J.J., Vauhkonen H., Prat E., Egozcue J., Sumoy L., Knuutila S., Miro R. Genome-wide differences between microsatellite stable and unstable colorectal tumors // Carcinogenesis. - 2006. - Vol. 27, № 3. - P. 419-428.
258 Lee J.W., Soung Y.H., Kim S.Y., Nam S.W., Kim C.J., Cho Y.G., Lee J.H., Kim H.S., Park W.S., Kim S.H., Lee J.Y., Yoo N.J.,Lee S.H. Inactivating mutations of proapoptotic Bad gene in human colon cancers // Carcinogenesis. - 2004 - Vol. 25, № 8. - P. 1371-1376.
259 Tu S., Sun R.W-Y., Lin M.C.M., Cui J.T., Zou B., Gu Q., Kung H.F., Che C.M., Wong B.C.Y. Gold (III) porphyrin complexes induce apoptosis and cell cycle arrest and inhibit tumor growth in colon cancer // Cancer. - 2009. Vol. 115, № 19. P. 4459 - 4469.
260 Jaffrey R.G., Pritchard S.C., Clark C., Murray G.I., Cassidy J., Kerr K.M., Nicolson M.C., McLeod H.L. Genomic instability at the BUB1 locus in colorectal cancer, but not in non-small cell lung cancer // Cancer Res. - 2000. - Vol. 60, № 16. - P. 4349-52.
261 Sawai H., Yasuda A., Ochi N., Ma J., Matsuo Y., Wakasugi T., Takahashi H., Funahashi H., Sato M., Takeyama H. Loss of PTEN expression is associated with colorectal cancer liver metastasis and poor patient survival // BMC Gastroenterology. - 2008. - Vol. 8, № 56. - doi:10.1186/1471-230X-8-56.
262 Seth R., Keeley J., Abu-Ali G., Crook S., Jackson D., Ilyas M. The putative tumour modifier gene ATP5A1 is not mutated in human colorectal cancer cell lines but expression levels correlate with TP53 mutations and chromosomal instability // J. Clin. Pathol. - 2009. - Vol. 62. - P. 598-603.
263 Zhang L., Ren X., Alt E., Bai X., Huang S., Xu Z., Lynch P.M., Moyer M.P., Wen X.-F., Wu X. Chemoprevention of colorectal cancer by targeting APC-deficient cells for apoptosis // Nature. - 2010. Vol. 464. - P. 1058-1061.
264 Bryan E.J., Jokubaitis V.J., Chamberlain N.L., Baxter S.W., Dawson E., Choong D.Y., Campbell I.G. Mutation analysis of EP300 in colon, breast and ovarian carcinomas // Int J Cancer. - 2002. Vol. 102, № 2. - P. 137-41.
265 Porter T.R., Richards F.M., Houlston R.S., Evans D.G.R., Jankowski J.A., Macdonald F., Norbury G., Payne S.J., Fisher S.A., Tomlinson I., Maher E.R. Contribution of cyclin d1 (CCND1) and E-cadherin (CDH1) polymorphisms to familial and sporadic colorectal cancer // Oncogene. - 2002. Vol. 21, №12. - P. 1928-1933.
266 Ashktorab H., Schäffer A.A., Daremipouran M., Smoot D.T., Lee E., Brim H. Distinct Genetic Alterations in Colorectal Cancer // PLoS One. - 2010. Vol. 5, № 1. - e8879. 267 Weichert W., Knösel T., Bellach J., Dietel M., Kristiansen G. ALCAM/CD166 is overexpressed in colorectal carcinoma and correlates with shortened patient survival // J Clin Pathol. - 2004. - Vol. 57, № 11. - P. 1160-1164.
268 Wheeler J., Kim H., Efstathiou J., Ilyas M., Mortensen N., Bodmer W. Hypermethylation of the promoter region of the E-cadherin gene (CDH1) in sporadic and ulcerative colitis associated colorectal cancer // Gut. - 2001. - Vol. 48, № 3.- P. 367-371.
269 Shiah S-G., Tai K.-Y., Wu C.-W. Epigenetic Regulation of EpCAM in Tumor Invasion and Metastasis // Journal of Cancer Molecules. - 2008. - Vol. 3, № 6. - P. 165-168.
270 Li G., Liu C., Yuan J., Xiao X., Tang N., Hao J., Wang H., Bian X., Deng Y., Ding Y. CD133(+) single cell-derived progenies of colorectal cancer cell line SW480 with different invasive and metastatic potential // Clin Exp Metastasis. - 2010. - Vol. 27, № 7. - P. 517-27.
271 Tol J.,Nagtegaal I.D., Punt C.J.A. BRAF Mutation in Metastatic Colorectal Cancer // N Engl J Med. - 2009. - Vol. 361. - P. 98-99.
272 Castro-Carpeño J., Belda-Iniesta C., Sáenz E.C., Agudo E.H., Batlle J.F., Barón M.G. EGFR and colon cancer: a clinical view // Clinical and Translational Oncology. - 2008. - Vol. 10, № 1. - P. 6-13. DOI: 10.1007/s12094-008-0147-3
273 Markman B., Javier Ramos F., Capdevila J., Tabernero J. EGFR and KRAS in colorectal cancer // Adv Clin Chem. - 2010. - Vol. 51. - P. 71-119.
274 Smith D.R., Goh H.S. Overexpression of the c-myc proto-oncogene in colorectal carcinoma is associated with a reduced mortality that is abrogated by point mutation of the p53 tumor suppressor gene // Clin Cancer Res. - 1996. - Vol. 2. - P. 1049-1053.
275 Langers A.M.G., Sier C.F.M., Hawinkels L.J.L.C., Kubben F.G.J.M., van Duijn W., et al. MMP-2 geno-phenotype is prognostic for colorectal cancer survival, whereas MMP-9 is not // Br J Cancer. - 2008. - Vol. 98, № 11. - P. 1820-1823.
276 Wilson S., Wakelam M.J.O., Hobbs R.F.D., Ryan A.V., Dunn J.A., Redman V.D., et al. Evaluation of the accuracy of serum MMP-9 as a test for colorectal cancer in a primary care population // BMC Cancer. - 2006. - Vol. 6, № 258. - doi:10.1186/1471-2407-6-258.
277 Corrêa S., Binato R., Rocher B.D., Castelo-Branco M.T.L., Pizzatti L., Abdelhay E. Wnt/β-catenin pathway regulates ABCB1 transcription in chronic myeloid leukemia // BMC Cancer. - 2012. - Vol. 12, № 303. - doi:10.1186/1471-2407-12-303.
278 Wilson P.M., Ladner R.D., Lenz H.-J. Predictive and Prognostic Markers in Colorectal Cancer // Gastrointest Cancer Res. - 2007. - Vol. 1, № 6. - P. 237-246. 279 Zhu M.M., Tong J.L., Xu Q., Nie F., Xu X.T., Xiao S.D., Ran Z.H. Increased JNK1 Signaling Pathway Is Responsible for ABCG2-Mediated Multidrug Resistance in Human Colon Cancer // PLoS ONE. - 2012. - Vol. 7, № 8. - e41763. doi:10.1371/journal.pone.0041763
280 McConnell B.B., Yang V.W. Mammalian Krüppel-Like Factors in Health and Diseases // Physiol Rev. - 2010. - Vol. 90, No .4. - P. 1337-1381.
281 Spaderna S., Schmalhofer O., Wahlbuhl M., Dimmler A., Bauer K., Sultan A., Hlubek F., Jung A., Strand D., Eger A., Kirchner T., Behrens J., Brabletz T. The Transcriptional Repressor ZEB1 Promotes Metastasis and Loss of Cell Polarity in Cancer // Cancer Res. - 2008. - Vol. 68, № 2. - P.537-544.
282 Peña C., García J.M., Larriba M.J., Barderas R., Gómez I., Herrera M., et al. SNAI1 expression in colon cancer related with CDH1 and VDR downregulation in normal adjacent tissue // Oncogene. - 2009. - Vol. 28, № 49. - P. 4375-85.
283 Trump D.L., Johnson C.S. Vitamin D and Cancer // Springer. - 2011. - P. 342.
284 Du L., Wang H., He L., Zhang J., Ni B., Wang X., Jin H., Cahuzac N., Mehrpour M., Lu Y., Chen Q. CD44 is of Functional Importance for Colorectal Cancer Stem Cells // Clin Cancer Res. - 2008. - Vol. 14. - P. 6751-7967.
285 Boccaccio C., Comoglio P.M. Invasive growth: a MET-driven genetic programme for cancer and stem cells // Nature Reviews Cancer. - 2006. - Vol. 6. - P. 637-645.
286 Lennartsson J., Rönnstrand L. The Stem Cell Factor Receptor/c-Kit as a Drug Target in Cancer // Current Cancer Drug Targets. - 2006. - Vol. 6. - P. 561-571.
287 Kopetz S. Targeting Src and Epidermal Growth Factor Receptor in Colorectal Cancer: Rationale and Progress Into the Clinic // Gastrointest Cancer Res 1(suppl 2). - 2007. - P. S37-S41.
288 Rustgi A.K. The genetics of hereditary colon cancer // Genes & Dev. - 2007. - Vol. 21. - P. 2525-2538.
289 Biswas S., Trobridge P., Romero-Gallo J., Billheimer D., Myeroff L.L., Willson J.K., et al. Mutational inactivation of TGFBR2 in microsatellite unstable colon cancer arises from the cooperation of genomic instability and the clonal outgrowth of transforming growth factor beta resistant cells // Genes Chromosomes Cancer. - 2008. - Vol. 47, № 2. - P.95-106. 290 Hawinkels L.J.A.C., Zuidwijk K., Verspaget H.W., de Jonge-Muller E.S.M., van Duijn W., Ferreira V., et al. VEGF release by MMP-9 mediated heparan sulphate cleavage induces colorectal cancer angiogenesis // European Journal of Cancer. - 2008. - Vol. 44, № 13. - P. 1904-1913.
291 Sartore-Bianchi A., Martini M., Molinari F., Veronese S., Nichelatti M., Artale S., et al. PIK3CA Mutations in Colorectal Cancer Are Associated with Clinical Resistance to EGFR-Targeted Monoclonal Antibodies // Cancer Res. - 2009. - Vol. 69. - P 1851-1857.
292 Woodford-Richens K.L., Rowan A.J., Gorman P., Halford S., Bicknell D.C., Wasan H.S., et al. SMAD4 mutations in colorectal cancer probably occur before chromosomal instability, but after divergence of the microsatellite instability pathway // PNAS. - 2001. - Vol. 98, № 17. - P. 9719-9723.
293 Wu P.P., Jin Y.L., Shang Y.F., Jin Z., Wu P., Huang P.L. Restoration of DLC1 gene inhibits proliferation and migration of human colon cancer HT29 cells // Ann Clin Lab Sci. - 2009. - Vol. 39, № 3. - P. 263-9.
294 Julien S.G., Dubé N., Hardy S., Tremblay M.L. Inside the human cancer tyrosine phosphatome // Nature Reviews Cancer. - 2011. - Vol. 11. - P. 35-49.
295 Idziaszczyk S., Wilson C.H., Smith C.G., Adams D.J., Cheadle J.P. Analysis of the frequency of GNAS codon 201 mutations in advanced colorectal cancer // Cancer Genetics and Cytogenetics. - 2010. - Vol. 202, № 1. - P. 67-69.
296 Ryan B.M., Molloy A.M., McManus R., Arfin Q., Kelleher D., Scott J.M., Weir D.G. The methylenetetrahydrofolate reductase (MTHFR) gene in colorectal cancer: role in tumor development and significance of allelic loss in tumor progression // Int J Gastrointest Cancer. - 2001. - Vol. 30, № 3. - P.105-11. 297 Lu X., Wei W., Fenton J., Nahorski M.S., Rabai E., Reiman A., et al. Investigation of the Birt-Hogg-Dube tumour suppressor gene (FLCN) in familial and sporadic colorectal cancer // J Med Genet. - 2010. - Vol. 47, № 6. - P. 385-90.
298. Иващенко А.Т., Исабекова А.С., Берилло О.А., Хайленко В.А., Ащеулов А.С., Атамбаева Ш.А. Создание информационных баз микроРНК и белок-кодирующих генов участвующих в онкогенезе // КазҰМУ хабаршысы. - 2010. -№ 1. -С. 204-205.
299. Иващенко А.Т., Хайленко В.А., Берилло О.А., Исабекова А.C., Атамбаева Ш.А., Кабдуллина А.А. Проблемы ранней молекулярной диагностики онкологических заболеваний // Вестник КазНУ. Серия биологическая. - 2010. - №1 (43). - С. 29-35.
300 Nakajima G., Hayashi K., Xi Y. et al. Non-coding MicroRNAs hsa-let-7g and hsa-miR-181b are Associated with Chemoresponse to S-1 in Colon Cancer // Cancer Genomics Proteomics. - 2006. - Vol. 3, № 5. - P. 317-324. 301 Lu J., Getz G., Miska E.A. et al. MicroRNA expression profiles classify human cancers // Nature. - 2005. - Vol. 435, № 7043. - P. 834-8.
302 Michael M.Z., Connor S.M., van Holst Pellekaan N.G. et al. Reduced accumulation of specific microRNAs in colorectal neoplasia // Mol Cancer Res. - 2003. - Vol. 1. - P. 882-91.
303 Pillai R.S., Bhattacharyya S.N., Artus C.G. et al. Inhibition of translational initiation by let-7 microRNA in human cells // Sceince. - 2005. - Vol. 309. - P. 1573-1576.
304 Gregersen L.H., Jacobsen A.B., Frankel L.B. et al. MicroRNA-145 Targets YES and STAT1 in Colon Cancer Cells // PLoS One. - 2010. - Vol. 5. - I.1. 305 Calin G.A., Dumitru C.D., Shimizu M. et al. Frequent deletions and downregulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia // Proc Natl Acad Sci USA. - 2002. - Vol. 99. - P. 15524-9.
306 Tazawa H., Tsuchiya N., Izumiya M., Nakagama H. Tumor-suppressive miR-34a induces senescence-like growth arrest through modulation of the E2F pathway in human colon cancer cells // PNAS. - 2007. - Vol. 104, № 39. - P.15472-15477.
307 Akao Y., Nakagawa Y., Naoe T. let-7 MicroRNA functions as a potential growth suppressor in human // Biol. Pharm. Bull. - 2006. - Vol. 29, № 5. - P. 903-906.
308 Bandres E., Cubedo E., Agirre X. et al. Identification by realtime PCR of 13 mature microRNAs differentially expressed in colorectal cancer and non-tumoral tissues // Mol Cancer. - 2006. - Vol. 5. - P. 29.
309 Asangani I.A., Rasheed S.A.K., Nikolova D.A. et al. MicroRNA-21 (miR-21) post-transcriptionally downregulatestumor suppressor Pdcd4 and stimulates invasion, intravasationand metastasis in colorectal cancer // Oncogene. - 2008. - Vol. 27. - P. 2128-2136.
310 Slaby O., Svoboda M., Fabian P. et al. Altered expression of miR-21, miR-31, miR-143 and miR-145 is related to clinicopathologic features of colorectal cancer // Oncology. - 2007. - Vol. 72. - P. 397-402.
311 Guo C., Sah J.F., Beard L. et al. The noncoding RNA, miR-126, suppresses the growth of neoplastic cells by targeting phosphatidylinositol 3-kinase signaling and isfrequently lost in colon cancers // Genes Chromosomes Cancer. - 2008. - Vol. 47. - P. 939 - 46.
312 Link A., Balaguer F., Shen Y. et al. Fecal microRNAs as novel biomarkers for colon cancer screening // Cancer Epidemiol Biomarkers Prev. - 2010. - Vol. 19, № 7. - P. 1766-74.
313 Xi Y., Formentini A., Chien M. et al. Prognostic values of microRNAs in colorectal cancer // Biomarker Insights. - 2006. - Vol. 1. - P. 113-121.
314 Ng E.K.O., Chong W.W.S., Jin H. et al. Differential expression of microRNAs in plasma of patients with colorectal cancer: a potential marker for colorectal cancer screening // Gut. - 2009. - Vol. 58. - P. 1375-1381. 315 Motoyama K., Inoue H., Takatsuno Y. et al. Over- and under-expressed microRNAs in human colorectal cancer // IJ Oncology. - 2009. - Vol. 34. - P. 1069-1075. 316 Schetter A.J., Leung S.Y., Sohn J.J. et al. MicroRNA expression profiles associated with prognosis and therapeutic outcome in colon adenocarcinoma // JAMA. - 2008. - Vol. 299. - P. 425-436.
317 Strillacci A., Griffoni C., Sansone P. et al. MiR-101 downregulation is involved in cyclooxygenase-2 overexpression in human colon cancer cells // Exp Cell Res. - 2009. - Vol. 315. - P. 1439-47.
318 Svoboda M., Izakovicova Holla L., Sefr R. et al. Micro-RNAs miR125b and miR137 are frequently upregulated in response to capecita-bine chemoradiotherapy of rectal cancer // Int J Oncol. - 2008. - Vol.33. - P. 541-7.
319 Schepeler T., Reinert J.T., Ostenfeld M.S. et al. Diagnostic and prognostic microRNAs in stage II colon cancer // Cancer Res. - 2008. - Vol. 68, № 15. - P. 6416-24.
320 Huang Z., Huang D., Ni S. et al. Plasma microRNAs are promising novel biomarkers for early detection of colorectal cancer // Int J Cancer. - 2010. - Vol. 127, № 1. - P. 118-26.
321 Sarver A.L., French A.J., Borralho P.M., Thayanithy V. et al. Human Colon cancer profiles show differential microRNA expression depending on mismatch repair status and are characteristic of undifferentiated proliferative states // BMC Cancer. - 2009. - Vol. 9, № 401. http:/www.biomedcentral.com/1471-2407/9/401.
322 Pu X., Huang G., Guo H. et al. Circulating miR-221 directly amplified from plasma is a potential diagnostic and prognostic marker of colorectal cancer and correlated with p53 expression // Journal of Gastroenterology and Hepatology. - 2010. - Vol. 25. - I. 10. - P. 1674-1680.
323 Isabekova A.S., Ivachshenko A.T., Regnier M. MicroRNAs in colorectal cancer // Вестник КазНУ. Серия биологическая. - 2010. - T. 3, № 45. - C. 134-138.
324 Issabekova A.S., Ivachshenko A.T. Common microRNAs for stem cells and colon cancer cells // Materials of conference "Advances in Stem Cell Rasearch"/ 3rd EMBO Stem Cell Conference. - 2011. Paris. - P. 114. 325 Исабекова А.С., Берилло О.А., Хайленко В.А., Атамбаева Ш.А., Иващенко А.Т. Использование микроРНК в диагностики рака // материалы 2-ой международной конференции Астана Биотех2011. Астана. - 2011. - С. 44.
326 Исабекова А.С., Берилло О.А., Хайленко В.А., Иващенко А.Т. Особенности связывания межгенных и интронных miRNA с mRNA гена Е-кадерина человека // Вестник КазНУ им. аль-Фараби. Серия биол. - 2011.- №1 (47). - С. 19-23.
327 A. Issabekova, O. Berillo, M. Regnier, A. Ivashchenko. Interactions of intergenic microRNAs with mRNAs of genes involved in carcinogenesis // Bioinformation. - 2012. - Vol. 8, № 11. - P. 513-518.
328 Берилло О.А., Исабекова А.С., Хайленко В.А., Атамбаева Ш.А., Иващенко А.Т. Свойства интронных miRNA человека и особенности их взаимодействия с mRNA // Вестник КазНУ им. аль-Фараби. Серия биол. - 2011. -Т. 4, №50 - С. 37-41.
329 Исабекова А.С., Берилло О.А., Хайленко В.А., Атамбаева Ш.А., Иващенко А.Т. Свойства межгенных miRNA человека и особенности их взаимодействия с mRNA // Вестник КазНУ им. аль-Фараби. Серия биол. - 2011. - Т. 4, №50 - С.41-45.
330 Иващенко А.Т., Берилло О.А., Исабекова А.С., Хайленко В.А.,Атамбаева Ш.А. Свойства интронных и межгенных miRNA человека и особенности их взаимодействия с mRNA // Известия НАН РК. Серия биологическая и медицинская. - 2011. - № 5. - C. 34-39.
331 Исабекова А.С., Берилло О.А., Хайленко В.А., Иващенко А.Т. Xарактеристики взаимодействия межгенных, интронных и экзонных miRNA с mRNA генов участвующих в онкогенезе // Материалы международной научно-практической конференции "Фармацевтические и медицинские биотехнологии. Москва. - 2012. - С. 70-73.
332 Issabekova A. microRNAs - molecular targets in cancer treatment // Материалы международного конгресса студентов и молодых ученых "Мир науки"/КазНУ. -2012. - C. 184.
333 Исабекова А.С., Хайленко В.А., Иващенко А.Т. Связывание межгенных microRNA человека с сайтами mRNA генов, участвующих в развитии рака толстой кишки // Вестник КазНУ им. аль-Фараби. Серия биол. - 2012. -Т. 4, №56 - С. 307-312. 334 Берилло О.А., Исабекова А.С.,Хайленко В.А., Иващенко А.Т. Характеристики связывания межгенных, интронных и экзонных microRNA с mRNA генов, кодирующих интронные microRNA // Вестник КазНУ им. аль-Фараби. Серия биол. - 2012. -Т. 4, №56 - С. 292-300.
335 A. Issabekova, O. BerilloA.T. Ivashchenko, miRNAs bind to mRNAs in sites encoding conserved oligopeptides // Materials of the 9th international Conference on Nanosciences & Nanotechnologies (NN12). - 2012. - Greece. - P.302.
336 Issabekova A.S., Ivachshenko A.T. Single nucleotide polymorphisms of microRNA-binding sites in mRNA of some oncogenes // Materials of conference "Non-coding RNA, Epigenetic Memory, and the Environment". - 2011. London. -poster 112. 337 Issabekova A., Ivachshenko A., Regnier M. Feature of interaction of intergenic miRNAs with mRNA of CDH1 gene participating in development of cancer // Conference Proceedings of MCCMB'11. - 2011. - Moscow. - P. 366-367.
338 Berillo O.A., Issabekova A.S., Regnier M., Ivashchenko A.T. Characteristics of binding sites of intergenic, intronic and exonic miRNAs with mRNAs of oncogenes coding intronic miRNAs // African Journal of Biotechnology. ISSN 1684-5315. - 2012. - in press
339 Issabekova A., Berillo O., Khailenko V., Ivachshenko A. Some miRNAs selectively regulate some colorectal cancer oncogenes // Conference Proceedings "NCRI Cancer conference". - Liverpool. UK. - 2011. -P. 71.
340 Issabekova A., Ivachshenko A. Features of miRNA binding to some colorectal cancer oncogenes // Conference Proceedings of 13th International PhD Symposium "The Rhythm of Life: Cycles in biology". - Heidelberg. Germany. - 2011. - P. 151-152. 341 Исабекова А.C., Атамбаева Ш.А., ИващенкоА.Т. Нанобиокомплексы в диагностике заболеваний // Материалы международного междисциплинарного симпозиума "Нанотехнология и ноосферология в контексте системного кризиса цивилизации". - 2011. - Симферополь-Ялта. - С. 58.
342 Исабекова А.С., Иващенко А.Т. МикроРНК межгенного происхождения участвующие в развитии рака толстой кишки человека // Материалы VI Московского международного конгресса "Биотехнологя: состояние и перспективы развития". - 2011. - Москва. Часть 1. - С. 61-62. 343 Berillo O.A., Isabekova A.S., Khailenko V.A., Ivachshenko A.T. Peculiarities of interaction mirna with mrna of some oncogenes // The seventh international Conference on Bioinformatics of Genome regulation and Structure \ systems biology. - 2010. - Novosibirsk. - Р. 115.
344 Исабекова А.С, Берилло О.А., Хайленко В.А., Иващенко А.Т. Характеристики связывания межгенных, интронных и экзонных miRNA c mRNA генов участвующих в онкогенезе // Вестник КазНУ им. аль-Фараби. Серия биол. - 2012. -Т. 1, №53 - С. 18-23.
345 Иващенко А.Т., Берилло О.А., Исабекова А.С., Байдильдинова Г.К. miRNA - перспективные фармацевтические вещества в лечении рака молочной железы // Материалы первой Международной конференции Развитие нанотехнологий: задачи международных и региональных научно-образовательных и научно-производственных центров. - 2012. Барнаул. - С. 199-200.
346 Исабекова А.С. Особенности взаимодействия микроРНК с изоформами пре-мРНК и мРНК онкогенов BAX И BAD // Материалы 1-международного конгресса студентов и молодых ученых "Мир науки"/КазНУ. - 2010. - С. 178-179. 347 Fart K.K., Grimson A., Jan C., Lewis B.P., Johnston W.K., Lim L.P., Burge C.B., Bartel D.P. The widespread impact of mammalian microRNAs on мРНК repression and evolution // Science. - 2005. - Vol. 310. - P. 1817-1821.
348 Иващенко А.Т., Берилло О.А., Исабекова А.С., Хайленко В.А. Нуклеотиды в сайтах связывания mRNA с miRNA кодируют консервативные олигопептиды в ортологичных белках // Известия НАН РК. Серия биологическая и медицинская. - 2012. - № 2 - C. 68-75.
349 A.S. Issabekova, O.A. Berillo, V.A. Khailenko. Features of hsa-mir-1279 binding sites in protein-coding sequence of PTPN12, MSH6, ZEB1 genes // Materials of the 8th international Conference on Bioinformatics of Genome regulation and Structure\systems biology. BGRS\SB'12. - Novosibirsk. Russia. - 2012. - P. 130.
350 A. Issabekova, O.A. Berillo, A.T. Ivashchenko. miRNA binding sites in protein-coding sequence of orthologous mRNAs encode conserved oligopeptides // Materials of the 3rd Moscow International conference "Molecular Phylogenetics" "MolPhy-3" Proceedings . - Moscow. Russia. - 2012. - P.149.
ПРИЛОЖЕНИЕ А
Таблица А.1 - Гены с наличием мутаций, при раке толстой кишки
Хромо-сомаГенСинонимические названия геновХромо-сомаГенСинонимические названия генов1RAD54LHR54; hHR54; RAD54A; hRAD54; RAD54L2LRP2DBS; gp330; LRP21MUTYHMYH; CYP2C; MGC4416; MUTYH2MAP2MAP2A; MAP2B; MAP2C; DKFZp686I2148; MAP21MTHFRCLC-6; KIAA00463CNTN4AXCAM; BIG-2; CNTN4A; MGC336151LGR6GPCR; FLJ14471; VTS20631; LGR63EPHA3ETK; HEK; ETK1; HEK4; TYRO4; EPHA31MCPMCP; TLX; AHUS2; MIC10; TRA2.10; MGC26544; CD463TNFSF10TL2; APO2L; CD253; TRAIL; Apo-2L; TNFSF101OBSCNUNC89; FLJ14124; KIAA1556; KIAA1639; DKFZp666E245; OBSCN3GSK3B1PTPRUFMI; PTP; PCP-2; PTP-J; PTPRO; PTPU2; GLEPP1; PTP-PI; PTPPSI; hPTP-J; FLJ37530; R-PTP-PSI; PTPRU3TGFBR2AAT3; FAA3; MFS2; RIIC; LDS1B; LDS2B; TAAD2; TGFR-2; TGFbeta-RII; TGFBR21OMA1DAB1; MPRP-1; YKR087C; ZMPOMA1; FLJ33782; 2010001O09Rik; OMA13MLH1FCC2; COCA2; HNPCC; hMLH1; HNPCC2; MGC5172; MLH12EPCAMDIAR5, EGP-2, EGP314, EGP40, ESA, HNPCC8, KS1/4, KSA, M4S1, MIC18, MK-1, TACSTD1, TROP13PIK3CAPI3K; MGC142161; MGC142163; p110-alpha; PIK3CA2BUB1BUB1A; BUB1L; hBUB1; BUB13CTNNB1
OK/SW-cl.35, CTNNB2FZD7FzE33ALCAMMEMD; CD1662MSH2COCA1, FCC1, HNPCC, HNPCC1, LCFS23PPAR-γGLM1; CIMT1; NR1C3; PPARG1; PPARG2; PPARgamma; PPARG2ODC1ODC; ODC13CHL1CALL; L1CAM2; FLJ44930; MGC132578; CHL12MSH6GTBP; HSAP; HNPCC5; MSH63P2RY14P2Y14; GPR105; KIAA0001; P2RY142PMS1PMSL1; hPMS1; HNPCC3; FLJ98259; DKFZp781M0253; PMS13TTLL3HOTTL; FLJ13898; DKFZp434B103; DKFZp686D076; TTLL3
Продолжение таблицы А.1 Хромо-сомаГенСинонимические названия геновХромо-сомаГенСинонимические названия генов4ABCG2MRX; MXR; ABCP; BCRP; BMDP; MXR1; ABC15; BCRP1; CD338; GOUT1; CDw338; UAQTL16PKHD1FCYT; ARPKD; TIGM1; FLJ46150; DKFZp686C01112; PKHD14FGFR3ACH; CEK2; JTK4; CD333; HSFGFR3EX; FGFR36KCNQ5Kv7.5; KCNQ54KITPBT; SCFR; C-Kit; CD117; KIT6C6orf29CTL4; NG22; C6orf29; FLJ14491; SLC44A44ADAM29CT73; svph1; ADAM296SLC29A1ENT1; MGC1465; MGC3778; SLC29A14FBXW7AGO; CDC4; FBW6; FBW7; FBX30; FBXW6; SEL10; FBXO30; SEL-10; FLJ16457; DKFZp686F23254; FBXW76SYNE18B; CPG2; EDMD4; MYNE1; SCAR8; C6orf98; FLJ30878; FLJ41140; dJ45H2.2; DKFZp781J13156; SYNE14PROM1MSTP061, AC133, CD133, CORD12, MCDR2, PROML1, RP41, STGD47BRAFBRAF1, RAFB1, B-raf 1, MGC1268065MSH3DUP, MRP17PTPN12PTP-PEST; PTPG15APCGS; DP2; DP3; BTPS2; DP2.5; APC7PMS2PMSL2; HNPCC4; PMS2CL; PMS26HIST1H1BH1; H1.5; H1F5; MGC126630; MGC126632; HIST1H1B7METAUTS9; c-Met; HGFR; RCCP26EYA4
CMD1J; DFNA10; EYA47EPHB6HEP; MGC129910; MGC129911; EPHB66VEGFAVPF; VEGF; MVCD17MLL3HALR; KMT2C; FLJ12625; FLJ38309; DKFZp686C08112; MLL36CD109CPAMD7; FLJ38569; FLJ41966; RP11-525G3.1; DKFZp762L1111; CD1097SEC8L1
(EXOC4)REC8; SEC8; Sec8p; SEC8L1; MGC27170; EXOC46HFEdJ221C16.10.1; HFE1; HH; HLA-H; MGC1037907EGFRERBB; HER1; mENA; ERBB1; PIG61; EGFR6PHIPndrp; WDR11; DCAF14; FLJ20705; FLJ45918; MGC90216; PHIP7ABCB1CLCS; MDR1; P-GP; PGY1; ABC20; CD243; GP170
Продолжение таблицы А.1 Хромо-сомаГенСинонимические названия геновХромо-сомаГенСинонимические названия генов8RUNX1T1CDR; ETO; MTG8; MTG8b; AML1T1; ZMYND2; CBFA2T1; MGC2796; RUNX1T110RETPTC; MTC1; HSCR1; MEN2A; MEN2B; RET51; CDHF12; RET-ELE1; RET8PDGFRLPDGRL10TCF7L2TCF4; TCF-4; TCF7L28MYCbHLHe39; c-Myc; MRTL10ADAMTS15MGC126403; ADAMTS158LOC157697HSPC319; ERICH1; LOC15769710ZEB1RP11-472N13.4, AREB6, BZP, DELTAEF1, FECD6, NIL2A, PPCD3, TCF8, ZFHEP, ZFHX1A8CSMD3KIAA1894; CSMD311BADBBC2; BCL2L8; BAD8DLC1HRA11MMP1CLG; CLGN9ENGRP11-228B15.2, CD105, END, HHT1, ORW, ORW111PTENBZS; MHAM; TEP1; MMAC1; PTEN1; 10q23del; MGC11227; PTEN9TGFBR1AAT5; ALK5; SKR4; ALK-5; LDS1A; LDS2A; TGFR-1; ACVRLK4; TGFBR111PTPRJDEP1; SCC1; CD148; HPTPeta; R-PTP-ETA; PTPRJ9ABC1ABC-1; ABC1; CERP; FLJ14958; HDLDT1;MGC164864; MGC165011; TGD11HRASC-BAS/HAS; C-H-RAS; C-HA-RAS1; CTLO9UHRF2NIRF; URF2; RNF107; MGC33463; DKFZp434B0920; DKFZp686G0837; RP11-472F14.2; UHRF211CD44AL133330.1, CDW44, CSPG8, ECMR-III, HCELL, HUTCH-I, IN, LHR, MC56, MDU2, MDU3, MIC4, Pgp19PTPRDHPTP; PTPD; HPTPD; HPTPDELTA; RPTPDELTA; PTPRD11CD248TEM1; CD164L1; MGC119478; MGC119479; CD2489DBC1FAM5A; DBCCR1; DBC111CCND1BCL1; D11S287E; PRAD1; U21B3110C10orf137EDRF1; MGC125705; RP11-383C5.6; C10orf13711GUCY1A2GC-SA2; GUC1A2; GUCY1A210ABCC2DJS; MRP2; cMRP; ABC30; CMOAT11SCN3BSCNB3; HSA243396; SCN3B10ACSL5ACS2; ACS5; FACL5; ACSL512KRASNS; NS3; KRAS1; KRAS2; RASK2; KI-RAS; C-K-RAS; K-RAS2A; K-RAS2B; K-RAS4A; K-RAS4B; KRAS10ERCC6CSB; CKN2; COFS; ARMD5; COFS1; RAD26; ERCC612K6IRS3K6IRS3; IRT6IRS3; KRT6IRS3; MGC129635; MGC129636; KRT73 Продолжение таблицы А.1 Хромо-сомаГенСинонимические названия геновХромо-сомаГенСинонимические названия генов12P2RX7P2X7; MGC20089; P2RX715C15orf2C15orf212VDRNR1I115MKRN3D15S9; RNF63; ZFP127; ZNF127; MGC88288; MKRN313KLF12AP2REP; AP-2rep; HSPC12216ADAMTS18ADAMTS21; ADAMTS1813CDK8K35; MGC126074; MGC126075; CDK816CDH1UVO; CDHE; ECAD; LCAM; Arc-1; CD324; CDH113IRS2IRS216AXIN1AXIN; PPP1R4913LMO7LOMP; FBX20; FBXO20; KIAA0858; LMO716GALNSGAS; MPS4A; FLJ17434; FLJ42844; FLJ98217; GALNAC6S; GALNS14MLH3HNPCC; HNPCC7; S240II11716MMP2CLG4; MONA; CLG4A; TBE-1; MMP-II; MMP214EVLRNB6; EVL16UQCRC2QCR2; UQCR2; UQCRC214AKTAKT; PKB; RAC; PRKBA; MGC99656; PKB-ALPHA; RAC-ALPHA; AKT116ZNF442FLJ14356; ZNF44214PRKD1PKD; PKCM; PRKCM; PKC-MU; PRKD117AXIN2AXIL; MGC10366; MGC126582; DKFZp781B0869; AXIN214KIAA1409FLJ4333717FLCNBHD; FLCL; FLJ45004; FLJ99377; MGC17998; MGC23445; DKFZp547A118; FLCN15NEUGRINDSC92; NGRN17TP53p53; LFS1; TRP53; FLJ92943; TP5315SMAD3MADH3; JV15-2; HSPC193; HsT17436; MGC60396; DKFZp586N0721; DKFZp686J10186; SMAD317EPPB9B9; EPPB9; MKSR1; B9D115MAPK6ERK3; PRKM6; p97MAPK; HsT17250; DKFZp686F03189; MAPK617MAP2K4NKK; MEK4; MKK4; SEK1; JNKK1; SERK1; MAPKK4; PRKMK4; MAP2K415ADAMTSL3KIAA1233; MGC150716; MGC150717; ADAMTSL317NF1WSS; NFNS; VRNF; FLJ21220; DKFZp686J1293; NF115BLMBS; MGC126616; MGC131618; MGC131620; RECQ218DCCCRC18; CRCR1; IGDCC1; DCC Продолжение таблицы А.1 Хромо-сомаГенСинонимические названия геновХромо-сомаГенСинонимические названия генов18SMAD2hMAD-2; hSMAD2; JV18; JV18-1; MADH2; MADR220MMP9GELB; CLG4B; MMP-9; MANDP2; MMP918SMAD4JIP; DPC4; MADH4; SMAD420SRCASV; SRC1; c-SRC; p60-Src; SRC18ATP5A1OMR; ORM; ATPM; MOM2; ATP5A; hATP1; ATP5AL2; ATP5A120PLCG1PLC1; NCKAP3; PLC-II; PLC148; PLCgamma1; PLCG118ZNF521EHZF; Evi3; DKFZp564D0764; ZNF52120SNAI1SLUGH2, SNA, SNAH, SNAIL, SNAIL1, dJ710H13.119BAXBCL2L420SFRS6B52; SRP55; MGC5045; FLJ08061; SFRS619ZNF480MGC32104; ZNF48021PKNOX1PREP1; pkonx1c; PKNOX119ZNF155pHZ-96; MGC161655; ZNF15522CHEK2CDS1; CHK2; LFS2; RAD53; HuCds1; PP1425; CHEK219MGC33407HSD21; MGC33407; ACTL922EP300p300; KAT3B; EP30020SDBCAG84Erv46; CGI-54; PRO0989; C20orf47; NY-BR-84; SDBCAG84; dJ477O4.2; ERGIC322GSTT1no20GNASAHO; GSA; GSP; POH; GPSA; NESP; GNAS1; C20orf45; MGC33735; GNASxTBX22CLPA; TBXX; dJ795G23.1; TBX22 118
119
Документ
Категория
Биология
Просмотров
471
Размер файла
2 965 Кб
Теги
1/--страниц
Пожаловаться на содержимое документа