close

Вход

Забыли?

вход по аккаунту

?

bd000103064

код для вставкиСкачать
?? ?????? ????????
?????? ??????? ?????????????
????????-???????? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? ?
???????????? ? ? ? ? ? ? ? ? ? ? ? ? ? ???????????? ? ? ? ? ? ?
???????? ????????
03.00.07-?????????????
???????????
??????????? ?? ????????? ?????? ???????
????????? ????????????? ????
?????? - 2004
2
?????? ????????? ? ????????????? ? ? ? ????????????? ? ???н
?????????? ??. ????????? ?.?. ???????? ???????????? ??????????н
????? ?????????? ?????????.
??????? ????????????: ???????? ????????????? ????, ??????
?.?. ??????
??????????? ?????????: ?????? ????????????? ????, ?????????
?.?. ??????????
???????? ??????????? ????
?.?. ???????????
??????? ??????????: ??????-??????????? ????????, ?. ?????-?????????
?????? ??????????? ?????????[ лл
2004 ?. ? f/j
f/j
'?????
?? ?????? ? 208.046.01 ??? MOCKOBCKOI
?? ????????? ????????????????
?????????? ??н
???? - ????????????????? ????????? ????????????? ? ????????????? ??.
?.?. ????????????? ?? ??????: 125212, ?. ??????, ??. ???????? ????????,
?. 10.
? ???????????? ????? ???????????? ? ?????????? ??????????? ??? ???н
?????????? ? ????????????? ??. ?.?. ?????????????.
??????????? ???????? л / ╗ ????
2004 ?.
?????? ?????????
???????????????? ??????,
???????? ????????????? ????
? ? . ?????????
ilfA^
^^^^f^OS'
23f24
*? *3
????? ?????????????? ??????
???????????? ????????
? ????????? ????? ?????? ???????? ???????? ?????????? ????н
?????? ????????? ????????? ??? ??????????????? ?????? ?????, ? ???
????? ? ??????. ? ????????? ???? ??-?? ???????? ?????? ????? ?
????????? ????????????? ???????? ? ????? ?????? ?????????? ???? ??н
???????????? ??????? ????????? ??????????, ? ??????????? ?????????? (???????? ?.?., 1997; ????????? ?.?.,1999).
???????? ??????????? ?????? ?????? ?????????????????, ??
?????? ? 80% ??????? ???????? ??????????? ?? ?????????? ????????н
?????? ?????. ?????????????? ???????????? ???????????? ???? ???
???????? ? ????, ??? ??????????? ??? ?? ?????? ??????? ???????, ?
????? ??????????????? ?????? ????????? 12,2-14,7% ? ???????? ???н
??????? (???? ?.?., 2000; ?????????? ?.?. ? ??. 2002). ? ????? ? ????
?????? ??????? ???????? ?????????? ????? ??????????, ??????, ????н
???????????????? ? ??????????? ??????? ???????????, ???????????н
??? ?????? ????????? ??????????? ? ???????? ??? ?????????????
???????.
???? ???? ??????????? ????????????? ??????????????? ???????,
???????????? ?? ???-??????????: ????????????????? ??????? 6-7 ??н
???, ???????????????? ?? 10-100 ???????? ? ???????, ??????????? 100%
?????????????, ??????????? ????????????? 100-200 ? ????? ???????? ?
????.
???????, ????????????? ??????????? ???????????, ????????? ??н
??????, ????? ?????????????? ??? ???????? ?????? ???????? ?????н
??????? ???????? ??? ?????????????????? ?????????, ?????????????н
???? ???????????????? ?????????-??????????????????? ??????? ??
?????? ? ???????? ??????????, ?????? ????????????? ?????????
???????????????????? ???????????
? ?????????? ?????????? ??????? ???????????!
??????? ???????.
??????????
??^??
4
???? ??????: ?????????? ????-??????? ??? ????????? ???????? ????
Shigella ? ???????????????? ?.???, ????????????????? ??????????? ???н
??? ???????? ???????? ??????????? ???-???????? ???????? ??????н
?????????? ????????????? ???????????? ????????? ???????????.
?????? ????????????:
1. ??????????? ??? ????-??????? ??? ???????? ???????? ???? Shigella
? ???????????????? ?. coli, ???????????? ???????? ????????????
?????? ? ??????????? ?????????, ????????? ???????, ???????? ???????
?????.
2. ?????????????? ????????????? ????????????????? ??? ????-???н
????, ?????????? ???????? ???? Salmonella, ??? ????????? ? ????????н
???? ????????.
3. ?????????? ???????????????? ???????????? ???-????????????
???????????? ????????? ?? ??????? ???????????????? ?????????????
???????????? ?????? ???????? ????????.
4. ??????? ?????????????????? ????? ???????? ???????????? ? ???н
???????? ???????? ??????, ?????????? ? ????????.
??????? ??????? ????????????
????????? ???????????? ????????, ??????????? ????????? ??н
????????? ?????????????????? ?????? ????????? ??????????????? ???н
???? ??????? ???????????? ?????? ? ???????????????? ????????. ??
???? ?????? ????????? ??????????? ????????????? ????-??????? ??? ??н
?????? ???????? ???? Shigella ? ???????????????? ?. ??? ? ???????????
?????????, ????????? ??????? ? ???????? ??????? ?????.
???????? ????? ?????? ? ?????????????????? ????? ???????? ????н
???????? ? ??????????? ???????? ??????, ??????????, ????????, ????н
?????? ? ?????-??????? ???????. ???????? ??????? ??????????????? ??н
?????????? ??????????? ???????????? (33,0%), ????????????? (22,6%) ?
??????????? (11,4%) ???????????????. ???????? ??????? ? ?????????
??????? ?????????????? ????? ????????????? ??????? 1 ????. ? ???????
5
?. coli 0127 ???????? ???????????? ?????????, ??????? ? ?????? ???????
tcpA V. cholerae ? V. eltor. ?????????? ?????????? ?????? ????? ? ???????
??????????????? ???????????? ????????????? ??????? ???????????????.
?????????? ?????????? ???????????? ???-???????????? ???????н
????? ????????? ??? ????????? ???????? ???????? ????????????? ?????н
??????? ????????? ???????????. ????????????? ???????????? ???????
??? ??????????? ?????? ???????? ???????? ????????? ????????? ???????????? ??????????????? ??????? ????? ??? ? 2 ????, ???????? ?????
??????????? ?????????? ? ?????????? Campylobacter ssp. ? Yersinia enterocolitica ? ?????-??????? ???????.
??????-???????????? ??????????
????????? ? ???? ????????? ?????? ??? ????-??????? ??? ????????
?????? ? ???????????????? ????????, ? ????? ?????????????? ? ? ????
??????? ???????????????? ????????????????? ????-??????? ??? ??????н
??? ???????? ????? Salmonella, Campylobacter ? Yersinia enterocolitica ????н
???? ??????? ????????????? ??? ?????????? ???????????? ????????????
????????? ? ? ?????????-?????????????????? ????????.
???????? ???????????????? ????????? ????????????? ??? ????-???н
??? ??? ???????? ????????????? ???????????? ?????? ???????? ?????н
??? ?????????? ????????? ??? ? ???????????? ???????? ??? ? ???????
????. ????????????? ??? ????-??????? ????? ??????? ??????? ????н
?????????? ???? ?????? ???, ?????? ? ?????? ? ??????, ???? ??????????
? ??????????????? ?????????, ????????? ???????? ???????? ????????????
??????????? ???????? ???????? ? ?????????-??????????????????? ???н
???? ?? ?????????? ?????????????.
????????????? ?????? ??? ??? ???????? ????????????? ?????????н
??? ?????? ???????? ???????? ? ???????? ?? ?????????? ??????? ????
??????????? ???????? ????? ??????? ?????????? ? ?????????? ?????н
??????? ???????? ??????? ?????????????? ? ????????.
6
???????? ?????????, ????????? ?? ??????
1. ????????????? ? ? ? ????-???????, ?????????? ?? ????????????
?????????, ??????????? ? ??????? ????????????, ????????? ? ???????
????????????????? ? ?????????????? ????????? ????????? ?????? ? ???????????????? ???????? ? ??????????? ????????? ?? ??????? ???????
????????? ??????????.
2. ?????????? ???-???????? ?????? ? ?????????? ????????? ?????
??? ? 2 ???? ????????? ????????????? ????????? ????????? ?????????н
??? ??????? ? ??????????? ????????? ? ??? ?????????? ?????????-?????н
????????????? ????????????.
3. ????????????????? ????????????? ? ? ? ????-??????? ??? ????????
????????????? ??????? ?????????????? ????????? ???????? ?????, ?????н
?????? ?????????? ? ?????????????????? ???????????? ???????????
???????? ???????????? ? ??????????? ???????? Shigella, Salmonella, ?. coli.
4. ??????????? ? ???????????? ????????????? ??????????? ???-???????????? ???????????? ????????? ?? ??????? ???????? ????? Shigella,
Salmonella, Campylobacter ? Yersinia enterocolitica ??? ?????????? ??????н
???? ???????????? ??????? ??????? ????????? ??????????.
????????? ??????
???????? ????????? ??????????? ???????? ?? ??????-????????н
???? ?????????? "?????????? ??????????????? ? ???????????? ??????н
?????????" (??????, 2002), ?? ??????-???????????? ??????????? л????н
??????????? ???????????? ???????????╗ (?. ????????, 2003), ?? ?????????????????? ???????????, ??????????? 100-????? ?? ??? ???????? ?????? ?.?. "?????????? ???????? ????????????? ???????????? ?????н
???" (?.????????, 2003), ?? ????????? ??????? ?????? ? ????????????????
???????? ?????????????? ? ? ? ????????????? ? ????????????? ??. ????.
?.?.????????. ?? ???? ??????????? ???????????? 10 ?????.
7
????????? ? ????? ???????????
??????????? ???????? ?? 143 ????????? ????????????? ??????, ????н
?????????? 13 ????????? ? 12 ?????????, ??????? ?? ????????, ?????? ??н
????????, ?????????? ? ??????? ????????????, ??????????? ? ?? ???????н
???, ??????????, ???????, ?????? ??????????, ??????????? 192 ?????н
????, ?? ??? 114 ???????????.
?????????? ? ? ? ? ? ?
????????? ? ??????
????????? ???????????? ???????? 263 ?????? ?????????????? ?????
Sliigella, Salmonella, Escherichia, Klebsiella, Enterobacter, Citrobacter ?? ???н
?????? ?????? ? ???? ????????????? ?? л?????╗; 368 ??????? ??н
????????????, ?????????? ?? ??????? ??????? ????????? ??????????,
525 ???? ???????????? ????????? (???????, ?????????? ?????); 174 ?????
????????? ??????? ? ?????? ? ???????? ??????? ?????.
???????? ???????? ????????????? ????????? ?.?.,???????? ?.?.,
??????????? P.M., ? ????????? ?,?. - ??????????? ??? ?8 ?. ?. ?????н
???? ?? ?????????????? ???????????? ????????? ? ??????????????? ????н
??? ??????????????.
????????? ?????? ?????? ???????????? ?????? ??????? ???????????
???????????? ???????????: ?.?.?. ??????? ?.?., ?.?.?. ??????? ?.?.,
?.?.?. ?????????? ?.?., ?.?.?. ??????????? ?.?., ?.?.?????? ?.?.
? ?????? ???? ???????????? ???????????-????????????? ??????: ???????????? ?????? ???????, ?????? ?????????? ???????? ????????, ???н
????????? ?????? ???????????? ??????????????????? ??? ????????.
????? ????????? 2472 ???-????????????, 164 ??????? ??????????? ??н
????? ????????.
8
??? ???????? ????-??????
??? ????????? ????? ???????? ?????????-
??? ?????????????? ????????? ?????? ? ?????? ????????? ?? ?????? ???н
?????????? ??????? ???????????? ??????????????????? ? ? ? ????? ? ???н
???????? ?????? ???????? лDNA-star╗.
??? ??????????? ??????
???
? ????????????? ?????????? ???
???????? ????????????? ?????? ????????? ???????? ??????????????? ?
?????????? ???: ??????????? ?? ??????? ??????? ????, ??????????????
????? ? ????????-???????????? ????????????????, ????? ?????????????????????????? ? ???????? ? ? ? ?? ??????????.
??? ??????????????
?????????? ??????? ??????????? ???????? ??н
???????????? ????????? ???????????? ????????????????? ? ? ? ????-???н
???? ? ?????????? ? ????? L T , ST, V T ???????? ? ??????? ????????????
?????? ? ????????, ????????????????? ? ? ? ????-??????? "?.??? tox (VT1, VT-2, ?7)" ???????????? ? ? ? ? ? (??????), ? ????? ?????????????????
? ? ? ????-??????? ???????????? ? ? ? ? ? ? ? ? (?????) ? ?????????? ?
???? ????????? ????????????? ctxA V . cholerae ? ? ???? ??????? tcpA ??н
?????? ?????????.
????????? ????????? ???????????? ????????? ??????? ?????????н
???? ? 2 % ????????? ????, ????????????????? ????????????? ?? ???????н
?????????? ? ???????????????? ????? ? ??????????????? ?? ??????????
л?????? 300╗. ???????????? ????????? ??????????? ??????????? ??? ??н
???? ???????????? ????????? л???????╗ ????? "Keklab" (??????).
???????? ??????????? ???????
?????? ??????? ?????????????? ???н
?????? ??????? ????????????? ????????????? ?? ???????? (Eckhardt ?.,
1978) ? "????????" ??????? (???????? ?.?. ? ??., 1995).
??????????????
???????
????????? ???????????
?????????????
??????????
???????????? ????????? ?
? ???????????
??????????????
??????? ????????? Microsoft Excel (?????? ???????????? ??????????). ? ? н
????????? ?????????? ?????? ??? ????????? ???? ?????????????? ???-
9
?????????? ????????? ? ?????????????? ???????? ??-??????? (????? ?.?.
?????????????? ??????, ??????, "?????", 1964, ?. 237-239)
?????????? ???????????? ? ?? ???????????
?????????? ??? ????-??????? ??? ????????-???????? ?????? ?
???????????????? ????????
??? ???????????? ?????? ??????? ?????????????? ?? ????????? ??н
???????????? ????? ? ??????????? ?? ???????????? ?????????????
"?????" ???? ???? ??????????? ??? ????-???????, ?????????? ????
???????? ???????????? ??????????????: LT, ST, VT1 ???????? ? ???????
???????????? ?????? ? ????????.
? ??????????? ???????? лDNA-stan> ?? ???? ??? ???????????????
????? ? ? ????? ?? ?.?. ???????? (??????) ??? ???????? ?????????н
??? ??????, ?????? ? ?????? ?????????, ??????????? ? ???????? ??? ??н
??? ???????? ???????????? ??????????????.
????????, ??????????? ? ??????? ??? ???? ??????? ????????????
?????? ? ???????????????? ???????? (inv):
SF-1 5' - GGAAGCTTAATACTCCTGAACGGCG - 3'
SF 2 5' - GGAAGCTTAGGTGTCGGCTTTTCTG - 3';
??????????? ????? ???????? ?? ??????????? ????? ?. ? ????????
"?????? ??????" (??????, "???", 1990, ?. 176-190). ??? ?????????? ???
??? ???????????? ???? ???????????? ????? "Sigma" (???) ? ???????
??????????????? Tag-??????????, ???????????? ???????????? ??? "???н
????".
??????????? ?????? ????????? ?????????????? ?? ???????:
T^.= 2(A+T) + 4(C+G)-5
? ?????? ????? ?????? ????????????? ??? ????-?????? ??? ????????
????????????? ???????????? ?????? ???????? ???????? ? ???????????
????????? ?? ????????????.
10
??? ????????????? ???? ??? ????-??????? ?????????????? ??? ???н
????? ????????????? ????????????? ?????? ??????? ??????????????, ???
???? ???? ????????, ??? ??????????? ??? ?????? ?????? ??? ???????????
?? ???? ? 3 ?????? E.coli ???????????? 0124:?72 ????????????????? ?
??????????, ???????????? ? ??????? ??? ??????? ????????????. ????н
????????? ????????? ??? ????^?? ? ?????????? ???????? ??????, ? ??????? ???? ???????? ?????????? ??????? ??????? (???? ? 120 ??), ?????????? ?? ?????? ?????????? ?????? ???????????? (Sasakawa ?. et al.,
1986; ???????? ?.?., 1997).
????????? ???????????? ????????? ???? ??????? ????????????:
94*0-3 ???} 1; 94''? - 1 ???, SS'C - 1 ???, 71░? - 1 ???}35; ??^? - 5 ???} 1.
???????????? ????????? ? ?????? ?????????? ????????????? ???н
???????? ?? ??????? "?????-250" ????? "??????" (??????). ?????? ???н
????????????? ????????? ??? - 760 ?.?.
????????????????? ??????? ????-??????? ??? ??????????? ??? ???н
?????????? ??????? ??????? ?????????????? ??????????? ? ????????????
??????????? ?. ??????? ?????????. ?????????? ????????????, ????????н
?????? ? ????. 1 ????????????????? ? ??????????????? ?????????? ??????
??? ? ??????????? ???.
??????? 1
?????????? ???????????? ???????????? ????????? ??? ?????????????
??????? ? ? ? ? ???????????? ??????????? ?. ?.?????????
?????????
??????????????? ????н
???? ?1
????????????? ??? ??н
?????
?????
?????????? ??н
???????????
(???.)
????????? ????????????
40
???
(???.)
7
???. ??????
(???.)
26
6
-
66
13
-
-
11
??? ????????? ???????????????? ???????????? ?? ?????????????
???????????? ????? ? ??????????? ??????? ? ??????? 18 ????? ??? 37"?,
??? ??????????? ??????????? ????????????????? ????????????.
????????????????? ????-??????? ? ?????????? ??????????? ?????н
???? ? ???????????? ???????????-????????????? ??????????? ????? ??
??.
??? ?????????? ???????????????? ? ????????????? ?? ????????????
??????? "????"-???. ? ?????? ???????? ???????????? ??? ???? ?????????, ?? ???????????? ???????? ? ???? ???? ? ????? ??????????? ?????.
???????????? ??????, ?????? ? ?????? ????????? ??????????? ??н
?????????? ??????????? ???????????? ??????????? ?????, ????????
????????????? ????????? ?? ?????? ????????? ??????????????, ??????н
??? ????-??????? ?? ??????????? ????????? ??????????? ???? ?? ????
????? ??. ????. ?.?.????????. ?? ??????????? ?????????? ?????? ???
????-??????? ???? ???????? ????????? 2 ???? ?????????:
???????: Shi 5' -GCTACTTCTTTCTGGATGGTATGGTGAGG-3';
Sh2 5' - CTAAGCATTGCCCCACGCTGGTTGTC-3';
??????????: Sh3 5' - GGACATTTTCAAGCTGGTTC-3';
Sh4 5' - GGCCAACAATTATTTCCTTG-3'.
??? ?????? ????????????? ????????? ? ??????? ??? ?? ???????н
????? ????????? ??????????????? ?? ????????????? ??????? ?????????
??? ? ???. ?????????? ?? ???????? ???????????????, ????? ??????? ??
????????????????? ???????? ??? ???????????????? ??????? ??????????
?????????????? ????????? ??? ?????????? ????????? ????????????????
???????.
????? ????????? ?? ??????? ???? ??? ???????? ??? ?????? ?????? ?
??????? ?????????? ???????????????. ??? ????????????? ??????? ???н
???????????? ?????? ? ????????-???????????? ??????????????? ??????н
???? ???? ????????? ??????????????? ????? ? ??? ? ??????? 18 ?????,
????? ???????? ??????????? ?????????? ??? ??? ????????????. ?????-
12
??? ??????????? ??? ????? ????????????????? ?????? ?????????????????????????? ? ??????????? ???????? ? ? ? ?? ??????????. ????? ????????
??????????? ????????????? ? ?????? ?????????????? ????????? ? ?????н
???? ???????? ???????????? ?????????? ??????? ????????? ???????????
?????? ??? ?????? ??????????????? ?????. ??? ????????? ???? ????????н
???? ????? ????????? "???-???? ?" ?????????? ? ? ? ? ? ? ? ? ? (??????).
? ?????? ? ????? ????????? ????-??????? "Ampli-Inv" ?????????н
??? ??????????? ?? ?????? ???????????? "?????? ? ? 2 " ????? л?????????????╗ (?. ??????), ??????? ???????????? ?????????? ? ? ? ? ????н
???? ? ??????????, ? ????????? ????????????? ???????? ????????????.
????????? "????"-??? ??? ??????? ????????? ??????? ???????????? :
95''? - 3 ???.} 1; PS'C - 15 ???., 65░? - 15 ???., 12░? - 15 ???.} 10; 95''? 11 ???., 55░? - 11 ???., ?^? - 11 ???.} 30; ?^? - 1 ???.} 1.
?????? ???????????????? ????????? ?1? - 348 ?.?.
??????????????????? ????????? ????, ?????????????? ?????? ??н
??????? ????????????? ??? ??????? ????????? ???????????? ?????????
?????? ??? ?? 10-15 ??? ? ??????????? ????????? ????? ????????????н
????? ???????? (?? 1,5 ?????), ?????????????? ? ????????? ????????????,
???????? ?? ????????, ??? ???? ?????????????????? ??? ???????????????????????????? ???????? ?????? ???????? ? ? ? ????-???????.
????-??????? ????????? ?????? ????????????? ????????? ??? ??????н
?????? ? ? ? S. flexneri 2? 10'" ?/??. ????????????? ???????????????? ??????????? "Ampli-Inv" ????????? 500 ??/??. ?? ??????????? ????????????
???????????? ????????? ???????????????? ????-??????? ????????? 97,3 % ,
? ????????????? - 95,4 % .
?? ????????????? ??? ????-??????? "Ampli- Inv" ???????????? ??н
????-??????????? ???????????? ( ? ? ? , ? ? ? , ?????????? ?? ??????????).
???????????? ?????? ?????? ???? ???????? ? ? ? ? ? ? ??. ?.?.??????????
(??????).
13
????????????? ????????????? ????-??????? ???? ??????????? ??
????????? ?????? ??????? ??????????????: ???? ????? ??????, ?????????
????????????? ????????, ????????? ????? Salmonella, ???81?11?, Enterobacter ? ??. ??? ??????????????? ?????? ???????? ???? Shigella ? ????н
???? ?. ??? 0124:?72 ???? ????????????? ????????? ? ???. ???????????
???????????? ??????????? ???????????? ??????, ?? ??????? ????????,
??? ???????? ??????? ???????????? ?. ??? ????? ?????? ????????????,
?????????? ????????????
(?????????? ?.?.,
1985). ?????? ????н
?????????? ?????? ????? ?????? ????????????? ?????????.
? ???? ???????????? ????????? ????-??????? ???? ????????? ?????н
???????, ? ??????? ???????????? ?????????????? ?????? ? ???? "????н
??????" ?????????. ????? "??????????" ??????? ? ? ? ?? ????????? ????н
??????? ?? ???????????????? ? ????????????? ?? ????????? ????????, ??н
????????? ?? ???????? "????"-???, ?? ???????? ????? ????????? ? ????н
??? ?????? ???????. ? ?????????? ???????????? ????????? ? ????????н
?????? ????? ???? ????????? ? ????????? ???????????? ? ?????????
??????: 95"? - 5 ???. } 1; 95"? - 10 ???., ??^? - 10 ???., 72░? - 10 ???.} 42;
??^? - 1 ???. } 1 . ?????? ?????????????? ????????? ? ? ? ??????? ???????н
????? ?????? ? E I E C - 348 ?.?.
??????????? ????????? ? ? ? ????-??????? "???11-1??" ???? ?????н
???? ?? ???? ????????????? ??? ?8. ?? ?????? ? 2001 ?? 2002 ??? ????
??????????? 165 ???????? ???????????? ????????? (????????? ?????) ??
??????? ? ??????????: ? ? ? , ??????????, ?????????????, ???????, ???????
??????????????, ? ? ? ? .
? ? ? ????? ??????????? ??????????? ?????????????????? ??????? ?
?????????????????? ??????????? ??? ?8.
????????????? ????????? ?????? ? ??????????? ????????? ???????
??? ???? ???? ????? ??? ? ???? (28,5%) ?? ????????? ? ??????????????н
???? ??????? (11%). ?????????????? ????????? ???????? ?????????????
?????????? ???????????.
14
??? ????????? ?????? ??? ? ??????????????????? ??????? ???? ??н
?????? 4 ?^????? ??????????? (????).
????+???+
? ???+???? ???-???+
????-???-
???. 1. ???????? ???????????, ?????????? ??? ???????????? ???????н
????? ???????????? ????????? ?? ??????? ?????? ? E I E C ???????
??? ? ?????????????????? ??????? (?=165)
?????????? ???????????? ????????, ??? ??????? ???????????????? ??н
???? ??? ????????? ???????? ?????? ???????????? ???????????, ???????
?????????????????? ??????? ?? ??????????. ????? ????, ????? ??? ??н
?????? ??????????????, ??????????? ? ???????????????? ?????????, ??н
????? ??????? ???? ???????? ??? ????????????????? ????????, ? ???
????? ? ??? ?????? (???????? ?.?. ? ??., 1993; ???????? ?.?. ? ??., 1997,
1999; ??????????? ?.?., 1997; Corwell P.R. et al., 1994). ????? ?????????
??????????????? ??????????????? ????????? ?????????????? ??????????
? ??????????????? ???????? ? ?????????????? ????? ?? ??????????? ???н
???. ??? ???? ???????? ????????? ???? ???????????? ???????? ? ?????н
??????????? ? ??? ????? ??????? ?? ????????????? ???????? ???????
????????????.
????????????? ??? ????-??????? ???????? ?? ?????? ???????? ????
Shigella, ?? ? ???????????????? ????????, ??????? ? ??????????????????
??????????? ??? ?8 ?? ???????? ??-?? ?????????? ????????????? ????н
?????????.
15
??? ????? ?? ??????? 2, ??????? ??? ??????? ???? ???????? ??????
?
??????????? ????????, ?????????? ?? ????? ? ????????? ? ? ?
?
??????????. ?????????? ?????? ????????????? ??????????.
??????? 2
????????? ???????? ???? Shigella ? ??????? ? ??????????
???????????? ??????????
???????
???
??????????
?????????????
???????
????
???????
???????????????
?????
??????????
?????????????
49
18
31
22
18
???????? ??????
??????????????????
??????? ???
???????
???.?.
???.?.
%
%
16,3
30
61,2
8
55,5
17
94,4
10
-
-
?
-
-
27
-
-
-
-
165
47
28,5
18
?
? ???????? ????????????????? ?????? ???????????? ??????????????н
??? ?????????????????? ???????? ? ? ? ????-???????: ? 2003 ???? ????-???н
???? ????????????? ?????????? ??????????? ???????? ( ? ? ? ) , ???????
????????? ???????? ?????????????????? ?????????? ??? ?????1???????
? ? ? ???????????? ???????????? ??????? ? ???????? ???????????????????? ?????? ?????? - ????????????????????? ??? ?????????? ?????????????????? ???????????.
????????? ? ??????????? ? ?????????? ???????????? ???????н
????? ????????????????? ????????? ? ? ? ????-?????? ??? ????????
??????????, ???????????????, ????????
??????????? ???????? ???? ?? ??????? ???? ? ????????? ? ? ? ? ??н
????? ?????? ???????? ?????????? ??????????? ?????????-?????????
16
??????, ??????? ????????-???????? ?????????? ? ??????????? ?????????
???????? ?????????? ?????????.
??????? ?????? ???????????? ???????? ????????? ?? ??????????? ??н
??????? ????????????? ? ?????????? ??????? ???? ?????????????????
????????????? ? ? ? ????-?????? ??? ???????? ???????? ???? Salmonella:
? ? ? ? ? ? ? ? ??. ?.?. ??????? ? ? ? ? (??????) ? ? ? ? ? ? ? ? ? ? ( ? ? н
????).
?????? ????-??????? ???? ??????????? ?? ?????? ????????? ? ???????
? ? ? ???????????? ??????? ??? ? ?????????? ? ????????? ??????????????? ???????? ???????? 500 ?.?.
?? ?????? ????? ?????? ?? ??????? ?????? ????????????? ??????????? ?? ????????? ?????? ??????? ??????????????. ??? ?????????
????????????
??????????
????
?????????????
?????????.
???
??????????????? ? ??????? ????????????? ?????? ????-??????? ???????
?????????? ?? ??????????, ? ??????? ??????????? ? ????????????? ??????????? ?????? ? ????????? ???????????? Salmonella typhimurium.
???????? ????-???????
???????????????
??????
?? ?????????????????
?????
??????????????,
??
?
???????
?????
??
?????????
??????? ????? Citrobacter freundii 021,022,038; ?. coli 0111,044, 077.
?????????????
????????????????
??
?????????
?????????????
S. typhimurium ? S. enteritidis ????????? 1000 ??/??.
??? ?????????? ? ? ? ?????????????? ????-??????? ???? ??????????
??????? ?????????, ????????? ?? 5 ????????? ??????.??????????? ??????
????????? ?? ?????? ?????? ???????????? ?????????? 60, 57, 55" ?. ??
????? ???????? ????????????? ????-??????? ???? ???? ??????? ??????н
??? ? ?????????, ??????????? ????????? ????? ?????????? ? ? ? ? ????н
???? ???????? ??????????: л??????? ?????╗ ????????? ? 10 ?? 4 ?????,
??????? ????????? ??? ??????????? ?????? ????????? 57** ?. ????? ?????,
?? 2 5 % ???? ????????? ?????????? ???????? ? ??????????? ????? ????-
17
?????, ??? ???????? ???????? ?????????????????. ??????????? ??????н
????? ???????? ??????? ?????????????? ????-???????.
??????????? ????????? ????-??????? ?????????????? ??? ???????н
??? ???????? ? ?????????? ??????????? ?????????-???????????????????
???????? ??? ????????????? ????????????? ????????????, ?????????н
???? ??????? ? ????????, ? ??? ??????????? ??????? ???. ??????????н
???????? ???????????? ?? ??????? ?????????? ????????? ???????????
?????????????????? ??????????? ?????????????? ?????? ????. ?????
???? ??????????? 78 ????. ?????????? ???????????? ??????????????? ??
????????????? ????????? ?????????? ? ?????? ? ???????? ??????? ?????
? ????????? ??????? ??????? ??? ????? ??? ? 2 ???? (????.4). ??????? ??н
??????, ??? ??? ?????, ?????? ????????????? ????????? ??? ??????????н
???????? ????????????, ????????? ?????????????? ? ??? ???-????????.
?????????? ?????????? ????????????? ??????????.
???????? ?? ????????? ????????????? ?????? ????-??????? ??? ???н
??????? ?????????-?????????????????? ????????????, ??? ??????????? ??
????????? ????????????? ?? ??? ????????????? ??????????. ??? ???????н
??? ?????? ????-??????? ????????? ????? ????? ? ????????????? ????? ?
??????????????? ? ??????? 18 ?????, ??? ??????????? ?????????????????
????????????. ? ???????? ?????? ???????? ????? ?????????? ?????????н
?????? ??????, ???????????? ????????????? ??????????. ??????????
????-??????? ?????? ???????????? ??????????? ????? ?? ??????????? (6
????????) ????????? ???? ?????????? ???, ??????????? ??????????? ??н
?????????????? ???????.
?????? ????-??????? ??? ???????? ???????? ???? Salmonella, ??????н
???????? ???? - л?????- ???? - Salmonella species 250╗ (????? ?? ??)
- ???????????? ????? ???????? ?? ???? ???????? ? ???????????? ???н
????. ?? ?????? ???????????? ????? ????????? ???????? ????????????,
??????????????? ??????????????? ??????. ???????? ????-??????? ??-
18
??????? ??????????????? ???????? ???? ????? ??????? ?????????? ???н
????? 225 ?.?.
??? ????????? ???????? ??????? л?????-???? - Salmonella species
250╗ ???????? ????? ?? ?????????????, ??? ? ????-??????? ?????????? ? ?
? ? ? ? ? ? ??. ?.?. ??????? ? ? ? ? , ? ????????????? ????????????????
???? ???? ? 2 ???? ? ????????? 500 ??/??.
?????????? ?? ?????? ?????????? ???? ??????????? ??????????, ??н
??? ??????? ?????????????? ????????? ??? ??? - ????? 2 ???????? ? ???н
?????????, ????????????? ??????????? ?????, ?????? ????-??????? ???н
??????? ? ? ? ? ? ? ? ? ? ????? ????????????? ? ??????? ? ??????.
???????????? ????????? ????-??????? ????????? ?? ????? ????????
? ?????????? ?????????-?????????????????? ???????????. ??????????н
???????? ?????? ????????? ?????????? ?????????? ? ?????????? ???????
? ? ? ? . ????? ??????????? 96 ????. ??????????? ???????????? ????????н
?????????? ????? ??????? ????????????? ???-???????? ?????????? ??
????????? ? ?????????????????? ????????????? (????. 4) ? ???????? ??н
?????????????? ????????????? ?????? ??? ??? ????????? ?????????
?????????? ? ??????????? ?????????, ????????? ??????? ? ????????
??????? ?????.
??????? 3
????????????? ?????????????? ????????????? ?????????????????
? ? ? ????-?????? ??? ????????? ??????????
???????????
1
2
??????-???????????
???????
26 ???.
6-8 ???.
???????н
?????????
(??/??)
1000
500
?????н
????????
???????н
?????
??????????н
????? ?????
95%
95%
???????
???????
??????????
?? ?????????
??????????: 1 - ??? ????-??????? ?????????? ? ? ? ? ? ? ? ? ? ? ? ? ??.
?.?. ???????; 2 -??? ????-??????? ?????????? ? ? ? ? ? ? ? ? ? .
19
?????????????? ????????? ?????????? ??????????? ????????, ??? ???????????? ?????????? ??????? ??? ???? ????? ? 2 ???? ??????????
???? ?? ????????? ? ??????????????????? ??????????????.
??? ????-??????? л?????-???? - Salmonella species 250╗ (????? ??
??) ?? ?????? ??????? ??????????????? ??????????? ??? ????-???????
?????????? ?? ?????? ??. ?.?. ??????? ???? (????. 3) ? ???????? ??н
??? ????????????? ? ?????????? ??? ?????????? ? ???????????? ??? ?
??????? ????.
??????? 4
?????????? ???????????? ?? ??????? ???????? ???? Salmonella
???????? ??????? ?????????????? ? ???????? ?. ?. ????????? ? ??н
???????????? ????????????? ????????????????? ??? ????-??????
???????????? ???
????-??????? ??? ??н
??????? ???????? ????
Salmonella
??? ????-??????? ???н
??????? ?? ??????
???? ??. ?.?. ????н
???
??? ????-??????? ???н
??????? ????? ??
??
?????
???????????
?????? ? ???н
????? ????н
?????? ?????
? ?????????
??????? (???.)
???????? ??????????
???-?????
(???.).
??????????-???????? ?????
(???.)
78
28
10
96
29
19
174
57
29
????????????? ? 2003 ???? ????? ?? ?? ??? ????-??????? ??? ??н
?????? ???????? ???? Campylobacter ? Yersinia enterocolytica ?????????
??? ??????? ???????????????? ???????????? ???-???????????? ???????н
????? ????????? ?? 4 ???????? ???????????????? ????????????? ???????н
???? ???: ???????, ???????????, ??????????????, ????????. ????????
???????????? ? ?? ??? ?? ??????????? ? ???????????? ???????????? ?
??????? ???????. ????????????? ? ????????? ???????? ??????? ????? ?
????????? ??? ? ??, ? ?????????? ? ?????????????????? ? ???????????
20
??????????? ??????????? ? ?????? ? ????? ? ??????????? ???????????? ??н
????????? ???? ???????? ???????? (?????????? ?.?., 1997).
??? ?????????????? ? ?????? ?????? ????-??????? ???????? ????????н
??? ? ? ? ? ? ? ? ? ? (??????). ??? ????????? ????????? ???????????? ?
??????????? ????????: ???????????? ?????? ????? ????????? ????, ??н
??? ????? ????????????? ??????? ??????????? ?????, ?????? ??? ???н
?????? ????????????, ??? ????????? ?????????? ??????? ? ?????????
????????????????? ?????, ??????? ??? ?????????????.
????? ???????????????? 153 ??????????? ??????? ?? ????? ? ????????
?? 3 ???. ?? 14 ??? ? ??????? ????????? ????????????? ??????????????
?????????. ?????????????????? ?????? ???? ?? ???? ?? ??????? ?????н
???? ??????????? ?????????????? ??? ?8 ?. ??????? ?????????. ??????н
???? ???????????? ???????????? ? ????. 5.
??????? 5
?????????? ???????????? ???-???????????? ????????????
????????? (?-153)
?????-????н
?????
???????? ???????????? ???
???????????
????
(???.)
???
???. ??????
(???.)
%
(???.)
%
SMgella
153
7
5,4
2
1,3
Salmonella
153
45
29,4
22
14,4
Campylobacter
153
3
2
-
-
Yersinia
153
2
1,3
-
-
?????
153
57
37,3
24
15,7
??????? ? ? ? ?????????????? ?????? ?????????? ? 37,3% ???????,
??? ?????????????????? ???????????? - ? 15,7%, ??? ??????????????? ?
????? ??????? ????????????? ??????????? ???-???????? ?????????????
21
???????????? ? ? ? . ?????????? ?????????? ???????? ????????????? ???н
?????????.
??????? ???????????, ??? ?? ???? ?????? ????? ?????? ???? ????н
???? ???????????? ??????? ? ??????????? ???????? ????????????? ?????н
??????? ??? ??????? ??? ? ?????????????????? ???????. ? ???????н
???? ??????? ??? ???? ??????????? ??????????????????? ?????? ? 2 ????
? ????? (????. 6).
??????? 6
?????????? ???????????? ???????????? ????????? ?? ?????????????
??????????? ? ? ? ??????? ? ? ? ? ?????????????????? ???????
(?=1018)
?????-????н
?????
Shigella
Salmonella
Campylobacter
Yersinia
?????
???????????
????
(???.)
383
329
153
153
1018
???????? ???????????? ? ? ?
??? ?????
?????????
(???.)
%
(???.)
67
103
3
2
175
17,5
31,3
20
51
???
???
71
1,9
1,3
17,2
%
5,4
15,5
???
???
7
???????? ????? ?????????? ??? ??????????? ?????????????? ???????
???-??????? ??? ????????? ?????? ???????????? ??????? ? ???????
????????????? ?????? ??? ?? ??????? ?????????????? ?????????? ???н
????????? ???-???????????? ??? ????????? ???????? ????????????? ???н
????????? ? ? ? .
????????? ???????? ???????????? ??????????????
? ?????????????? ????????????? ?????????????????
? ? ? ????-??????
???????? ?????????????????? ???????????? ??????????? ????????
???????????? ?????????????? ? ?????????????? ?????? ? ? ? - ???? ?? ???-
22
?????????? ??????????? ??????????? ?????????????, ??????? ??? ???н
???????????? ???????, ??? ? ???????????? ????????.
??????? ???????????? ????????????? ????????????? ??????????
??????? ?????????????? ? ?? ??????????? ???????????? ????????????
??????? ? ??????????????. ??????? ? ?????? ??????? ????????????, ? ?
???????? - ????????? ?????????? ???????????? ???????. ???? ? ????????
????????????? ??????? ???? ????????, ??? ??????????? ???????? ?? ??н
???????????. ????? ?????? ???????? ????? ??????? ????? ??? (??????? ?.?.?998; ??????????? ?.?. 2000).
?? ?????? ????? ?????? ??? ???????? ?????????? ??????? ?????????н
????? ?? ???????????? ???????????? ??? ????-??????? ??? ?????????
????? ???????? ???????????? ??????????????: LT, ST, VT1 ???????? ?
??????? ???????????? ?????? ? ????????. ?? ???? ??? ???????????????
????? ?? ?.?. ???????? ??? (??????) ? ??????????? ???????? лDNAstar╗ ?? ??????? ???????????? ??????, ?????? ? ?????? ?????????, ???н
???????? ? ?????????????? ???????? ??? ????????? ?????. ?????????н
??? ????-??????, ?????? ??????????? ?????? ????????? ? ?????? ???н
?????? ???????????? ????????????? ??????????, ???????? ??????????н
??? ?? ?????? ????????? ?????????????? ????????? ?????????? ????-???н
???? ??? ????????? ??????? ???????????? ??????.
? ??????????? ????????????????? ??? ????-?????? ??? ?????? 171
????? (??????????? ??????? ??????????????). ? ???????? ????????? ??н
?????????? ?????? ?? ????????? ?????? ? ?????? ?????????????? ???н
????? ????? л?????╗. ???????? ???????????????? ? ??????????? ???????? ?????????????? ??? ?????? ???????????? (44,5%), ? 8,2% ??????? ??н
??????? ??? ????????????? ??????? 1, ???? ?? ????????? ? ????????
(5,8%).
?? ?????? ????? ???????????? ?? ??????? ?????????? ???????? ???н
???????? ???????? ?????????????? ? ?????????????? 2-? ?????????????
????????????????? ??? ????-??????: ????-??????? ??? ???????? ????-
23
??????? ??????? V. cholerae ?????????? ? ? ? ? ? ? ? ? (?????) ? ??????????? ?????????? ? ? ? ? ? ? ? ? ? (??????) ??? ????????????? ?. coli
0157:?7. ?????? ????-??????? ????????? ???????? ??? ????????? ???????
(??????? ?????? LT-???????) ? ???? ???????? ??????? V. cholerae ? V. eltor.
?? ?????? ?????????? ????? ?????????? ???????? Vibrionaceae ?
Enterobacteriaceae ???????? ????? ???????????? ??????????, ???????
???????????? ??????? ??????????? ??????????? ??????? ?????????????? ??
??????? ????? ???????? ???????????? ????????? ???????? (?????? ? . ? ,
2001; ????? J . et al., 1997). ???? ????????? 35 ??????? ????????????????
???????? ?????? ?????????????, 8 ??????? S.sonnei ? 12 ???????
S.flexneri. ? ?????????? ???????????? ??????????? ?????? ?? ???? ????н
????, ? ?????????? ?? ??? ??????? ????????????????? 3 ?????? ?, coli ??н
?? ???????? 0127, ??? ???? ?????????????? ???? ???????? ? ? ? ????????
????? 300 ?.?. ?????????? ????????? ??????????????? ? ??????? ? ?.???
0127 ???????????? ???????? ??????? ? ????? ??????? ????????? ????????.
?????? ???? ??????? ???????.
?????? ??? ????-??????? ????????? ???????? ???? ????????????
???????? 1 ? 2 ( V T 1 , VT2) ? ????? ??????????? ???????? ?7 ?. coli
0157:?7. ??????????? ??????? ?????????????? ???? ??????????? ?? ??н
????? ????????? ????? ? ?? ??? ??????? ???????????? ?????? ? E I E C .
?????????? ? ???? ??????????? ???????????? ?????????? ?????????н
?????? ? ???????????????? ??????????????? ? ??????????? ???????? ??н
???????????? ???????????? ???????????, ????????????? ?? ????????????
(33,0%), ????????????? (22,6%) ? ??????????? (11,4%) ???????????????
(????.7).
??-????????, ??? ???? ???? ?????????????? ? ?????????? ??????н
???????? ? ?????????? ??????????? ??? ???????????? ???????????? ?
??????????-?????????.
24
??????? 7
?????????????????? ????? ???????? ????????????
? ??????????? ???????? ?????????????? (ii=368)
?????-????н
?????
Escherichia
Shigella
Salmonella
????? Enterobacteriaceae
???????н
????
??????? VT
(???.)
1
140
22
163
61
65
368
83
???????? ???? ???????? ????????????
(???.)
VT
LT
ST
ctxA
tcpA
?7
Inv
2
-
-
-
-
-
-
-
??
?????н
????
-
3
-
??
?????н
????
3
32
8
2
6
116
42
122
?? ???????????? ??????????? ????????????? ?? ???? ?????? ???????н
????? ???????? ?????? ???? VT1 (22,6%). ?????? ?? ?????? ????? ?????н
??????? (1994-1996?.?.) ?????????? ?????? ??????????? ?.???. ?????? ?
????????? ????? ??? VT1 ???? ??????????? ? ??????????? ????????
S.flexneri 2?. ???? ???? ??????????? ? ????????????? ??????? ? ???, ???
??? S.flexneri 2?, ???????????? ?????? ? ?????????????? ????????? ???н
????????? ?????????? ? ??, ? ???? ??????? ???????? ???????? ?????????
?????????, ? ??????? ?????? ????????? ??????? ??????????? (??????????? ?.?., 2000; ???? ?.?. ? ??., 2002; Schuch R., 1997).
??????????? ???????????? ???????? ??????????? ?????? ?????????? ?
????????? ???????? ?????????? ????? ???????? ????????????, ????????н
??? ??? ???????? ? ??????. ?????????? ????????? 2 ??????, ? ???????
???????? ?????????, ??????? ? ????? ????? ??????????? ???????? ?7.
????? ???????, ???????? ?? ??? ????????????? ?????????????? ??????????, ???????? ???????????? ?????? ? ??????????????? ???????? ????н
???????? ? ??????????? ???????? Shigella, Salmonella, ?. coli, ?????????? ?
????????????? ???????.
25
???????
1. ??????????? ????? ??????????? ????????????? ??? ????-??????? ??? ??н
?????? ???????? ???? Shigella ? ???????????????? ?. coli, ??????????
?? ???????????? ????????? ? ??????????????? ??????? ??????? ????н
????????.
2. ??????????, ??? ????????????? ????????? ???????? ????? Sliigella ?
Salmonella ??????? ??? ??? ???????????? ???????????? ?????????,
?????? ? ???????? ??????? ????? ? ????????? ??????? ? 2,5 ???? ????,
??? ??? ????????????????? ???????.
3. ???????? ???????????????? ???????????? ???-???????????? ???????н
????? ????????? ?? ??????? ???????? ????? Shigella, Salmonella, Camн
pylobacter ? Yersinia enterocolytica, ???????????? ?????? ? ???????н
????? ????????????? ??????? ?????????? ????????, ????????????
???????????????????? ????? ????????????, ???????? ?????????????
????????? ??????????????? ??????? ?????? ???????? ???????? ?????
??? ? 2 ????.
4. ????????
???????????
????? ???????????? (33,0%)
?????????????
(22,6%) ? ??????????? (11,4%) ??????????????? ? ??????????? ???????? ??????????????, ?????????? ? ?????-??????? ???????. ??????????? ????? ???????????? ???????? ?.??? ? S.flexneri 2?, ???????????
??? ????????????? ??????? 1. ???????? ??????? ? ?.??? 0127 ??????н
?????? ????????, ??????? ? ????? ??????? ????????? ????????.
?????? ????? ?? ???? ???????????
1.
??????? ?.?., ?????? ?.?., ?????????? ?.?., ?????? ?.?? ????????
?.?., ??????? ?.?., ???????? ?.?. ????????????? ?????? ????????????
?????? ??????? (???) ??? ????????? ???????? ???? Salmonella ?? ?????н
??? ??????? ????? // ??. "???????? ? ????????". - ?.????????. - 1997. ?.21-22.
26
2.
?????? ?.?., ???????? ?.?., ??????? ?.?., ??????? ?.?., ????????
?.?., ?????? ?.?. ?????????? ????-?????? (???-??????) ??? ?????????
???????? ????????????? ?????????????? // ???. ???????? - 1994. - ?4. ?.11-12.
3.
?????? ?.?., ?????????? ?.?., ?????????? ?.?., ?????? ?.?., ??н
???? ?.?., ???????? ?.?. ???? ????????????? ???-??????????? ? ????н
?????-?????????????????? ???????? // ??. "???????? ? ????????". ?.????????. - 1998. - ?.18.
4.
?????? ?.?., ?????? ?.?., ?????????? ?.?., ?????????? ?.?.,
?????? ?.?. ???????? ????????? ???-??????????? ? ????????? ?? ?? ????
??? ?. ???? // ? ??. ???????????? ??????? ?????? ? ???????????? ? ????н
??? ???????????? ????????????? ??????????? - ?.????????. - 2000. ?.64-65.
5.
?????? ?.?., ?????????? ?.?., ?????????? ?.?., ?????? ?.?.,
?????? ?.?., ?????? ?.?. ???? ?????? ?????? ?????????, ?????????????
? ?????????? ?????????????? ??? ????????????? ? ????????????? ??.
????????? ?.?.???????? // ??. ??????????????? ? ?????????? ????????
??????????? ?????????????. - ??????, ?.????????. - 2000. - ?.64.
6.
?????? ?.?., ?????? ?.?., ?????? ?.?., ?????? ?.?. ???? ???????н
??? ??? ????-??????? ??? ????????? Vibrio cholerae // ??. ??????????н
????? ???????????? ??????????? - ??????. - 2002. - ?.282-283.
7.
?????? ?.?., ?????? ?.?., ?????????? ?.?., ?????? ?.?., ????????
?.?., ?????????? P.M. ????????? ??????? ??? ???????? ???? Shigella ?
????????? ?????? ?? ??????? ? ??????? ????????? ?????????? //??. ?
????????????? ??????????? ????? "??????? ? ????????". - ?.????????.
-2002.-?.71-72.
27
8.
?????? ?.?., ?????????? ?.?., ??????? ?.?., ?????????? ?.?., ??н
???? ?.?., ?????? ?.?., ?????? ?.?., ??????? ?.?. ???????? ??????,
???????? ? ??????????????? ????????????? ?????????? ??? ??????????
???-??????????? ????????????? ? ???????? ???????? // ??????? ???
??????. - ?.????????. - 2002. - 12 ?.
9.
?????? ?.?., ?????? ?.?., ?????????? ?.?., ?????? ?.?., ????????
?.?.*, ?????????? P.M.* ????????? ??????? ??? ???????? ???? Shigella
? ????????? ?????? ?? ??????? ? ??????? ????????? ?????????? // ??.
"??????????????? ? ?????????? ???????? ?????????????". - ??????. 2001.-?. 120-122.
10.
?????? ?.?., ?????? ?.?., ?????????? ?.?., ?????? ?.?., ????????
?.?., ?????????? P.M. ????????? ??????? ??? ???????? ???? Shigella ?
????????? ?????? ?? ??????? ? ??????? ????????? ?????????? // ??.
"?????????? ??????????????? ? ???????????? ???????????????" - ??????.
-2002.-?.268-270.
????????? ? ?????? 15.06.2004. ?????? 80x84 1/16.
?????? ????????. ?????? ????????.
???.???.?. 1. ???. 120.???.100.
?????????? ?? ????????? ? ???? л???????????? ????????????? ?????╗,
?.????????, ??.??????, 3.
??? ??????? ????
2006-4
23524
/
- f.╗
2 3 mAml
^
i%^\
??\\^.
?? ? ?????????
??????? ?????????????? ????? ????????????? ??????? 1 ????. ? ???????
5
?. coli 0127 ???????? ???????????? ?????????, ??????? ? ?????? ???????
tcpA V. cholerae ? V. eltor. ?????????? ?????????? ?????? ????? ? ???????
??????????????? ???????????? ????????????? ??????? ???????????????.
?????????? ?????????? ???????????? ???-???????????? ???????н
????? ????????? ??? ????????? ???????? ???????? ????????????? ?????н
??????? ????????? ???????????. ????????????? ???????????? ???????
??? ??????????? ?????? ???????? ???????? ????????? ????????? ???????????? ??????????????? ??????? ????? ??? ? 2 ????, ???????? ?????
??????????? ?????????? ? ?????????? Campylobacter ssp. ? Yersinia enterocolitica ? ?????-??????? ???????.
??????-???????????? ??????????
????????? ? ???? ????????? ?????? ??? ????-??????? ??? ????????
?????? ? ???????????????? ????????, ? ????? ?????????????? ? ? ????
??????? ???????????????? ????????????????? ????-??????? ??? ??????н
??? ???????? ????? Salmonella, Campylobacter ? Yersinia enterocolitica ????н
???? ??????? ????????????? ??? ?????????? ???????????? ????????????
????????? ? ? ?????????-?????????????????? ????????.
???????? ???????????????? ????????? ????????????? ??? ????-???н
??? ??? ???????? ????????????? ???????????? ?????? ???????? ?????н
??? ?????????? ????????? ??? ? ???????????? ???????? ??? ? ???????
????. ????????????? ??? ????-??????? ????? ??????? ??????? ????н
?????????? ???? ?????? ???, ?????? ? ?????? ? ??????, ???? ??????????
? ??????????????? ?????????, ????????? ???????? ???????? ????????????
??????????? ???????? ???????? ? ?????????-??????????????????? ???н
???? ?? ?????????? ?????????????.
????????????? ?????? ??? ??? ???????? ????????????? ?????????н
??? ?????? ???????? ???????? ? ???????? ?? ?????????? ??????? ????
??????????? ???????? ????? ??????? ?????????? ? ?????????? ?????н
??????? ???????? ??????? ?????????????? ? ????????.
6
???????? ?????????, ????????? ?? ??????
1. ????????????? ? ? ? ????-???????, ?????????? ?? ????????????
?????????, ??????????? ? ??????? ????????????, ????????? ? ???????
????????????????? ? ?????????????? ????????? ????????? ?????? ? ???????????????? ???????? ? ??????????? ????????? ?? ??????? ???????
????????? ??????????.
2. ?????????? ???-???????? ?????? ? ?????????? ????????? ?????
??? ? 2 ???? ????????? ????????????? ????????? ????????? ?????????н
??? ??????? ? ??????????? ????????? ? ??? ?????????? ?????????-?????н
????????????? ????????????.
3. ????????????????? ????????????? ? ? ? ????-??????? ??? ????????
????????????? ??????? ?????????????? ????????? ???????? ?????, ?????н
?????? ?????????? ? ?????????????????? ???????????? ???????????
???????? ???????????? ? ??????????? ???????? Shigella, Salmonella, ?. coli.
4. ??????????? ? ???????????? ????????????? ??????????? ???-???????????? ???????????? ????????? ?? ??????? ???????? ????? Shigella,
Salmonella, Campylobacter ? Yersinia enterocolitica ??? ?????????? ??????н
???? ???????????? ??????? ??????? ????????? ??????????.
????????? ??????
???????? ????????? ??????????? ???????? ?? ??????-????????н
???? ?????????? "?????????? ??????????????? ? ???????????? ??????н
?????????" (??????, 2002), ?? ??????-???????????? ??????????? л????н
??????????? ???????????? ???????????╗ (?. ????????, 2003), ?? ?????????????????? ???????????, ??????????? 100-????? ?? ??? ???????? ?????? ?.?. "?????????? ???????? ????????????? ???????????? ?????н
???" (?.????????, 2003), ?? ????????? ??????? ?????? ? ????????????????
???????? ?????????????? ? ? ? ????????????? ? ????????????? ??. ????.
?.?.????????. ?? ???? ??????????? ???????????? 10 ?????.
7
????????? ? ????? ???????????
??????????? ???????? ?? 143 ????????? ????????????? ??????, ????н
?????????? 13 ????????? ? 12 ?????????, ??????? ?? ????????, ?????? ??н
????????, ?????????? ? ??????? ????????????, ??????????? ? ?? ???????н
???, ??????????, ???????, ?????? ??????????, ??????????? 192 ?????н
????, ?? ??? 114 ???????????.
?????????? ? ? ? ? ? ?
????????? ? ??????
????????? ???????????? ???????? 263 ?????? ?????????????? ?????
Sliigella, Salmonella, Escherichia, Klebsiella, Enterobacter, Citrobacter ?? ???н
?????? ?????? ? ???? ????????????? ?? л?????╗; 368 ??????? ??н
????????????, ?????????? ?? ??????? ??????? ????????? ??????????,
525 ???? ???????????? ????????? (???????, ?????????? ?????); 174 ?????
????????? ??????? ? ?????? ? ???????? ??????? ?????.
???????? ???????? ????????????? ????????? ?.?.,???????? ?.?.,
??????????? P.M., ? ????????? ?,?. - ??????????? ??? ?8 ?. ?. ?????н
???? ?? ?????????????? ???????????? ????????? ? ??????????????? ????н
??? ??????????????.
????????? ?????? ?????? ???????????? ?????? ??????? ???????????
???????????? ???????????: ?.?.?. ??????? ?.?., ?.?.?. ??????? ?.?.,
?.?.?. ?????????? ?.?., ?.?.?. ??????????? ?.?., ?.?.?????? ?.?.
? ?????? ???? ???????????? ???????????-????????????? ??????: ???????????? ?????? ???????, ?????? ?????????? ???????? ????????, ???н
????????? ?????? ???????????? ??????????????????? ??? ????????.
????? ????????? 2472 ???-????????????, 164 ??????? ??????????? ??н
????? ????????.
8
??? ???????? ????-??????
??? ????????? ????? ???????? ?????????-
??? ?????????????? ????????? ?????? ? ?????? ????????? ?? ?????? ???н
?????????? ??????? ???????????? ??????????????????? ? ? ? ????? ? ???н
???????? ?????? ???????? лDNA-star╗.
??? ??????????? ??????
???
? ????????????? ?????????? ???
???????? ????????????? ?????? ????????? ???????? ??????????????? ?
?????????? ???: ??????????? ?? ??????? ??????? ????, ??????????????
????? ? ????????-???????????? ????????????????, ????? ?????????????????????????? ? ???????? ? ? ? ?? ??????????.
??? ??????????????
?????????? ??????? ??????????? ???????? ??н
???????????? ????????? ???????????? ????????????????? ? ? ? ????-???н
???? ? ?????????? ? ????? L T , ST, V T ???????? ? ??????? ????????????
?????? ? ????????, ????????????????? ? ? ? ????-??????? "?.??? tox (VT1, VT-2, ?7)" ???????????? ? ? ? ? ? (??????), ? ????? ?????????????????
? ? ? ????-??????? ???????????? ? ? ? ? ? ? ? ? (?????) ? ?????????? ?
???? ????????? ????????????? ctxA V . cholerae ? ? ???? ??????? tcpA ??н
?????? ?????????.
????????? ????????? ???????????? ????????? ??????? ?????????н
???? ? 2 % ????????? ????, ????????????????? ????????????? ?? ???????н
?????????? ? ???????????????? ????? ? ??????????????? ?? ??????????
л?????? 300╗. ???????????? ????????? ??????????? ??????????? ??? ??н
???? ???????????? ????????? л???????╗ ????? "Keklab" (??????).
???????? ??????????? ???????
?????? ??????? ?????????????? ???н
?????? ??????? ????????????? ????????????? ?? ???????? (Eckhardt ?.,
1978) ? "????????" ??????? (???????? ?.?. ? ??., 1995).
??????????????
???????
????????? ???????????
?????????????
??????????
???????????? ????????? ?
? ???????????
??????????????
??????? ????????? Microsoft Excel (?????? ???????????? ??????????). ? ? н
????????? ?????????? ?????? ??? ????????? ???? ?????????????? ???-
9
?????????? ????????? ? ?????????????? ???????? ??-??????? (????? ?.?.
?????????????? ??????, ??????, "?????", 1964, ?. 237-239)
?????????? ???????????? ? ?? ???????????
?????????? ??? ????-??????? ??? ????????-???????? ?????? ?
???????????????? ????????
??? ???????????? ?????? ??????? ?????????????? ?? ????????? ??н
???????????? ????? ? ??????????? ?? ???????????? ?????????????
"?????" ???? ???? ??????????? ??? ????-???????, ?????????? ????
???????? ???????????? ??????????????: LT, ST, VT1 ???????? ? ???????
???????????? ?????? ? ????????.
? ??????????? ???????? лDNA-stan> ?? ???? ??? ???????????????
????? ? ? ????? ?? ?.?. ???????? (??????) ??? ???????? ?????????н
??? ??????, ?????? ? ?????? ?????????, ??????????? ? ???????? ??? ??н
??? ???????? ???????????? ??????????????.
????????, ??????????? ? ??????? ??? ???? ??????? ????????????
?????? ? ???????????????? ???????? (inv):
SF-1 5' - GGAAGCTTAATACTCCTGAACGGCG - 3'
SF 2 5' - GGAAGCTTAGGTGTCGGCTTTTCTG - 3';
??????????? ????? ???????? ?? ??????????? ????? ?. ? ????????
"?????? ??????" (??????, "???", 1990, ?. 176-190). ??? ?????????? ???
??? ???????????? ???? ???????????? ????? "Sigma" (???) ? ???????
??????????????? Tag-??????????, ???????????? ???????????? ??? "???н
????".
??????????? ?????? ????????? ?????????????? ?? ???????:
T^.= 2(A+T) + 4(C+G)-5
? ?????? ????? ?????? ????????????? ??? ????-?????? ??? ????????
????????????? ???????????? ?????? ???????? ???????? ? ???????????
????????? ?? ????????????.
10
??? ????????????? ???? ??? ????-??????? ?????????????? ??? ???н
????? ????????????? ????????????? ?????? ??????? ??????????????, ???
???? ???? ????????, ??? ??????????? ??? ?????? ?????? ??? ???????????
?? ???? ? 3 ?????? E.coli ???????????? 0124:?72 ????????????????? ?
??????????, ???????????? ? ??????? ??? ??????? ????????????. ????н
????????? ????????? ??? ????^?? ? ?????????? ???????? ??????, ? ??????? ???? ???????? ?????????? ??????? ??????? (???? ? 120 ??), ?????????? ?? ?????? ?????????? ?????? ???????????? (Sasakawa ?. et al.,
1986; ???????? ?.?., 1997).
????????? ???????????? ????????? ???? ??????? ????????????:
94*0-3 ???} 1; 94''? - 1 ???, SS'C - 1 ???, 71░? - 1 ???}35; ??^? - 5 ???} 1.
???????????? ????????? ? ?????? ?????????? ????????????? ???н
???????? ?? ??????? "?????-250" ????? "??????" (??????). ?????? ???н
????????????? ????????? ??? - 760 ?.?.
????????????????? ??????? ????-??????? ??? ??????????? ??? ???н
?????????? ??????? ??????? ?????????????? ??????????? ? ????????????
??????????? ?. ??????? ?????????. ?????????? ????????????, ????????н
?????? ? ????. 1 ????????????????? ? ??????????????? ?????????? ??????
??? ? ??????????? ???.
??????? 1
?????????? ???????????? ???????????? ????????? ??? ?????????????
??????? ? ? ? ? ???????????? ??????????? ?. ?.?????????
?????????
??????????????? ????н
???? ?1
????????????? ??? ??н
?????
?????
?????????? ??н
???????????
(???.)
????????? ????????????
40
???
(???.)
7
???. ??????
(???.)
26
6
-
66
13
-
-
11
??? ????????? ???????????????? ???????????? ?? ?????????????
???????????? ????? ? ??????????? ??????? ? ??????? 18 ????? ??? 37"?,
??? ??????????? ??????????? ????????????????? ????????????.
????????????????? ????-??????? ? ?????????? ??????????? ?????н
???? ? ???????????? ???????????-????????????? ??????????? ????? ??
??.
??? ?????????? ???????????????? ? ????????????? ?? ????????????
??????? "????"-???. ? ?????? ???????? ???????????? ??? ???? ?????????, ?? ???????????? ???????? ? ???? ???? ? ????? ??????????? ?????.
???????????? ??????, ?????? ? ?????? ????????? ??????????? ??н
?????????? ??????????? ???????????? ??????????? ?????, ????????
????????????? ????????? ?? ?????? ????????? ??????????????, ??????н
??? ????-??????? ?? ??????????? ????????? ??????????? ???? ?? ????
????? ??. ????. ?.?.????????. ?? ??????????? ?????????? ?????? ???
????-??????? ???? ???????? ????????? 2 ???? ?????????:
???????: Shi 5' -GCTACTTCTTTCTGGATGGTATGGTGAGG-3';
Sh2 5' - CTAAGCATTGCCCCACGCTGGTTGTC-3';
??????????: Sh3 5' - GGACATTTTCAAGCTGGTTC-3';
Sh4 5' - GGCCAACAATTATTTCCTTG-3'.
??? ?????? ????????????? ????????? ? ??????? ??? ?? ???????н
????? ????????? ??????????????? ?? ????????????? ??????? ?????????
??? ? ???. ?????????? ?? ???????? ???????????????, ????? ??????? ??
????????????????? ???????? ??? ???????????????? ??????? ??????????
?????????????? ????????? ??? ?????????? ????????? ????????????????
???????.
????? ????????? ?? ??????? ???? ??? ???????? ??? ?????? ?????? ?
??????? ?????????? ???????????????. ??? ????????????? ??????? ???н
???????????? ?????? ? ????????-???????????? ??????????????? ??????н
???? ???? ????????? ??????????????? ????? ? ??? ? ??????? 18 ?????,
????? ???????? ??????????? ?????????? ??? ??? ????????????. ?????-
12
??? ??????????? ??? ????? ????????????????? ?????? ?????????????????????????? ? ??????????? ???????? ? ? ? ?? ??????????. ????? ????????
??????????? ????????????? ? ?????? ?????????????? ????????? ? ?????н
???? ???????? ???????????? ?????????? ??????? ????????? ???????????
?????? ??? ?????? ??????????????? ?????. ??? ????????? ???? ????????н
???? ????? ????????? "???-???? ?" ?????????? ? ? ? ? ? ? ? ? ? (??????).
? ?????? ? ????? ????????? ????-??????? "Ampli-Inv" ?????????н
??? ??????????? ?? ?????? ???????????? "?????? ? ? 2 " ????? л?????????????╗ (?. ??????), ??????? ???????????? ?????????? ? ? ? ? ????н
???? ? ??????????, ? ????????? ????????????? ???????? ????????????.
????????? "????"-??? ??? ??????? ????????? ??????? ???????????? :
95''? - 3 ???.} 1; PS'C - 15 ???., 65░? - 15 ???., 12░? - 15 ???.} 10; 95''? 11 ???., 55░? - 11 ???., ?^? - 11 ???.} 30; ?^? - 1 ???.} 1.
?????? ???????????????? ????????? ?1? - 348 ?.?.
??????????????????? ????????? ????, ?????????????? ?????? ??н
??????? ????????????? ??? ??????? ????????? ???????????? ?????????
?????? ??? ?? 10-15 ??? ? ??????????? ????????? ????? ????????????н
????? ???????? (?? 1,5 ?????), ?????????????? ? ????????? ????????????,
???????? ?? ????????, ??? ???? ?????????????????? ??? ???????????????????????????? ???????? ?????? ???????? ? ? ? ????-???????.
????-??????? ????????? ?????? ????????????? ????????? ??? ??????н
?????? ? ? ? S. flexneri 2? 10'" ?/??. ????????????? ???????????????? ??????????? "Ampli-Inv" ????????? 500 ??/??. ?? ??????????? ????????????
???????????? ????????? ???????????????? ????-??????? ????????? 97,3 % ,
? ????????????? - 95,4 % .
?? ????????????? ??? ????-??????? "Ampli- Inv" ???????????? ??н
????-??????????? ???????????? ( ? ? ? , ? ? ? , ?????????? ?? ??????????).
???????????? ?????? ?????? ???? ???????? ? ? ? ? ? ? ??. ?.?.??????????
(??????).
13
????????????? ????????????? ????-??????? ???? ??????????? ??
????????? ?????? ??????? ??????????????: ???? ????? ??????, ?????????
????????????? ????????, ????????? ????? Salmonella, ???81?11?, Enterobacter ? ??. ??? ??????????????? ?????? ???????? ???? Shigella ? ????н
???? ?. ??? 0124:?72 ???? ????????????? ????????? ? ???. ???????????
???????????? ??????????? ???????????? ??????, ?? ??????? ????????,
??? ???????? ??????? ???????????? ?. ??? ????? ?????? ????????????,
?????????? ????????????
(?????????? ?.?.,
1985). ?????? ????н
?????????? ?????? ????? ?????? ????????????? ?????????.
? ???? ???????????? ????????? ????-??????? ???? ????????? ?????н
???????, ? ??????? ???????????? ?????????????? ?????? ? ???? "????н
??????" ?????????. ????? "??????????" ??????? ? ? ? ?? ????????? ????н
??????? ?? ???????????????? ? ????????????? ?? ????????? ????????, ??н
????????? ?? ???????? "????"-???, ?? ???????? ????? ????????? ? ????н
??? ?????? ???????. ? ?????????? ???????????? ????????? ? ????????н
?????? ????? ???? ????????? ? ????????? ???????????? ? ?????????
??????: 95"? - 5 ???. } 1; 95"? - 10 ???., ??^? - 10 ???., 72░? - 10 ???.} 42;
??^? - 1 ???. } 1 . ?????? ?????????????? ????????? ? ? ? ??????? ???????н
????? ?????? ? E I E C - 348 ?.?.
??????????? ????????? ? ? ? ????-??????? "???11-1??" ???? ?????н
???? ?? ???? ????????????? ??? ?8. ?? ?????? ? 2001 ?? 2002 ??? ????
??????????? 165 ???????? ???????????? ????????? (????????? ?????) ??
??????? ? ??????????: ? ? ? , ??????????, ?????????????, ???????, ???????
??????????????, ? ? ? ? .
? ? ? ????? ??????????? ??????????? ?????????????????? ??????? ?
?????????????????? ??????????? ??? ?8.
????????????? ????????? ?????? ? ??????????? ????????? ???????
??? ???? ???? ????? ??? ? ???? (28,5%) ?? ????????? ? ??????????????н
???? ??????? (11%). ?????????????? ????????? ???????? ?????????????
?????????? ???????????.
14
??? ????????? ?????? ??? ? ??????????????????? ??????? ???? ??н
?????? 4 ?^????? ??????????? (????).
????+???+
? ???+???? ???-???+
????-???-
???. 1. ???????? ???????????, ?????????? ??? ???????????? ???????н
????? ???????????? ????????? ?? ??????? ?????? ? E I E C ???????
??? ? ?????????????????? ??????? (?=165)
?????????? ???????????? ????????, ??? ??????? ???????????????? ??н
???? ??? ????????? ???????? ?????? ???????????? ???????????, ???????
?????????????????? ??????? ?? ??????????. ????? ????, ????? ??? ??н
?????? ??????????????, ??????????? ? ???????????????? ?????????, ??н
????? ??????? ???? ???????? ??? ????????????????? ????????, ? ???
????? ? ??? ?????? (???????? ?.?. ? ??., 1993; ???????? ?.?. ? ??., 1997,
1999; ??????????? ?.?., 1997; Corwell P.R. et al., 1994). ????? ?????????
??????????????? ??????????????? ????????? ?????????????? ??????????
? ??????????????? ???????? ? ?????????????? ????? ?? ??????????? ???н
???. ??? ???? ???????? ????????? ???? ???????????? ???????? ? ?????н
??????????? ? ??? ????? ??????? ?? ????????????? ???????? ???????
????????????.
????????????? ??? ????-??????? ???????? ?? ?????? ???????? ????
Shigella, ?? ? ???????????????? ????????, ??????? ? ??????????????????
??????????? ??? ?8 ?? ???????? ??-?? ?????????? ????????????? ????н
?????????.
15
??? ????? ?? ??????? 2, ??????? ??? ??????? ???? ???????? ??????
?
??????????? ????????, ?????????? ?? ????? ? ????????? ? ? ?
?
??????????. ?????????? ?????? ????????????? ??????????.
??????? 2
????????? ???????? ???? Shigella ? ??????? ? ??????????
???????????? ??????????
???????
???
??????????
?????????????
???????
????
???????
???????????????
?????
??????????
?????????????
49
18
31
22
18
???????? ??????
??????????????????
??????? ???
???????
???.?.
???.?.
%
%
16,3
30
61,2
8
55,5
17
94,4
10
-
-
?
-
-
27
-
-
-
-
165
47
28,5
18
?
? ???????? ????????????????? ?????? ???????????? ??????????????н
??? ?????????????????? ???????? ? ? ? ????-???????: ? 2003 ???? ????-???н
???? ????????????? ?????????? ??????????? ???????? ( ? ? ? ) , ???????
????????? ???????? ?????????????????? ?????????? ??? ?????1???????
? ? ? ???????????? ???????????? ??????? ? ???????? ???????????????????? ?????? ?????? - ????????????????????? ??? ?????????? ?????????????????? ???????????.
????????? ? ??????????? ? ?????????? ???????????? ???????н
????? ????????????????? ????????? ? ? ? ????-?????? ??? ????????
??????????, ???????????????, ????????
??????????? ???????? ???? ?? ??????? ???? ? ????????? ? ? ? ? ??н
????? ?????? ???????? ?????????? ??????????? ?????????-?????????
16
??????, ??????? ????????-???????? ?????????? ? ??????????? ?????????
???????? ?????????? ?????????.
??????? ?????? ???????????? ???????? ????????? ?? ??????????? ??н
??????? ????????????? ? ?????????? ??????? ???? ?????????????????
????????????? ? ? ? ????-?????? ??? ???????? ???????? ???? Salmonella:
? ? ? ? ? ? ? ? ??. ?.?. ??????? ? ? ? ? (??????) ? ? ? ? ? ? ? ? ? ? ( ? ? н
????).
?????? ????-??????? ???? ??????????? ?? ?????? ????????? ? ???????
? ? ? ???????????? ??????? ??? ? ?????????? ? ????????? ??????????????? ???????? ???????? 500 ?.?.
?? ?????? ????? ?????? ?? ??????? ?????? ????????????? ??????????? ?? ????????? ?????? ??????? ??????????????. ??? ?????????
????????????
??????????
????
?????????????
?????????.
???
??????????????? ? ??????? ????????????? ?????? ????-??????? ???????
?????????? ?? ??????????, ? ??????? ??????????? ? ????????????? ??????????? ?????? ? ????????? ???????????? Salmonella typhimurium.
???????? ????-???????
???????????????
??????
?? ?????????????????
?????
??????????????,
??
?
???????
?????
??
?????????
??????? ????? Citrobacter freundii 021,022,038; ?. coli 0111,044, 077.
?????????????
????????????????
??
?????????
?????????????
S. typhimurium ? S. enteritidis ????????? 1000 ??/??.
??? ?????????? ? ? ? ?????????????? ????-??????? ???? ??????????
??????? ?????????, ????????? ?? 5 ????????? ??????.??????????? ??????
????????? ?? ?????? ?????? ???????????? ?????????? 60, 57, 55" ?. ??
????? ???????? ????????????? ????-??????? ???? ???? ??????? ??????н
??? ? ?????????, ??????????? ????????? ????? ?????????? ? ? ? ? ????н
???? ???????? ??????????: л??????? ?????╗ ????????? ? 10 ?? 4 ?????,
??????? ????????? ??? ??????????? ?????? ????????? 57** ?. ????? ?????,
?? 2 5 % ???? ????????? ?????????? ???????? ? ??????????? ????? ????-
17
?????, ??? ???????? ???????? ?????????????????. ??????????? ??????н
????? ???????? ??????? ?????????????? ????-???????.
??????????? ????????? ????-??????? ?????????????? ??? ???????н
??? ???????? ? ?????????? ??????????? ?????????-???????????????????
???????? ??? ????????????? ????????????? ????????????, ?????????н
???? ??????? ? ????????, ? ??? ??????????? ??????? ???. ??????????н
???????? ???????????? ?? ??????? ?????????? ????????? ???????????
?????????????????? ??????????? ?????????????? ?????? ????. ?????
???? ??????????? 78 ????. ?????????? ???????????? ??????????????? ??
????????????? ????????? ?????????? ? ?????? ? ???????? ??????? ?????
? ????????? ??????? ??????? ??? ????? ??? ? 2 ???? (????.4). ??????? ??н
??????, ??? ??? ?????, ?????? ????????????? ????????? ??? ??????????н
???????? ????????????, ????????? ?????????????? ? ??? ???-????????.
?????????? ?????????? ????????????? ??????????.
???????? ?? ????????? ????????????? ?????? ????-??????? ??? ???н
??????? ?????????-?????????????????? ????????????, ??? ??????????? ??
????????? ????????????? ?? ??? ????????????? ??????????. ??? ???????н
??? ?????? ????-??????? ????????? ????? ????? ? ????????????? ????? ?
??????????????? ? ??????? 18 ?????, ??? ??????????? ?????????????????
????????????. ? ???????? ?????? ???????? ????? ?????????? ?????????н
?????? ??????, ???????????? ????????????? ??????????. ??????????
????-??????? ?????? ???????????? ??????????? ????? ?? ??????????? (6
????????) ????????? ???? ?????????? ???, ??????????? ??????????? ??н
?????????????? ???????.
?????? ????-??????? ??? ???????? ???????? ???? Salmonella, ??????н
???????? ???? - л?????- ???? - Salmonella species 250╗ (????? ?? ??)
- ???????????? ????? ???????? ?? ???? ???????? ? ???????????? ???н
????. ?? ?????? ???????????? ????? ????????? ???????? ????????????,
??????????????? ??????????????? ??????. ???????? ????-??????? ??-
18
??????? ??????????????? ???????? ???? ????? ??????? ?????????? ???н
????? 225 ?.?.
??? ????????? ???????? ??????? л?????-???? - Salmonella species
250╗ ???????? ????? ?? ?????????????, ??? ? ????-??????? ?????????? ? ?
? ? ? ? ? ? ??. ?.?. ??????? ? ? ? ? , ? ????????????? ????????????????
???? ???? ? 2 ???? ? ????????? 500 ??/??.
?????????? ?? ?????? ?????????? ???? ??????????? ??????????, ??н
??? ??????? ?????????????? ????????? ??? ??? - ????? 2 ???????? ? ???н
?????????, ????????????? ??????????? ?????, ?????? ????-??????? ???н
??????? ? ? ? ? ? ? ? ? ? ????? ????????????? ? ??????? ? ??????.
???????????? ????????? ????-??????? ????????? ?? ????? ????????
? ?????????? ?????????-?????????????????? ???????????. ??????????н
???????? ?????? ????????? ?????????? ?????????? ? ?????????? ???????
? ? ? ? . ????? ??????????? 96 ????. ??????????? ???????????? ????????н
?????????? ????? ??????? ????????????? ???-???????? ?????????? ??
????????? ? ?????????????????? ????????????? (????. 4) ? ???????? ??н
?????????????? ????????????? ?????? ??? ??? ????????? ?????????
?????????? ? ??????????? ?????????, ????????? ??????? ? ????????
??????? ?????.
??????? 3
????????????? ?????????????? ????????????? ?????????????????
? ? ? ????-?????? ??? ????????? ??????????
???????????
1
2
??????-???????????
???????
26 ???.
6-8 ???.
???????н
?????????
(??/??)
1000
500
?????н
????????
???????н
?????
??????????н
????? ?????
95%
95%
???????
???????
??????????
?? ?????????
??????????: 1 - ??? ????-??????? ?????????? ? ? ? ? ? ? ? ? ? ? ? ? ??.
?.?. ???????; 2 -??? ????-??????? ?????????? ? ? ? ? ? ? ? ? ? .
19
?????????????? ????????? ?????????? ??????????? ????????, ??? ???????????? ?????????? ??????? ??? ???? ????? ? 2 ???? ??????????
???? ?? ????????? ? ??????????????????? ??????????????.
??? ????-??????? л?????-???? - Salmonella species 250╗ (????? ??
??) ?? ?????? ??????? ??????????????? ??????????? ??? ????-???????
?????????? ?? ?????? ??. ?.?. ??????? ???? (????. 3) ? ???????? ??н
??? ????????????? ? ?????????? ??? ?????????? ? ???????????? ??? ?
??????? ????.
??????? 4
?????????? ???????????? ?? ??????? ???????? ???? Salmonella
???????? ??????? ?????????????? ? ???????? ?. ?. ????????? ? ??н
???????????? ????????????? ????????????????? ??? ????-??????
???????????? ???
????-??????? ??? ??н
??????? ???????? ????
Salmonella
??? ????-??????? ???н
??????? ?? ??????
???? ??. ?.?. ????н
???
??? ????-??????? ???н
??????? ????? ??
??
?????
???????????
?????? ? ???н
????? ????н
?????? ?????
? ?????????
??????? (???.)
???????? ??????????
???-?????
(???.).
??????????-???????? ?????
(???.)
78
28
10
96
29
19
174
57
29
????????????? ? 2003 ???? ????? ?? ?? ??? ????-??????? ??? ??н
?????? ???????? ???? Campylobacter ? Yersinia enterocolytica ?????????
??? ??????? ???????????????? ???????????? ???-???????????? ???????н
????? ????????? ?? 4 ???????? ???????????????? ????????????? ???????н
???? ???: ???????, ???????????, ??????????????, ????????. ????????
???????????? ? ?? ??? ?? ??????????? ? ???????????? ???????????? ?
??????? ???????. ????????????? ? ????????? ???????? ??????? ????? ?
????????? ??? ? ??, ? ?????????? ? ?????????????????? ? ???????????
20
??????????? ??????????? ? ?????? ? ????? ? ??????????? ???????????? ??н
????????? ???? ???????? ???????? (?????????? ?.?., 1997).
??? ?????????????? ? ?????? ?????? ????-??????? ???????? ????????н
??? ? ? ? ? ? ? ? ? ? (??????). ??? ????????? ????????? ???????????? ?
??????????? ????????: ???????????? ?????? ????? ????????? ????, ??н
??? ????? ????????????? ??????? ??????????? ?????, ?????? ??? ???н
?????? ????????????, ??? ????????? ?????????? ??????? ? ?????????
????????????????? ?????, ??????? ??? ?????????????.
????? ???????????????? 153 ??????????? ??????? ?? ????? ? ????????
?? 3 ???. ?? 14 ??? ? ??????? ????????? ????????????? ??????????????
?????????. ?????????????????? ?????? ???? ?? ???? ?? ??????? ?????н
???? ??????????? ?????????????? ??? ?8 ?. ??????? ?????????. ??????н
???? ???????????? ???????????? ? ????. 5.
??????? 5
?????????? ???????????? ???-???????????? ????????????
????????? (?-153)
?????-????н
?????
???????? ???????????? ???
???????????
????
(???.)
???
???. ??????
(???.)
%
(???.)
%
SMgella
153
7
5,4
2
1,3
Salmonella
153
45
29,4
22
14,4
Campylobacter
153
3
2
-
-
Yersinia
153
2
1,3
-
-
?????
153
57
37,3
24
15,7
??????? ? ? ? ?????????????? ?????? ?????????? ? 37,3% ???????,
??? ?????????????????? ???????????? - ? 15,7%, ??? ??????????????? ?
????? ??????? ????????????? ??????????? ???-???????? ?????????????
21
???????????? ? ? ? . ?????????? ?????????? ???????? ????????????? ???н
?????????.
??????? ???????????, ??? ?? ???? ?????? ????? ?????? ???? ????н
???? ???????????? ??????? ? ??????????? ???????? ????????????? ?????н
??????? ??? ??????? ??? ? ?????????????????? ???????. ? ???????н
???? ??????? ??? ???? ??????????? ??????????????????? ?????? ? 2 ????
? ????? (????. 6).
??????? 6
?????????? ???????????? ???????????? ????????? ?? ?????????????
??????????? ? ? ? ??????? ? ? ? ? ?????????????????? ???????
(?=1018)
?????-????н
?????
Shigella
Salmonella
Campylobacter
Yersinia
?????
???????????
????
(???.)
383
329
153
153
1018
???????? ???????????? ? ? ?
??? ?????
?????????
(???.)
%
(???.)
67
103
3
2
175
17,5
31,3
20
51
???
???
71
1,9
1,3
17,2
%
5,4
15,5
???
???
7
???????? ????? ?????????? ??? ??????????? ?????????????? ???????
???-??????? ??? ????????? ?????? ???????????? ??????? ? ???????
????????????? ?????? ??? ?? ??????? ?????????????? ?????????? ???н
????????? ???-???????????? ??? ????????? ???????? ????????????? ???н
????????? ? ? ? .
????????? ???????? ???????????? ??????????????
? ?????????????? ????????????? ?????????????????
? ? ? ????-??????
???????? ?????????????????? ???????????? ??????????? ????????
???????????? ?????????????? ? ?????????????? ?????? ? ? ? - ???? ?? ???-
22
?????????? ??????????? ??????????? ?????????????, ??????? ??? ???н
???????????? ???????, ??? ? ???????????? ????????.
??????? ???????????? ????????????? ????????????? ??????????
??????? ?????????????? ? ?? ??????????? ???????????? ????????????
??????? ? ??????????????. ??????? ? ?????? ??????? ????????????, ? ?
???????? - ????????? ?????????? ???????????? ???????. ???? ? ????????
????????????? ??????? ???? ????????, ??? ??????????? ???????? ?? ??н
???????????. ????? ?????? ???????? ????? ??????? ????? ??? (??????? ?.?.?998; ??????????? ?.?. 2000).
?? ?????? ????? ?????? ??? ???????? ?????????? ??????? ?????????н
????? ?? ???????????? ???????????? ??? ????-??????? ??? ?????????
????? ???????? ???????????? ??????????????: LT, ST, VT1 ???????? ?
??????? ???????????? ?????? ? ????????. ?? ???? ??? ???????????????
????? ?? ?.?. ???????? ??? (??????) ? ??????????? ???????? лDNAstar╗ ?? ??????? ???????????? ??????, ?????? ? ?????? ?????????, ???н
???????? ? ?????????????? ???????? ??? ????????? ?????. ?????????н
??? ????-??????, ?????? ??????????? ?????? ????????? ? ?????? ???н
?????? ???????????? ????????????? ??????????, ???????? ??????????н
??? ?? ?????? ????????? ?????????????? ????????? ?????????? ????-???н
???? ??? ????????? ??????? ???????????? ??????.
? ??????????? ????????????????? ??? ????-?????? ??? ?????? 171
????? (??????????? ??????? ??????????????). ? ???????? ????????? ??н
?????????? ?????? ?? ????????? ?????? ? ?????? ?????????????? ???н
????? ????? л?????╗. ???????? ???????????????? ? ??????????? ???????? ?????????????? ??? ?????? ???????????? (44,5%), ? 8,2% ??????? ??н
??????? ??? ????????????? ??????? 1, ???? ?? ????????? ? ????????
(5,8%).
?? ?????? ????? ???????????? ?? ??????? ?????????? ???????? ???н
???????? ???????? ?????????????? ? ?????????????? 2-? ?????????????
????????????????? ??? ????-??????: ????-??????? ??? ???????? ????-
23
??????? ??????? V. cholerae ?????????? ? ? ? ? ? ? ? ? (?????) ? ??????????? ?????????? ? ? ? ? ? ? ? ? ? (??????) ??? ????????????? ?. coli
0157:?7. ?????? ????-??????? ????????? ???????? ??? ????????? ???????
(??????? ?????? LT-???????) ? ???? ???????? ??????? V. cholerae ? V. eltor.
?? ?????? ?????????? ????? ?????????? ???????? Vibrionaceae ?
Enterobacteriaceae ???????? ????? ???????????? ??????????, ???????
???????????? ??????? ??????????? ??????????? ??????? ?????????????? ??
??????? ????? ???????? ???????????? ????????? ???????? (?????? ? . ? ,
2001; ????? J . et al., 1997). ???? ????????? 35 ??????? ????????????????
???????? ?????? ?????????????, 8 ??????? S.sonnei ? 12 ???????
S.flexneri. ? ?????????? ???????????? ??????????? ?????? ?? ???? ????н
????, ? ?????????? ?? ??? ??????? ????????????????? 3 ?????? ?, coli ??н
?? ???????? 0127, ??? ???? ?????????????? ???? ???????? ? ? ? ????????
????? 300 ?.?. ?????????? ????????? ??????????????? ? ??????? ? ?.???
0127 ???????????? ???????? ??????? ? ????? ??????? ????????? ????????.
?????? ???? ??????? ???????.
?????? ??? ????-??????? ????????? ???????? ???? ????????????
???????? 1 ? 2 ( V T 1 , VT2) ? ????? ??????????? ???????? ?7 ?. coli
0157:?7. ??????????? ??????? ?????????????? ???? ??????????? ?? ??н
????? ????????? ????? ? ?? ??? ??????? ???????????? ?????? ? E I E C .
?????????? ? ???? ??????????? ???????????? ?????????? ?????????н
?????? ? ???????????????? ??????????????? ? ??????????? ???????? ??н
???????????? ???????????? ???????????, ????????????? ?? ????????????
(33,0%), ????????????? (22,6%) ? ??????????? (11,4%) ???????????????
(????.7).
??-????????, ??? ???? ???? ?????????????? ? ?????????? ??????н
???????? ? ?????????? ??????????? ??? ???????????? ???????????? ?
??????????-?????????.
24
??????? 7
?????????????????? ????? ???????? ????????????
? ??????????? ???????? ?????????????? (ii=368)
?????-????н
?????
Escherichia
Shigella
Salmonella
????? Enterobacteriaceae
???????н
????
??????? VT
(???.)
1
140
22
163
61
65
368
83
???????? ???? ???????? ????????????
(???.)
VT
LT
ST
ctxA
tcpA
?7
Inv
2
-
-
-
-
-
-
-
??
?????н
????
-
3
-
??
?????н
????
3
32
8
2
6
116
42
122
?? ???????????? ??????????? ????????????? ?? ???? ?????? ???????н
????? ???????? ?????? ???? VT1 (22,6%). ?????? ?? ?????? ????? ?????н
??????? (1994-1996?.?.) ?????????? ?????? ??????????? ?.???. ?????? ?
????????? ????? ??? VT1 ???? ??????????? ? ??????????? ????????
S.flexneri 2?. ???? ???? ??????????? ? ????????????? ??????? ? ???, ???
??? S.flexneri 2?, ???????????? ?????? ? ?????????????? ????????? ???н
????????? ?????????? ? ??, ? ???? ??????? ???????? ???????? ?????????
?????????, ? ??
Документ
Категория
Без категории
Просмотров
1
Размер файла
982 Кб
Теги
bd000103064
1/--страниц
Пожаловаться на содержимое документа